Dot Blot Method Research Articles

1169P - Validation of novel diagnostic kits using the semi-dry dot-blot method for detecting metastatic lymph nodes in breast cancer; distinguishing macrometastases and micrometastases

1169P - Validation of novel diagnostic kits using the semi-dry dot-blot method for detecting metastatic lymph nodes in breast cancer; distinguishing macrometastases and micrometastases

Evaluation of immunologic response of salivary sIg-A in pediatric tuberculosis patients to antigen Ag38-rec of Mycobacterium tuberculosis Indonesian strain

Objective: We studied the immune response of salivary secretory immunoglobulin A (sIg-A) from a pediatric tuberculosis (TB) group (scoring ≥6) and non-TB group (scoring <6) against recombinant Ag38 (Ag38-rec) fromMycobacterium tuberculosis Indonesian strain.Materials and Methods: Seventy-eight children were divided into three groups; those with TB (n=26), those with suspected TB (n=26), and healthy children (n=26), their saliva was collected, and salivary sIg-A was challenged with purified Ag38-rec using the dot blot method. A change of color from white to dark blue indicated a positive reaction.Results: The immune response of sIg-A of children with TB and those with suspected TB to Ag38-rec was not significantly different. In the TB group, Ag38-rec showed a higher sensitivity than protein purified derivative (PPD) (70.8% vs. 62.5%), but a lower specificity (26.9% vs. 34.62%). However, within both groups (scoring ≥6) as well as non-TB group (scoring <6) Ag38-rec was able to identify children with a positive TST (tuberculin skin test) better than PPD.Conclusion: The antigen Ag38-rec could not distinguish between children with TB (scores ≥6 and <6). However, it demonstrated the potential of Ag38-rec for use in screening for TB infection among children with suspect TB (scores <6).

Anti-DFS70 antibodies detected by immunoblot methods: A reliable tool to confirm the dense fine speckles ANA pattern

BackgroundAutoantibodies to the DFS70 (dense fine speckles 70) protein have been identified among the antinuclear antibodies (ANA) in patients with various disorders. However, the ANA test in indirect immunofluorescence (IIF) is not a reliable method to identify anti-DFS70 antibodies. We undertook this study to evaluate the diagnostic performance of two new immunoblot methods for the detection of anti-DFS70 antibodies and to investigate whether their different DFS70 antigen composition could affect diagnostic accuracy in detecting anti-DFS70 antibodies. Methods62 samples showing a DFS70 staining pattern by IIF were tested by dot blot (Alphadia) and line blot (Euroimmun) methods. The dot blot method employs a truncated sequence of the DFS70 antigen (residues 349-435), while the line blot uses the full-length protein (aa 1-530). The 62 samples were previously assayed by a chemoluminescent (CLIA) method also using a truncated antigen (aa 349-435): 27 were CLIA positive and 35 were CLIA negative. 120 sera from subjects with infectious diseases were used as controls. ResultBoth immunoblot methods were positive in the 27 IIF/CLIA positive samples; in addition, the Alphadia dot blot identified another seven DFS70 samples and the Euroimmun line blot was positive in five samples that were negative by CLIA. Among the 120 control samples, two false positives were recorded for the CLIA method, six for the Alphadia method and four for the Euroimmun method. Therefore, in this selected series of samples, sensitivity and specificity were 43.5% and 98.3% for the CLIA method, 54.8% and 95% for the dot blot and 51.6% and 96.6% for the line blot, respectively. ConclusionsBecause of great inconsistency in assessing the DFS70 pattern using the ANA-IIF test, specific assays should be used to confirm anti-DFS70 antibodies. The results of this study show that there is no difference in the overall diagnostic accuracy among methods that use the truncated or the full-length DFS70 antigenic sequence and that it is likely that antibodies directed against antigens other than DFS70 may be responsible for producing a DFS70-like ANA-IIF pattern.

