Drop Of Suspension Research Articles

THE MODEL OF DRYING SESSILE DROP OF COLLOIDAL SOLUTION

We have proposed and investigated a model of drying colloidal suspension drop placed onto a horizontal substrate in which the sol to gel phase transition occurs. The temporal evolution of volume fraction of the solute and the gel phase dynamics were obtained from numerical simulations. Our model takes into account the fact that some physical quantities are dependent on volume fraction of the colloidal particles.

Morphologic and mitochondrial characterization of human spermatogenic cells dispersed in wet preparation for testicular sperm extraction: establishment of a microscopic diagram of developing human spermatogenic cells

The successful identification of spermatozoa at microdissection testicular sperm extraction is critical and can depend on the judgment of experienced reproductive clinicians. Therefore, we characterized human spermatogenic cells based on stage-specific mitochondrial location and morphologic change by using a vital mitochondrion-specific fluorescent probe, Mitotracker, and stage-specific antibodies to make a useful microscopic diagram.

The influence of gravity on the distribution of the deposit formed onto a substrate by sessile, hanging, and sandwiched hanging drop evaporation

The focus of the present article is the study of the influence of gravity on the particle deposition profiles on a solid substrate during the evaporation of sessile, hanging and sandwiched hanging drops of colloidal particle suspensions. For concentrations of nanoparticles in the colloidal solutions in the range 0.0001–1 wt.%, highly diluted suspensions will preferentially form rings while concentrated suspensions will preferentially form spots in both sessile and hanging drop evaporation. For intermediary concentrations, the particle deposition profiles will depend on the nanoparticle aggregation dynamics in the suspension during the evaporation process, gravity and on the detailed evaporation geometry. The evaporation of a drop of toluene/carbon nanoparticle suspension hanging from a pendant water drop will leave on the substrate a circular spot with no visible external ring. By contrast, a clear external ring is formed on the substrate by the sessile evaporation of a similar drop of suspension sandwiched between a water drop and the substrate. From the application viewpoint, these processes can be used to create preferential electrical conductive carbon networks and contacts for arrays of self-assembled nanostructures fabricated on solid substrates as well as on flexible polymeric substrates.

Spectroscopic Ellipsometry Study on Refractive Index Spectra of Colloidal β-FeOOH Nanorods with Their Self-Assembled Thin Films

We prepared monodisperse colloidal β-FeOOH (square prismatic crystalline) nanorods. Self-assembled dry thin films of the rods were formed on quartz substrates by evaporating drops of repulsive-rod suspensions. Using spectroscopic ellipsometry, the complex refractive index spectra of the β-FeOOH nanorod films were deduced, which are further corrected on the basis of absorption spectra measured for β-FeOOH nanorod suspensions, with aid of the Kramers-Krönig relation and an optical two-phase mixing model. Simultaneously, in this correction process, the rod volume fraction in the films and the complex mean refractive index spectra of purely the rod were extracted together. The real part of the refractive index spectra of the β-FeOOH rod, n'(c)(λ), shows a maximal value of 2.365 (aver.) at 410 nm (λ(m)) (hence a normal dispersion at λ > λ(m) and an anomalous dispersion at λ < λ(m)). At λ = 589.3 nm (λ(D) for "sodium light"), the n'(c)(λ) value is consistent with refractive indices predicted by Gladstone-Dale's and Anderson's refractivity formulas with the density of the β-FeOOH rod, 3.638 ± 0.104 g/cm(3), measured in this work.

Severe Outbreak of Bacterial Canker Caused by Clavibacter michiganensis subsp. michiganensis on Tomato in Central Italy.

From May to July 2010, severe outbreaks of bacterial canker of tomato (Solanum lycopersicum L.) were observed in 16 fields in the Province of Viterbo, central Italy. Cultivars affected were Uno Rosso, Peto 1296, UG 812, UG 822, and Podium. Disease incidence ranged from 70 to 100% and was highest for Uno Rosso followed by UG 812, UG 822, Peto 1296, and Podium. Leaf symptoms initially appeared as interveinal, pale green, water-soaked areas that quickly turned yellow-brown to necrotic, resembling sunburn. Infected parts of the plants began to wilt and then die. Light yellow-to-brown streaks or cankers appeared on stems and the cankers darkened. As the disease progressed, affected stems split lengthwise and a pale yellow-to-reddish brown discoloration of the vascular tissue was observed. The pith of infected stems turned brown, granular to mealy, and filled with cavities. Dividing the stem into two pieces lengthwise revealed yellowing of vascular tissues in the fruits that otherwise was asymptomatic. Eventually, vascular wilting and premature death of entire plants were observed. Once a month, infected samples were randomly collected three times from each field from five plants. A gram-positive, nonmotile, nonspore forming, aerobic, curved, rod-shaped bacterium was consistently isolated onto nutrient broth yeast extract agar medium from symptomatic plant tissues. Strains tested positive for gelatin liquefaction, H2S production from peptone, utilization of citrate and negative for starch hydrolysis. Forty-five isolates were used to inoculate four-o'clock (Mirabilis jalapa L.) plants by injecting a bacterial suspension of the appropriate isolate in sterilized distilled water (108 CFU/ml) into leaves (1). Known strains of Clavibacter michiganensis subsp. michiganensis (DPP22) and Pseudomonas fluorescens (DPP09N) were used as positive and negative control treatments, respectively. Four leaves per plant and three plants were inoculated for each bacterial strain and control treatment. All 45 tomato field isolates and the known strain of C. michiganensis subsp. michiganensis produced a hypersensitive reaction within 48 h. Pathogenicity tests were performed on 3-week-old, potted tomato seedlings (cv. Ciliegino) by placing a drop of the appropriate bacterial suspension (108 CFU/ml) on wounds created by excising the leaf petiole. The inoculated plants were maintained at 26 ± 1°C in a greenhouse. The two control isolates were similarly inoculated onto tomato seedlings. After 15 days, all inoculated plants developed symptoms, whereas negative control plants remained asymptomatic. Bacteria reisolated from inoculated leaf lesions had the same characteristics as the original bacteria. A 1,400-bp region of the 16S rDNA was amplified from 15 of the 45 strains with primers NOC 1F (AGAGTTTGATCATGGCTCAG) and NOC 3R (ACGGTTACCTTGTTACGACTT) and sequenced (GenBank Accession Nos. HQ144228 to HQ144242; strains CmmVT1 to CmmVT15). A BlastN search of the sequences in GenBank revealed the tomato strains had 99 to 100% identity with the 16S rDNA sequences of C. michiganensis subsp. michiganensis strains (GenBank Accession Nos. EU 685335, AM711867, and AM410696). In Italy, this pathogen was first reported in 1914 in Vasto and later in a few other regions. However, to our knowledge, this is the first observation of widespread outbreaks in >300 ha of tomato fields with severe economic losses. Reference: (1) R. D. Gitaitis. Plant Dis. 74:58, 1990.

A rapid and simple method for determining fungicide resistance in Botrytis

A simple test based on the germination of conidia of Botrytis on agar media augmented with various fungicides has been developed. Average concentrations causing a 50% reduction of germ-tube growth (EC50) of highly sensitive isolates were determined on 1% malt extract agar (thiophanate-methyl 0.090 ppm; iprodione 0.566 ppm; fludioxonil 0.026 ppm; fenhexamid 0.144 ppm), 1% malt extract agar with 100 ppm salicyl hydroxamic acid (QoI fungicides, viz. trifloxystrobin 0.009 ppm; pyraclostrobin 0.013 ppm; azoxystrobin 0.087 ppm), 0.5% yeast extract agar (boscalid 0.069 ppm) and 0.5% sucrose agar (cyprodinil 0.053 ppm). In order to detect different levels of resistance against these various fungicides, two discriminatory concentrations were identified for each compound. A routine assay method was developed in which drops of a conidial suspension harvested directly from diseased plant material or sporulating cultures were incubated on each of 20 different agar media. Because of a very short time-span of 24–48 h between sample collection and evaluation of results, field-specific information on the occurrence, frequency and types of resistance of Botrytis against common botryticides in soft-fruit production may be generated prior to the main fungicide spray season at blossom time.