Antimicrobial and antioxidant activity and chemical characterisation of Erythrina stricta Roxb. (Fabaceae)

Ethnopharmacological relevanceThe bark of Erythrina stricta Roxb. (Fabaceae) has been used in Indian indigenous systems as a remedy for rheumatism, stomach-ache, asthma, dysentery, contact dermatitis, eczema and skin infections. However, there have been limited phytochemical or biological studies on the bark of E. stricta and there are no studies that align with its traditional medicinal uses. Aim of the studyThe aim of this study was to assess the antimicrobial and antioxidant activity of the stem bark of E. stricta to support its topical use in the treatment of contact dermatitis, eczema and skin infections and to isolate and identify any bioactive compounds. Materials and methodsMTT microdilution and disc diffusion assays were used to determine the antimicrobial activities of n-hexane, dichloromethane, ethyl acetate, methanol and water extracts of the bark of E. stricta. Column and preparative thin layer chromatography were used for the purification of the dichloromethane extract. The structures of the compounds isolated were elucidated by extensive 1D and 2D NMR spectroscopic techniques and comparison with published data. The antioxidant activities of the extracts were determined by DPPH free radical scavenging and FRAP assays and the antioxidant activity of the pure compounds by dot-blot and DPPH staining methods. ResultsThe dichloromethane, ethyl acetate, and n-hexane extracts showed the most significant activity with MIC values of 7.8µg/mL, 125µg/mL, and 125µg/mL against a sensitive strain of Staphylococcus aureus. The dichloromethane and ethyl acetate extracts also showed significant activity against Candida albicans with MIC values of 125µg/mL and 1mg/mL respectively. GC-MS analysis of the n-hexane extract showed the presence of the antibacterial and antifungal compounds β-caryophyllene, caryophyllene oxide, α-selinene, β-selinene, selin-11-en-4-α-ol, α-copaene and δ-cadenine. Phytochemical studies of the dichloromethane extract led to the isolation of the novel compound erynone (1), together with six known compounds; wighteone (2), alpinum isoflavone (3), luteone (4), obovatin (5), erythrinassinate B (6) and isovanillin (7). Luteone (4) exhibited the most significant antibacterial activity with minimum inhibitory quantity (MIQ) values of 1.88µg, 1.88µg and 3.75µg, respectively, against sensitive (MSSA) and resistant strains (MRSA and MDRSA) of S. aureus using a TLC bioautography assay. Erynone (1) exhibited the greatest DPPH free radical scavenging activity. ConclusionsSeven compounds, including a new chromanone, were isolated from the antimicrobial dichloromethane extract of the stem bark of E. stricta. Six of the seven compounds showed antibacterial and/or antioxidant activities. These findings provide support for the customary (traditional and contemporary) use of E. stricta bark for the treatment of skin and wound infections.

Evaluation of immunologic response of salivary sIg-A in pediatric tuberculosis patients to antigen Ag38-rec of Mycobacterium tuberculosis Indonesian strain

Objective: We studied the immune response of salivary secretory immunoglobulin A (sIg-A) from a pediatric tuberculosis (TB) group (scoring ≥6) and non-TB group (scoring <6) against recombinant Ag38 (Ag38-rec) fromMycobacterium tuberculosis Indonesian strain.Materials and Methods: Seventy-eight children were divided into three groups; those with TB (n=26), those with suspected TB (n=26), and healthy children (n=26), their saliva was collected, and salivary sIg-A was challenged with purified Ag38-rec using the dot blot method. A change of color from white to dark blue indicated a positive reaction.Results: The immune response of sIg-A of children with TB and those with suspected TB to Ag38-rec was not significantly different. In the TB group, Ag38-rec showed a higher sensitivity than protein purified derivative (PPD) (70.8% vs. 62.5%), but a lower specificity (26.9% vs. 34.62%). However, within both groups (scoring ≥6) as well as non-TB group (scoring <6) Ag38-rec was able to identify children with a positive TST (tuberculin skin test) better than PPD.Conclusion: The antigen Ag38-rec could not distinguish between children with TB (scores ≥6 and <6). However, it demonstrated the potential of Ag38-rec for use in screening for TB infection among children with suspect TB (scores <6).

Abstract P3-01-18: Validation of a novel diagnostic kit using the semi-dry dot-blot method for detecting metastatic lymph nodes in breast cancer

Abstract Background: The semi-dry dot-blot (SDB) method is a diagnostic procedure for detecting lymph node (LN) metastases. The metastases are visualized by the presence of cytokeratin (CK) with lavage fluid of sectioned LNs by anti-pancytokeratin antibody, based on the theory that epithelial components such as CK are not found in normal LNs. We previously reported 93.3% sensitivity, 96.9% specificity, and 96.6% accuracy for this method in detecting metastasis in sentinel LNs, compared with permanent pathological diagnosis in breast cancer. In this study, we evaluated a novel kit that applies the SDB method using the newly developed anti-CK19 antibody for diagnosing LN metastases in breast cancer. Methods: We obtained 141 LNs dissected from 81 breast cancer patients from July 2013 to April 2015 at Nagasaki University Hospital and the Japanese Red Cross Nagasaki Genbaku Hospital, including 33 dissected axillary LNs and 108 sentinel LNs, which were sliced at 2-mm intervals and washed with phosphate-buffered saline. The suspended cells in the lavage fluid of sliced LNs were centrifuged to collect the cell pellet and lysed with lysis buffer to extract protein. This extracted protein was used with the kit to diagnose LN metastasis. The washed LNs were blindly diagnosed by pathologists using hematoxylin and eosin (H&E) stain. Diagnoses based on the kit were compared with their H&E counterparts. Results: Of the 141 LNs, 57 were assessed as positive and 84 as negative by permanent pathological examination with H&E. Use of the kit resulted in correct diagnoses in 46 of the 57 pathologically positive cases and all of pathologically negative cases. Sensitivity, specificity and accuracy of the kit in detecting LN metastases were 80.7% (95% confidence interval [95% CI]: 75.6–80.7%), 100% (95% CI: 96.5–100%), and 92.2% (95% CI: 88.1–92.2%), respectively. In 11 false-negative cases, there were 9 micrometastases; therefore, sensitivity was 95.5% (95% CI: 90.1–95.5%) in cases of macrometastases. Diagnosis was achieved in approximately 20 min using the kit, reducing the diagnostic time by half compared with the original SDB method. The cost of this kit was within 8 USD, and we are currently developing an improved kit for the detection of smaller metastases. Conclusions: The kit in our study is accurate, quick, and cost-effective in diagnosing LN metastases without the loss of LN tissue. Its sensitivity in detecting macrometastases is excellent, which is important in clinical practice. Citation Format: Otsubo R, Hirakawa H, Oikawa M, Shibata K, Tanaka A, Matsumoto M, Yano H, Nagayasu T. Validation of a novel diagnostic kit using the semi-dry dot-blot method for detecting metastatic lymph nodes in breast cancer. [abstract]. In: Proceedings of the Thirty-Eighth Annual CTRC-AACR San Antonio Breast Cancer Symposium: 2015 Dec 8-12; San Antonio, TX. Philadelphia (PA): AACR; Cancer Res 2016;76(4 Suppl):Abstract nr P3-01-18.

The relationship between the presence of autoantibodies, indicators of local and systemic inflammation, the serum concentration of B-cell activating factor (BAFF) and the intensity of salivary gland infiltration in patients with primary Sjögren's syndrome - a preliminary study.

ObjectivesThe aim of this study was to find markers related to activation of B cells, which show a correlation with the systemic inflammation markers – erythrocyte sedimentation rate and C-reactive protein and with the intensity of in situ inflammation.Material and methodsForty-one primary Sjögren's syndrome (pSS) patients (33 female, 8 male) of the mean age 52.9 ±15 years were included. A group of 20 healthy volunteers was applied as a control. Erythrocyte sedimentation rate (ESR), concentration of gamma-globulins, C-reactive protein (CRP) and rheumatoid factor (RF) were measured by routine laboratory tests. Titres of antinuclear antibodies (ANAs) were determined by the indirect immunofluorescence method, while anti-SS-A/SS-B antibodies were detected by both the dot-blot method and an enzyme immunoassay. The concentrations of BAFF in sera were measured by sandwich ELISA. Biopsies of minor salivary glands were taken and the focus score (FS) was calculated. Correlations between quantitative variables were assessed using the Spearman correlation coefficient (r).ResultsSerum concentrations of BAFF was significantly higher in the pSS patients than in the control group. The study revealed a statistically significant correlation between ANAs titre and the FS (r = 0.421).Anti-SS-A/Ro and anti-SS-B/La antibodies positively correlated with ESR. There was also a positive correlation between the gamma globulin level and the titres of all tested autoantibodies.ConclusionsThe positive correlation between ANAs and FS confirms the importance of these autoantibodies in the local inflammatory process. The positive correlation between anti-SS-A/SS-B antibodies and ESR suggests involvement of these antibodies in generalization of the inflammatory response. In the pSS group serum concentrations of BAFF were statistically significantly higher than healthy volunteers. All presented results confirm the role of activity of B cells in the course of pSS.