Nanobubble and nanodroplet template growth of particle nanorings versus nanoholes in drying nanofluids and polymer films

Here we demonstrate how confined nanobubbles and nanodroplets, which can either form spontaneously at the suspension/substrate interface, or can more interestingly be purposely introduced in the system, allow assembly of nanoparticles (NPs) into nanoring-like structures with a flexible control of both the size and distribution. As with most wetting-mediated nanopatterning methods, this approach provides an alternative to direct replication from templates. The formation of two-dimensional ring-shaped nanostructures was obtained by drying a nanocolloidal gold (Au) suspension drop confining nanobubbles (or nanodroplets) that are settled at a solid substrate. AFM investigation of the dry nanostructures showed the formation of isolated Au NPs rings having diameters ranging from 200 nm to 500 nm along the dewetting-drying path of the suspension drop. The flexibility of these wetting processes for the variation of the spatial features of the nanoring (size and shape resolution) essentially depends on physical parameters such as the nanobubble/nanodroplet size and concentration, the wettability, and the evaporation rate of the nanofluid drop on the substrate. Furthermore, we show that the underpinning mechanism of this evaporation-assisted assembly of Au NPs into supported functional nanoring patterns is fairly similar to that at work in the spontaneous formation of nanoholes in drying polymer thin films. Finally, the method proves to be a simple and flexible nanofabrication tool to be extended to various nanosize objects, towards specific optical and sensing applications.

238 ASSOCIATION BETWEEN SPERM MORPHOLOGY AND IN VITRO EMBRYO PRODUCTION IN MICE

Although sperm morphology affects male fertility in several species, normally, it is not considered for in vitro fertilization (IVF) programs in mice. In order to correlate sperm morphology with IVF rates in murines, a total of 3336 oocytes were used in 11 identical IVF replicates using 8-wk-old B6D2 F1 (C57BL/6 × DBA/2J) males and 3- to 4-wk-old C57BL/6J donors females. For each replicate, 10 females were injected intraperitoneally with 5 IU of eCG (Novormon, Syntex, Buenos Aires, Argentina), and 5 IU of hCG (Ovusyn, Syntex) 48 h apart. Superovulated females were killed 14 to 16 h after hCG injection. The oviducts were isolated and cumulus–oocyte complexes were recovered and introduced into each sperm suspension drop. Previously, sperm was obtained from males killed by cervical dislocation, the cauda epididymis were recovered, minced with fine scissors in equilibrated human tubal fluid medium (HTF, EmbryoMax, Chemicon International, Phillipsburg, NJ, USA), and resuspended in a total volume of 200 μL of HTF. The sperm suspension was incubated at 0.05 or 3 × 106 spermatozoa/mL concentration in equilibrated 100-μL drops of HTF under embryo tested mineral oil (Sigma, St. Louis, MO, USA), at 37°C in 5% CO2, 95% air for 1 h before insemination. To evaluate sperm morphology, a sample of each replicate was fixed with 10% formalin and observed under phase-contrast microscopy (Olympus IX81) at 100× magnification. Sperm abnormalities regarding head and neck, tail, and cytoplasmic droplet were recorded from 200 cells. Five hours after insemination, the fertilized eggs were washed and transferred in groups of 50 to 100 into 100-μL drops of equilibrated culture medium (KSOM, EmbryoMax, Chemicon International) under the same culture conditions. The number of 2- (cleavage) and 8- (development) cell embryos was scored after 24 and 72 h in culture, respectively. Statistical analysis was performed by logistic regression taking into account the effect of the sperm abnormalities, the replicate, and the sperm dose. The effect of the sperm abnormalities is shown in Table 1. Results were not significantly influenced by the replicate or the sperm dose (P &gt; 0.05). In conclusion, sperm morphology affects cleavage and embryo development rates in mice, and it should be taken into account as a source of variation in the success of IVF. Table 1.Effect of total sperm abnormalities on cleavage rate and embryo development in mice

Combustion of coal–water suspensions

Combustion technologies using coal–water suspensions create a number of new possibilities for organising combustion processes so that they fulfil contemporary requirements (e.g., in terms of the environment protection-related issues). Therefore, an in-depth analysis is necessary for examining the technical applications of coal in the form of a suspension as a fuel. The paper undertakes the complex study of coal–water suspension combustion in air and in the fluidised beds. This, according to the author, best simulates the conditions that should be satisfied in order to use the new “fuel” efficiently and ecologically. An important element of the study was the identification of coal–water suspension drops, its complex morphology and evolution in the combustion process. The mathematical model enables the prognosis for change of the surface and the centre temperatures and a mass loss of the coal–water suspension during combustion in air and in the fluidised bed.