Evaluation of immunologic response of salivary sIg-A in pediatric tuberculosis patients to antigen Ag38-rec of Mycobacterium tuberculosis Indonesian strain

Objective: We studied the immune response of salivary secretory immunoglobulin A (sIg-A) from a pediatric tuberculosis (TB) group (scoring > and =6) and non-TB group (scoring <6) against recombinant Ag38 (Ag38-rec) fromMycobacterium tuberculosis Indonesian strain.Materials and Methods: Seventy-eight children were divided into three groups; those with TB (n=26), those with suspected TB (n=26), and healthy children (n=26), their saliva was collected, and salivary sIg-A was challenged with purified Ag38-rec using the dot blot method. A change of color from white to dark blue indicated a positive reaction.Results: The immune response of sIg-A of children with TB and those with suspected TB to Ag38-rec was not significantly different. In the TB group, Ag38-rec showed a higher sensitivity than protein purified derivative (PPD) (70.8% vs. 62.5%), but a lower specificity (26.9% vs. 34.62%). However, within both groups (scoring > and =6) as well as non-TB group (scoring <6) Ag38-rec was able to identify children with a positive TST (tuberculin skin test) better than PPD.Conclusion: The antigen Ag38-rec could not distinguish between children with TB (scores > and =6 and <6). However, it demonstrated the potential of Ag38-rec for use in screening for TB infection among children with suspect TB (scores <6).

Development of a dot blot assay with antibodies to recombinant "core" 14-3-3 protein: Evaluation of its usefulness in diagnosis of Creutzfeldt-Jakob disease.

Background and Purpose:Definitive diagnosis of Creutzfeldt–Jakob disease (CJD) requires demonstration of infective prion protein (PrPSc) in brain tissues by immunohistochemistry or immunoblot, making antemortem diagnosis of CJD difficult. The World Health Organization (WHO) recommends detection of 14-3-3 protein in cerebrospinal fluid (CSF) in cases of dementia, with clinical correlation, as a useful diagnostic marker for CJD, obviating the need for brain biopsy. This facility is currently available in only a few specialized centers in the West and no commercial kit is available for clinical diagnostic use in India. Hence the objective of this study was to develop an in-house sensitive assay for quantitation of 14-3-3 protein and to evaluate its diagnostic potential to detect 14-3-3 proteins in CSF as a biomarker in suspected cases of CJD.Materials and Methods:A minigene expressing the “core” 14-3-3 protein was synthesized by overlapping polymerase chain reaction (PCR) and the recombinant protein was produced by employing a bacterial expression system. Polyclonal antibodies raised in rabbit against the purified recombinant protein were used for developing a dot blot assay with avidin-biotin technology for signal amplification and quantitation of 14-3-3 protein in CSF.Results:The results in the present study suggest the diagnostic potential of the dot blot method with about 10-fold difference (P< 0.001) in the CSF levels of 14-3-3 protein between the CJD cases (N= 50) and disease controls (N= 70). The receiver operating characteristic (ROC) analysis of the results suggested an optimal cutoff value of 2 ng/mL.Conclusions:We have developed an indigenous, economical, and sensitive dot blot method for the quantitation of 14-3-3 protein in CSF.

Cross-species PCR and field studies on Paulownia elongata: A potential bioenergy crop

AbstractPaulownia elongata is a short-rotation fast growing tree and is known for high biomass accumulation and carbon sequestration potential. Optimization of protocols for nucleic acid extraction, PCR, RT-PCR, and other molecular biology techniques are required for better understanding of cellulose synthesis and to assess the potential of Paulownia as a biofuel tree. The main objective of this work was to study a putative cellulose synthase amplicon expression under various environmental conditions and evaluate the potentials of Paulownia as a biofuel tree. Using cross-species PCR an amplicon representative of a putative cellulose synthase gene from Paulownia was identified. This 177-bp long DNA sequence was 46% similar with cellulose synthase genes from Arabidopsis as expected. Gene specific primers for this particular Paulownia cellulose synthase gene were designed and reverse transcription PCR was performed to confirm its transcription. We report an inexpensive cDNA dot-blot method to study expression of this gene under various environmental conditions. We observed that cold and, to a lesser extent, heat stress downregulated its expression. This information will help to understand cellulose deposition in plant cell wall under stressful conditions. To the best of our knowledge this is the first characterization of a cDNA sequence from Paulownia elongata.

Evaluation of immunologic response of salivary sIg-A in pediatric tuberculosis patients to antigen Ag38-rec of Mycobacterium tuberculosis Indonesian strain

Objective: We studied the immune response of salivary secretory immunoglobulin A (sIg-A) from a pediatric tuberculosis (TB) group (scoring of 6) and non-TB group (scoring &lt;6) against recombinant Ag38 (Ag38-rec) fromMycobacterium tuberculosis Indonesian strain.Materials and Methods: Seventy-eight children were divided into three groups; those with TB (n=26), those with suspected TB (n=26), and healthy children (n=26), their saliva was collected, and salivary sIg-A was challenged with purified Ag38-rec using the dot blot method. A change of color from white to dark blue indicated a positive reaction.Results: The immune response of sIg-A of children with TB and those with suspected TB to Ag38-rec was not significantly different. In the TB group, Ag38-rec showed a higher sensitivity than protein purified derivative (PPD) (70.8% vs. 62.5%), but a lower specificity (26.9% vs. 34.62%). However, within both groups (scoring of 6) as well as non-TB group (scoring &lt;6) Ag38-rec was able to identify children with a positive TST (tuberculin skin test) better than PPD.Conclusion: The antigen Ag38-rec could not distinguish between children with TB scores of 6 and &lt;6.1. However, it demonstrated the potential of Ag38-rec for use in screening for TB infection among children with suspect TB (scores &lt;6).

A Development of Homolog Sequence of Eimeria tenella Partial Genome as a Probe for Molecular Diagnosis of Coccidiosis

The goal of the research was to develop a homolog sequence of Eimeria tenella partial genome as a molecularprobe for diagnose coccidiosis using dot blot method. A probe of homolog sequence of E.tenella partial genomeand a non radioactive label, dig-11-dUTP, were used for this research. Four concentrations of molecular probelabeled with dig-11-dUTP, namely, 158,33 pg/μl, 52,25 pg/μl, 15,83 pg/μl and 5,225 pg/μl were tested to detect0,6551 μg DNA target. The procedure of labeling and hybridization detection between DNA target with themolecular probe labeled with dig-11-dUTP were carried out with Digh high prime DNA labeling and detectionstarter Kit I. The conclusion of the research was that 52,25 pg/μl molecular probe or more which its sequenceGGCA CAGTATCCTCCTTCAGGGCAGGG CTCGCACTGGTCAAA CGCGG TAC CATT could detect DNAtarget by dot blot method.Keywords: coccidiosis, E. tenella genome, molecular probe, dot blot hybridization

Efficient Cadmium Bioaccumulation by Displayed Hybrid CS3 Pili: Effect of Heavy Metal Binding Motif Insertion Site on Adsorption Capacity and Selectivity

The objective of this study was to evaluate the influence of insertion site of the metal binding motif on the bioaccumulation capacity of the hybrid CS3 pili displayed on the surface of Escherichia coli using both computational and experimental methods. Two metal binding motifs (cadmium binding motif (cbm) and cadmium binding beta motif (cbβm)), identified by searching against the PROSITE database, were inserted into five putative permissive sites of CstH protein (CS3 pili subunit) by using SOEing PCR technique. The expression and surface display of the hybrid pili were evaluated using dot and Western blotting methods and also immunofluorescence microscopy. The cadmium binding affinity and selectivity of the recombinant bacteria displaying various hybrid pili were evaluated using atomic absorption procedure. The results showed that the cadmium binding motifs enabled the cells to sequester cadmium 8- to 16-fold higher than the E.coli expressing native pili. The location of the metal binding motifs in the pili subunit had also a significant effect on the metal-binding properties of the hybrid pili. The insertion at positions 107-108 and 92-93 of the mature CstH showed the highest adsorption in comparison to other positions.