Measurement of Nanoparticle Concentration Using Quartz Crystal Microgravimetry

Various nanoscale items (e.g., nanoparticles and nanotubes) have been actively investigated due to their unique physicochemical properties. A common issue encountered in such studies is accurate expression of nanoparticle concentration. Given the critical importance of the dose-response relationship, we present the use of quartz crystal microgravimetry (QCM) to accurately measure nanoparticle concentration in a colloidal suspension. Application of a small drop of the nanoparticle suspension in a volatile solvent to the crystal surface leaves a dry nanoparticle residue after solvent evaporation after which the shift in the crystal resonant frequency is recorded. The instrument was calibrated using a set of serial dilutions of Si and Ag nanopowder in methanol, rhodamine B in methanol, and ferrocene in cyclohexane. Using QCM, a linear response for nanoparticle concentrations up to 1300 μg/mL was determined. The developed method was used to determine the concentrations of size-selected, octyl-terminated Si nanocrystal samples with median diameters in the range 1.1-14.8 nm and also to calculate size-dependent nanocrystal extinction coefficients.

Hydrodynamic interactions suppress deformation of suspension drops in Poiseuille flow

Evolution of a suspension drop entrained by Poiseuille flow is studied numerically at a low Reynolds number. A suspension drop is modeled by a cloud of many nontouching particles, initially randomly distributed inside a spherical volume of a viscous fluid which is identical to the host fluid outside the drop. Evolution of particle positions and velocities is evaluated by the accurate multipole method corrected for lubrication, implemented in the HYDROMULTIPOLE numerical code. Deformation of the drop is shown to be smaller for a larger volume fraction. At high concentrations, hydrodynamic interactions between close particles significantly decrease elongation of the suspension drop along the flow in comparison to the corresponding elongation of the pure-fluid drop. Owing to hydrodynamic interactions, the particles inside a dense-suspension drop tend to stay for a long time together in the central part of the drop; later on, small clusters occasionally separate out from the drop, and are stabilized by quasiperiodic orbits of the constituent nontouching particles. Both effects significantly reduce the drop spreading along the flow. At large volume fractions, suspension drops destabilize by fragmentation, and at low volume fractions, by dispersing into single particles.

Bouncing behaviors of suspension liquid drops on a superhydrophobic surface

This paper reveals three patterns of bouncing behaviors of suspension drops containing calcium carbonate (CaCO3) powder on a superhydrophobic surface with the aid of a high-speed camera. In transmission electron microscopy (TEM) observation, the particles of CaCO3 are shaped like sticks whose equivalent diameters are about 700 nm. Unlike a pure water drop, dense suspension drops cannot be pinched off at the bounce on the superhydrophobic surface due to a high effective viscosity, whereas the equilibrium contact angle appears to be almost identical in all kinds of droplets.

First Report of Alternaria Leaf Blight on Bupleurum chinense Caused by Alternaria alternata in China.