Prion protein and its interactions with metal ions (Cu2+, Zn2+, and Cd2+) and metallothionein 3

The effects of heavy metals (Zn 2+ , Cu 2+ , and/or Cd 2+ ) on Escherichia coli expressing either prion (hPrP C ) or metallothionein 3 (MT-3) brain proteins capable of binding these metals were investigated. The expression of hPrP C or MT-3 in E.coli was confirmed using western-blot and dot-blot methods. After analyzing growth curves, we found that bacteria expressing prion protein better tolerated the presence of Zn 2+ in comparison with wild-type bacteria and bacteria expressing MT-3. The addition of Cd 2+ and Cu 2+ was well tolerated by bacteria expressing MT-3, whereas the bacteria expressing prion protein displayed slower growth when compared to the wild-type. We subsequently determined total content of the MT in bacteria using differential pulsed voltammetry (DPV), and depending on the treatment of the individual metals. MT expression in MT3 transformed cells as well as in control E.coli cells increased at the lowest metal concentration (25 µM), followed by a decrease at higher metal concentrations (50, 75, and 150 µM). The highest increase by Cd 2+ were observed. MT expression pattern in hPrP C transformed cells was different. After application of Cu 2+ an increase in MT expression continued also at higher metal concentrations; and after application of Cd 2+ and Zn 2+ no decrease in MT expression at higher metal concentrations was observed.

HIV-1 Structural Proteins Serve as PAMPs for TLR2 Heterodimers Significantly Increasing Infection and Innate Immune Activation.

Immune activation is critical to HIV infection and pathogenesis; however, our understanding of HIV innate immune activation remains incomplete. Recently we demonstrated that soluble TLR2 (sTLR2) physically inhibited HIV-induced NFκB activation and inflammation, as well as HIV-1 infection. In light of these findings, we hypothesized that HIV-1 structural proteins may serve as pathogen-associated molecular patterns (PAMPs) for cellular TLR2 heterodimers. These studies made use of primary human T cells and TZMbl cells stably transformed to express TLR2 (TZMbl-2). Our results demonstrated that cells expressing TLR2 showed significantly increased proviral DNA compared to cells lacking TLR2, and mechanistically this may be due to a TLR2-mediated increased CCR5 expression. Importantly, we show that HIV-1 structural proteins, p17, p24, and gp41, act as viral PAMPs signaling through TLR2 and its heterodimers leading to significantly increased immune activation via the NFκB signaling pathway. Using co-immunoprecipitation and a dot blot method, we demonstrated direct protein interactions between these viral PAMPs and TLR2, while only p17 and gp41 bound to TLR1. Specifically, TLR2/1 heterodimer recognized p17 and gp41, while p24 lead to immune activation through TLR2/6. These results were confirmed using TLR2/1 siRNA knock down assays which ablated p17 and gp41-induced cellular activation and through studies of HEK293 cells expressing selected TLRs. Interestingly, our results show in the absence of TLR6, p24 bound to TLR2 and blocked p17 and gp41-induced activation, thus providing a novel mechanism by which HIV-1 can manipulate innate sensing. Taken together, our results identified, for the first time, novel HIV-1 PAMPs that play a role in TLR2-mediated cellular activation and increased proviral DNA. These findings have important implications for our fundamental understanding of HIV-1 immune activation and pathogenesis, as well as HIV-1 vaccine development.

Molecular Basis of β-Thalassemia in the Population of the Aegean Region of Turkey: Identification of A Novel Deletion Mutation

β-Thalassemia (β-thal) is the most common monogenic disorder in Turkey. The aim of this study was to investigate the spectrum of β-thal mutations in the Aegean region of Turkey. The data was derived from 1171 unrelated β-thal subjects, detected in a regional reference hospital between November 2004 and December 2013. Screening for the 22 common mutations was performed using the polymerase chain reaction (PCR)-reverse dot-blot method, and direct automated DNA sequencing for the unknown samples. Thirty-one different β-thal alleles were identified. Seven mutations, namely IVS-I-110 (G > A) (41.7%), IVS-I-1 (G > A) (8.9%), IVS-II-745 (C > G) (8.6%), codon 8 (–AA) (7.7%), IVS-II-1 (G > A) (7.2%), IVS-I-6 (T > C) (6.6%), codon 39 (C > T) (4.6%) accounted for 85.3% of the mutated alleles. Frequencies of the remaining 24 β-thal mutations were less than 2.2%; these included one novel mutation [HBB: c.206_212del (p.Leu69Profs*19)], and four others [–56 (G > C), codon 16 (–C), IVS-I (–3) (C > T) (codon 29), codon 76 (–C)] found in Turkey for the first time. The results will help to prevent severe β-thal through genetic counseling and prenatal diagnosis (PND) in the Aegean region of Turkey.

Accuracy of Reverse Dot-Blot PCR in Detection of Different β-Globin Gene Mutations.

Prevention programs for β-thalassemia based on molecular diagnosis of heterozygous carriers and/or patients require the use of reliable mutation screening methods. The aim of this study was to compare between direct DNA sequencing, and reverse dot-blot PCR in detection of different β-globin gene mutations in Egyptian children with β-thalassemia. Forty children with β-thalassemia were subjected to mutation analysis, performed by both direct DNA sequencing and β-globin Strip Assay MED™ (based on reverse dot-blot PCR). The most frequent mutant alleles detected by reverse dot-blot PCR were; IVSI-110 G>A (31.25%), IVS I-6 T>C (21.25%), and IVS I-1 G>A (20%). Relatively less frequent mutant alleles detected by reverse dot-blot PCR were "IVSII-1 G>A (5%), IVSII-745 C>G (5%), IVSII-848 C>A (2.5%), IVSI-5 G>C (2.5%), -87 C>G(2.5%), and cd39 C>T (2.5%)", While the genotypes of three patients (6 alleles 7.5%) were not detected by reverse dot-blot PCR. Mutant alleles detected by direct DNA sequencing were the same as reverse dot-blot PCR method except it revealed the genotypes of 3 undetected patients (one patient was homozygous IVSI-110 G>A, and two patients were homozygous IVS I-1 G>A. Sensitivity of the reverse dot-blot PCR was 92.5% when compared to direct DNA sequencing for detecting β-thalassemia mutations. Our results therefore suggest that, direct DNA sequencing may be preferred over reverse dot-blot PCR in critical diagnostic situations like genetic counseling for prenatal diagnosis.

Validation of a novel diagnostic kit using the semi-dry dot-blot method for detecting metastatic lymph nodes in breast cancer.

e22129 Background: The semi-dry dot-blot (SDB) method is a diagnostic procedure for detecting lymph node (LN) metastases. The metastases are visualized by the presence of cytokeratin (CK) with lava...

Abstract P2-01-23: Validation of diagnostic procedure for metastatic lymph nodes in breast cancer using a semi-dry dot-blot method and novel anti-cytokeratin 18+19 antibodies

Abstract Introduction: Sentinel lymph node (SLN) biopsy is a common diagnostic procedure for breast cancer. However, because of a shortage of pathology specialists in Japan and discordance between intra-operative and final pathological diagnoses of SLN metastasis, new diagnostic modalities are desperately required. We previously reported a novel method of detecting metastasis in SLNs by a semi-dry dot-blot (SDB) method with 93.3% sensitivity, 96.9% specificity and 96.6% accuracy. Here, we evaluated the efficacy of the SDB method using novel anti-cytokeratin (CK) 18+19 antibodies to diagnose lymph node metastases in breast cancer. Materials and methods: We obtained 73 lymph nodes dissected from 43 patients with breast cancer from July 2013 to May 2014 at Nagasaki University Hospital and the Japanese Red Cross Nagasaki Genbaku Hospital, including 55 sentinel lymph nodes and 18 dissected axillary lymph nodes, which were sliced at 2-mm intervals and washed with phosphate-buffered saline. This lavage fluid was used to diagnose lymph node metastasis by the SDB method; whereas the washed lymph nodes were blindly diagnosed by pathologists using with hematoxylin and eosin (H&amp;E) stain. Suspended cells in the lavage fluid were centrifuged; the cell pellet was lysed with lysis buffer to extract protein, which was then challenged and visualized with anti-cytokeratin 18 and 19 antibodies, each at 1μg/ml and 0.1μg/ml to distinguish between micrometastases or isolated tumor cells (ITC) and macrometastases; and with chromogen on a dot-blot membrane. Diagnoses based on the SDB method were compared with their H&amp;E counterparts. When the SDB method and H&amp;E-based examinations did not agree, we examined specimens immunohistochemically with anti-cytokeratin18+19 antibodies. Results: Of the 73 lymph nodes, 25 were assessed as positive and 48 as negative by the permanent pathological examination with H&amp;E. The SDB method made correct diagnoses in all positive cases and 42 of the 48 pathologically negative cases. We found four micrometastases and one ITC in the positive cases, which were difficult to diagnose as positive at the lower antibody concentration, but were clearly positive at the higher concentration. When the 6 discrepant cases were examined immunohistochemically, we found two cases of ITC and one of micrometastasis. Sensitivity, specificity and accuracy of the SDB method in detecting cancer cells were 100% (95% confidence interval [95% CI]: 100–100%), 93.8% (95% CI: 86–101%) and 95.9% (95% CI: 91–100%), respectively. Conclusions: The SDB method using anti-CK18+19 antibodies is simple and accurate for diagnosing lymph node metastases; estimating metastatic amount may be possible with different antibody concentrations. We are producing an SDB kit that uses these antibodies. Citation Format: Ryota Otsubo, Masahiro Oikawa, Hiroshi Hirakawa, Hiroshi Yano, Takeshi Nagayasu. Validation of diagnostic procedure for metastatic lymph nodes in breast cancer using a semi-dry dot-blot method and novel anti-cytokeratin 18+19 antibodies [abstract]. In: Proceedings of the Thirty-Seventh Annual CTRC-AACR San Antonio Breast Cancer Symposium: 2014 Dec 9-13; San Antonio, TX. Philadelphia (PA): AACR; Cancer Res 2015;75(9 Suppl):Abstract nr P2-01-23.