Bupleurum chinense DC. (family Umbelliferae) is an important medicinal herb in traditional Chinese medicine and is cultivated as an economically important plant in China (2). From 2006 to 2009, severe foliar disease was observed on B. chinense in Haidian, Changping, and Shunyi districts, Beijing, China. Approximately 75 to 85% of fields were affected with disease incidence ranging from 65 to 90%. Distribution of the disease in affected B. chinense fields was generally associated with high soil moisture, often corresponding to poor drainage. Initial symptoms first appeared on older leaves as irregularly shaped, minute, dark brown-to-black spots, with yellow borders on the edge of the affected leaflet blade. As the disease progressed, the lesions expanded, causing the leaflets to turn brown, shrivel, and die. Isolations performed on potato dextrose agar (PDA) initially resulted in white colonies. After 7 days of incubation at 25°C, the colonies turned gray or brown. Conidia varied in size from 10 × 6 to 40 × 12 μm, appeared brown to dark brown or olive-brown, were short beaked and borne in long chains, oval and bean-shaped with one to six transverse septa and zero to three longitudinal septa. Sequences of the rDNA from the internal transcribed spacer regions 1 and 2 and the 5.8S gene were amplified using primers ITS1 and ITS4, were obtained from three isolates, and comparisons with GenBank showed 100% similarity with A. alternata (Genbank Accession No. AB470912.1). For pathogenicity tests, three isolates were grown on PDA for 14 days. Inoculations were performed on detached, surface-sterilized, and healthy B. chinense leaflets following the method of Belisario (1). A 5-μl drop of conidial suspension containing 1 × 105 CFU/ml was placed on each leaflet and 12 leaves per isolate were used. Leaves were incubated in a growth chamber (80 to 90% relative humidity; 50 to 60 klx/m2 light intensity with a 12-h photoperiod). After 5 days, leaf spots similar to the original symptoms developed on all inoculated leaves and A. alternata was consistently reisolated from symptomatic leaf tissues on PDA. Control leaflets inoculated with sterile water remained asymptomatic. The experiment was performed three times. To our knowledge, this is the first report of A. alternata on B. chinense from China.

Roles of adjuvants in aphicidal activity of enzymes from Beauveria bassiana (Ascomycota: Hypocreales) SFB-205 supernatant

Enzymes from Hypocrealean entomopathogenic fungi often encounter unfavorable abiotic and biotic factors during pathogenesis. The present work describes the roles of adjuvants, such as corn oil and polyoxyethylene-(3)-isotridecyl ether (TDE-3), in promoting aphicidal activity of enzyme precipitate from Beauveria bassiana SFB-205 supernatant. Supernatant enzymes including chitinase and proteases were lyophilized by attagel-mediated protein precipitation to produce attagel-mediated enzyme powder (AMEP). Corn oil-based AMEP + TDE-3 suspension showed 96.3% control efficacy against cotton aphids, Aphis gossypii Glover (Hemiptera: Aphididae), in glasshouse conditions at 2 days post-application, whereas water-based AMEP + TDE-3 suspension or TDE-3 alone showed < 20% efficacy. Corn oil-based AMEP + TDE-3 suspension was superior in degrading chitinase-specific substrate ( p-nitrophenyl-β- d-acetylglucosaminide) under a drying condition compared to water-based AMEP + TDE-3 suspension. TDE-3 made supernatant, a source material of AMEP, degraded more cotton aphid proteins than supernatant alone in SDS-polyacrylamide gel electrophoresis; supernatant was used to clearly show the degradation without interfering with other proteins such as AMEP. These results suggest that 1) corn oil can slow down the evaporation of the diluted suspension drop and provide more time for enzymes from AMEP to degrade more cuticles at the time of application and 2) TDE-3 can disrupt chitin–protein matrixes within procuticle and facilitate enzymes from AMEP in degrading proteins which increases the exposure of chitin fibers to the attack of chitinases. This approach can provide another strategy in developing biopesticides using entomopathogenic fungi.

First Report of Sour Rot Caused by Geotrichum citri-aurantii on Key Lime (Citrus aurantifolia) in Colima State, Mexico.