PD33-09 LOSS OF 5-HYDROXYMETHYLCYTOSINE FACILITATES THE ESTABLISHMENT OF UNIQUE ABERRANT DNA METHYLATION PATTERN TO PROMOTE KIDNEY TUMORIGENESIS

You have accessJournal of UrologyKidney Cancer: Basic Research III1 Apr 2015PD33-09 LOSS OF 5-HYDROXYMETHYLCYTOSINE FACILITATES THE ESTABLISHMENT OF UNIQUE ABERRANT DNA METHYLATION PATTERN TO PROMOTE KIDNEY TUMORIGENESIS Liqun Zhou, Zhongqiang Guo, and Xuesong Li Liqun ZhouLiqun Zhou More articles by this author , Zhongqiang GuoZhongqiang Guo More articles by this author , and Xuesong LiXuesong Li More articles by this author View All Author Informationhttps://doi.org/10.1016/j.juro.2015.02.2107AboutPDF ToolsAdd to favoritesDownload CitationsTrack CitationsPermissionsReprints ShareFacebookTwitterLinked InEmail INTRODUCTION AND OBJECTIVES A genome-wide loss of methylation and gene-specific promoter-associated CpG island hypermethylation are characteristic feature of cancer. However, the mechanisms and functional roles behind aberrant DNA methylation still remain obscure. Further study indicates that deregulated 5-hydroxymethylcytosine (5hmC)-generating pathways facilitates the CpG island associated hypermethylation in tumor. But the readout of bisulfite sequencing (BS-Seq) is the sum of 5mC and 5hmC. The present study was to study the modification level of 5hmC in clear cell renal cell carcinoma (ccRCC) and investigate the role of 5hmC modification in ccRCC tumorigenesis and development. METHODS The modification level of 5hmC in ccRCC and adjacent normal kidney tissues was evaluated by immunohistochemistry (IHC), dot blot and liquid chromatography-electrospray ionization-tandem mass spectrometry (LC-ESI-MS) method. The relationship between 5hmC modification and overall survival were calculated using the Kaplan-Meier estimator. Genome-wide BS-Seq and Tet-assisted bisulfite sequencing (TAB-Seq) were used to detect DNA 5mC and 5hmC modification level at base resolution. The expression of total mRNA was analysis using RNA-Seq method. RESULTS In our study, 5hmC is globally loss in virtually all the tumor tissue compared to the matched normal kidney tissue, which is an independent prognosis marker. Further single nucleotide resolution 5mC and 5hmC sequencing results showed that loss of 5hmC facilitate the establishment of the hypermethylator phenotype in both promoter and genic regions and facilitating the gene silencing. We show that downregulation of IDH1 is likely one of the mechanisms underlying 5-hmC loss in ccRCC. Rescuing the 5hmC level in ccRCC cells by overexpressing IDH1 attenuates the invasion capacity of tumor cells and suppresses the tumor growth in xenograft model. CONCLUSIONS Collectively, loss of 5-hydroxymethylcytosine facilitates the establishment of unique aberrant DNA methylation pattern to promote kidney tumorigenesis. © 2015 by American Urological Association Education and Research, Inc.FiguresReferencesRelatedDetails Volume 193Issue 4SApril 2015Page: e712 Advertisement Copyright & Permissions© 2015 by American Urological Association Education and Research, Inc.MetricsAuthor Information Liqun Zhou More articles by this author Zhongqiang Guo More articles by this author Xuesong Li More articles by this author Expand All Advertisement Advertisement PDF downloadLoading ...