Sour rot caused by Geotrichum citri-aurantii (Ferraris) R. Cif. & F. Cif. (synonym G. candidum Link) is a disease that causes postharvest losses of lemon (Citrus limon Burm, f.), mandarin (C. reticulata Blanco), and orange (C. sinensis (L.) Osbeck) (2-4) worldwide, but it has not been described on key lime (C. aurantifolia (Chistm.) Swingle) from the State of Colima, Mexico. During the agricultural cycle from 2005 to 2007, 300 fruits of key lime were analyzed. Symptoms observed on approximately 40% of the fruits were wounds with a sour, fermented smell with 30% of the softened area covered with white mycelium. A Geotrichum sp. was isolated on potato dextrose agar (PDA). On the basis of morphological criteria (1) and sequencing the internal transcribed spacer (ITS1-5.8s-ITS2) region of rDNA (GenBank Accession No. EU131181), the fungus was identified as G. citri-aurantii. A sample of the fungus was deposited in the Biology Collection of Yeast and Fungi (Reg. No. CLT20) of Centro de Investigaciones Biológicas del Noroeste, Mexico. Key limes were inoculated with G. citri-aurantii by placing three drops (20 μl each) of a sterile water suspension of 106 arthroconidia/ml in three punctured wounds of 3-mm diameter produced with a sterile scalpel on the fruit surface. Ten plastic boxes with five fruit each were stored for 2 weeks at 20°C and 85% relative humidity. Sour rot symptoms on key lime inoculated with G. citri-aurantii were identical to fruit in the field. The control fruit inoculated with sterile water did not develop symptoms. The fungus was reisolated, confirming Koch's postulates. The test was repeated three times to confirm our diagnosis. To our knowledge, this is the first report of G. citri-aurantii causing sour rot on key lime in Colima, Mexico.

Quantitative Proteomics Analysis of Chondrogenic Differentiation of C3H10T1/2 Mesenchymal Stem Cells by iTRAQ Labeling Coupled with On-line Two-dimensional LC/MS/MS

The chondrogenic potential of multipotent mesenchymal stem cells (MSCs) makes them a promising source for cell-based therapy of cartilage defects; however, the exact intracellular molecular mechanisms of chondrogenesis as well as self-renewal of MSCs remain largely unknown. To gain more insight into the underlying molecular mechanisms, we applied isobaric tag for relative and absolute quantitation (iTRAQ) labeling coupled with on-line two-dimensional LC/MS/MS technology to identify proteins differentially expressed in an in vitro model for chondrogenesis: chondrogenic differentiation of C3H10T1/2 cells, a murine embryonic mesenchymal cell line, was induced by micromass culture and 100 ng/ml bone morphogenetic protein 2 treatment for 6 days. A total of 1756 proteins were identified with an average false discovery rate <0.21%. Linear regression analysis of the quantitative data gave strong correlation coefficients: 0.948 and 0.923 for two replicate two-dimensional LC/MS/MS analyses and 0.881, 0.869, and 0.927 for three independent iTRAQ experiments, respectively (p < 0.0001). Among 1753 quantified proteins, 100 were significantly altered (95% confidence interval), and six of them were further validated by Western blotting. Functional categorization revealed that the 17 up-regulated proteins mainly comprised hallmarks of mature chondrocytes and enzymes participating in cartilage extracellular matrix synthesis, whereas the 83 down-regulated were predominantly involved in energy metabolism, chromatin organization, transcription, mRNA processing, signaling transduction, and cytoskeleton; except for a number of well documented proteins, the majority of these altered proteins were novel for chondrogenesis. Finally, the biological roles of BTF3l4 and fibulin-5, two novel chondrogenesis-related proteins identified in the present study, were verified in the context of chondrogenic differentiation. These data will provide valuable clues for our better understanding of the underlying mechanisms that modulate these complex biological processes and assist in the application of MSCs in cell-based therapy for cartilage regeneration.

How walls influence destabilization of a suspension drop settling under gravity in a viscous fluid?

An experiment was performed to test the influence of walls on destabilization of a suspension drop settling under gravity in a viscous fluid in the low Reynolds number regime. The averaged distance the drop settled until destabilization was determined. In was found that in the presence of one or two parallel vertical walls close by, the destabilization length is shorter than in an unbounded fluid.

Assemblies of poly(styrene/⇌-tert-butoxy-ω-vinyl-benzyl-poryglycidol) Microspheres with different diameters deposited on mica plates

Formation of poly(styrene/α-tert-butoxy-ω-vinyl-benzyl-polyglycidol) microsphere assemblies on mica plates modified with 3-aminopropyltriethoxysilane was investigated. Microsphere assemblies contained two types of particles similar with respect of their chemical structure but with different diameters (D n = 1000 and 350 nm). Methods of particle deposition included: deposition from water suspension of a mixture of small and large particles on mica plates placed at the bottom of suspension container, deposition of particles from a drop of ethanol suspension (containing large and small microspheres) placed on the mica substrate, deposition of microspheres on modified mica plates crossing the liquid-air interface-sequential deposition of large and small particles, and one-batch deposition from a mixed water suspension of large and small microspheres. Deposition from water suspension containing large and small microspheres on plates placed on the bottom of suspension container yielded assemblies with large particles randomly distributed among the small ones. Fraction of large particles in adsorbed particle assembly was smaller than fraction of large particles in suspension. Particle assemblies prepared by placement of ethanol suspension of large and small microspheres on mica were composed of quite regularly distributed large particles among the small ones. A two step process consisting of withdrawal of mica plate from water suspension of large particles and then on using this plate as substrate in a second step during which the plate was withdrawn from suspension of small particles yielded particle assemblies containing aggregates of large particles randomly distributed among the small ones. Withdrawal of mica plates from water suspension of large and small microspheres resulted in particle assemblies composed of regularly distributed stripes of large and small microspheres. Formation of the described above microsphere assemblies is possible only in case of reversible adsorption of particles.

Distribution of bone marrow stem cells in large porous polyester scaffolds

This work examined the optimal syringing depth during in vitro cell loading in order to even cell distribution after syringing a drop of cell suspension in cylinder poly(lactide-co-glycolide) (PLGA) porous scaffolds. The scaffolds of 10 mm height and 10 mm diameter were fabricated via room-temperature compression molding & particulate leaching technique based on spherical porogens. In vitro tests were employed for such examinations: a global observation of a cell-loaded scaffold stained by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) technique and a quantitative measurement of spatial distribution of cells after slicing the cell-loaded scaffolds into layers. It was found that an even distribution of cells was soon achieved only if the initial cell suspension was seeded on the layer that was below the top surface but above the middle of scaffolds. The availability of in vitro osteoblastic differentiation of rat bone marrow stem cells in such a kind of spherical-pore PLGA scaffolds was meanwhile confirmed.

Preparation of 0.05% FK506 Suspension Eyedrops and Its Pharmacokinetics After Topical Ocular Administration

To investigate the stability of FK506 eye suspension and its pharmacokinetics in rabbit aqueous humor, as well as its distribution in eye tissues. Sedimentation rate, flocculation value, redispersion time, rheological study, and accelerated experiment were determined for evaluating the stability of FK506 suspension. In a single-dose pharmacokinetic study, six rabbits were instilled a 25-microL drop of 0.05% FK506 suspension and aqueous humor samples were collected at different intervals after administration. In a multiple-dose pharmacokinetic study, a 25-microL drop of FK506 suspension was instilled into the right eye of six rabbits four times a day for 7 days. On the eighth day, aqueous humor samples were collected before the administration of the first, second, third dose, and at different checkpoints after the third dose. For tissue distribution study, six eyes per time points (18 rabbits in total) were treated with single dose of FK506 suspension, and the eyes were enucleated at 60, 100, and 240 min after treatment, then eye tissues were collected. The concentrations of FK506 in all samples were determined by LC-MS/MS. The preliminary results indicated that the stability of FK506 suspension was in accord with the standards of Chinese pharmacopoeia. The maximum concentrations of aqueous humor after single dose and multiple dose administrations were 31.40 +/- 9.32 ng/mL and 37.73 +/- 11.25 ng/mL, respectively. The concentration of FK506 in cornea at 60, 100, and 240 min after a single dose were 402.0 +/- 96.8 ng/g, 363.8 +/- 84.5 ng/g, and 220 +/- 62.3 ng/g, respectively. Determination of pharmacokinetic parameters of single-dose and multiple-dose administration, as well as the FK506 concentrations in eye tissues, showed that the FK506 formulation and the dosing regimen ensured the therapeutic concentration of FK506 for treating corneal allograft rejection. Based on the stability, single-dose and multiple-dose pharmacokinetics, and tissue distribution, FK506 suspension eyedrops may be a suitable candidate for clinical application in ophthalmology.