Donor RBCs Research Articles

A novel GYP(B-A-B) hybrid in a blood donor identified by a phenotyping discrepancy with different anti-s reagents.

MNS is a complex blood group system whose antigens are carried on glycophorin A (GPA), glycophorin B (GPB) and hybrid glycophorin molecules. These hybrid proteins are the results of gene recombination events at the GYPA/GYPB loci. One of the larger groups of hybrid proteins in this system are the GP(B-A-B) hybrid proteins, which often arise through gene recombination events in and around exon 3/intron 3 of GYPA, and pseudoexon 3 of GYPB.1 Different low-prevalence antigens are expressed on the hybrids depending on the point of crossover, and the presence of such a hybrid is often detected by aberrant expression of S and/or s antigens.2 We present the investigation of samples from a blood donor who had been genotyped on the HEA BeadChip array (Immucor, GA) as GYPB*03/03 but whose RBCs phenotyped S+ s+ . Extended phenotyping for S/s was performed by routine serological techniques with commercially available polyclonal and monoclonal reagent sera (See Figure 1A for manufacturers). Confirmatory allele-specific PCR (PCR-ASP) for the S/s polymorphism was performed as described previously on genomic DNA isolated from peripheral blood.3 GYPB exons 2–6 were specifically amplified using the primer pair GYP2-F and GYPB6-R (5′TATTGTACAGATGAGAAAACCAAGGCAC3′ and 5′GTGAGGCAGGAGAACAGGGAATTAG3′). The amplicon was purified and sequenced using the following internal GYPB-exon specific primers: exon 2: GPBX2S 5′CTATTTTATACAGAAATTGTGAG3′, GPBX2AS 5′CTAGAATTCCTCTGTAGTAAG3′; pseudoexon 3: GPBX3S 5′GGAGAATTTGTCTTTCATGATAC3′, GPB1963R 5′CAACATATGCTCTTCTGTTTTAAG3′; exon 4: GYPB42F 5′ATTTCTCATCCATGAATACG3′, GYPB43R 5′GCTTGGCCTCCCAAAATTATA3′; exon 5: GPB4/5 5′CTGTCTTATTTTTCTATTGCTATG3′, GPBIVS5 5′CTGTTTCTCTTTTGAGTTTAACTG3′ (Eurofins Genomics, Ebersberg, Germany). GYPB exon 1 was not sequenced since the peptide sequence encoded is cleaved from the mature protein. Note that exon numbering includes pseudoexon 3 for comparison with previously described hybrids.2 Phenotyping for Mit antigen was performed using anti-Mit from our rare sera collection. Extended phenotyping confirmed the RBCs as S+ (results not shown); however, s typing was inconclusive since 4/8 anti-s reagents were nonreactive (Figure 1A). Strikingly, clone P3BER reacted 4+ with the donor RBCs while clone P3YAN3 was nonreactive. The RBCs were only weakly positive with 3 polyclonal anti-s. The result of PCR-ASP genotyping was GYPB*03/*04, consistent with an S+ s+ phenotype, and which contradicted the results of the original HEA BeadChip analysis. DNA sequence analysis revealed a novel hybrid sequence (Genbank number OP263737) that was shown to be an 104-bp insertion of GYPA into GYPB exon 4 with the downstream breakpoint in intron 4 (NC_000004.12(NM_002100.4):c.155_175 +83delins[NM_002099.6:c.251_271 + 83]; Figure 1B), such that GPB amino acid sequence 52VHRFTVP58 is replaced by the GPA sequence AHHFSEP (NP_002091.4:p.52_58delins[NP_002090.4:p.84_90]; Figure 1C). The insertion of GYPA-specific nucleotides explains the failure of the HEA BeadChip assay to predict the s antigen encoded by this allele. Further, it is not unusual for hybrid proteins to carry low-prevalence antigens. Review of the inserted GPA sequence suggested that the RBCs might be Mit + since a change of p.Arg54His underlies this low-prevalence GPB antigen.2 The donor's RBCs typed Mit+ with a single example of the antibody. We report a novel and unusual GYP(B-A-B) allele (provisionally named GYP*507) in which gene recombination has occurred within GYPB exon 4. While Thr48 defining the s antigen is still present, Arg54, which is thought to be important for s expression, is substituted by His54 and thus the epitope recognized by anti-s, clone P3YAN3 can be mapped to this region of GPB. The hybrid protein carries the Mit antigen. In contrast, the monoclonal anti-s P3BER has been shown previously to require Thr44 for reactivity, since this is absent from GP.Mur and GP.Bun hybrid proteins,4 and shows that these two monoclonal anti-s recognize different epitopes on GPB. The serological results showed that the expression of s antigen in this new hybrid is both qualitatively and quantitatively perturbed.2 We thank Judith Aeschlimann for providing the GYP2-F and GYPB6-R primer sequences. This work has been supported by the ALF program from the Swedish government and regional county councils (grant no. ALFSKANE-446521 to M.L.O.) to university healthcare in Region Skåne and at Lund University. The authors have disclosed no conflicts of interest.

Hypoxic storage of donor red cells preserves deformability after exposure to plasma from adults with sickle cell disease.

Red cell (RBC) transfusions are beneficial for patients with sickle cell disease (SCD), but ex vivo studies suggest that inflamed plasma from patients with SCD during crises may damage these RBCs, diminishing their potential efficacy. The hypoxic storage of RBCs may improve transfusion efficacy by minimizing the storage lesion. We tested the hypotheses that (1) The donor RBCs exposed to the plasma of patients in crisis would have lower deformability and higher hemolysis than those exposed to non-crisis plasma, and (2) hypoxic storage, compared to standard storage, of donor RBCs could preserve deformability and reduce hemolysis. 18 SCD plasma samples from patients who had severe acute-phase symptoms (A-plasma; n=9) or were at a steady-state (S=plasma; n=9) were incubated with 16 RBC samples from eight units that were stored either under conventional(CRBC) or hypoxic(HRBC) conditions. Hemolysis and microcapillary deformability assays of these RBCs were analyzed using linear mixed-effect models after each sample was incubated in patient plasma overnight at 37°C RESULTS: Relative deformability was 0.036 higher (p < 0.0001) in HRBC pairs compared to CRBC pairs regardless of plasma type. Mean donor RBC hemolysis was 0.33% higher after incubation with A-plasma compared to S-plasma either with HRBC or CRBC (p=0.04). HRBCs incubated with steady-state patient plasma demonstrated the highest deformability and lowest hemolysis. Hypoxic storage significantly influenced RBC deformability. Patient condition significantly influenced post-incubation hemolysis. Together, HRBCs in steady-state plasma maximized donor red cell ex vivo function and survival.

The use of pluripotent stem cells to generate diagnostic tools for transfusion medicine

AbstractRed blood cell (RBC) transfusion is one of the most common medical treatments, with more than 10 million units transfused per year in the United States alone. Alloimmunization to foreign Rh proteins (RhD and RhCE) on donor RBCs remains a challenge for transfusion effectiveness and safety. Alloantibody production disproportionately affects patients with sickle cell disease who frequently receive blood transfusions and exhibit high genetic diversity in the Rh blood group system. With hundreds of RH variants now known, precise identification of Rh antibody targets is hampered by the lack of appropriate reagent RBCs with uncommon Rh antigen phenotypes. Using a combination of human-induced pluripotent stem cell (iPSC) reprogramming and gene editing, we designed a renewable source of cells with unique Rh profiles to facilitate the identification of complex Rh antibodies. We engineered a very rare Rh null iPSC line lacking both RHD and RHCE. By targeting the AAVS1 safe harbor locus in this Rh null background, any combination of RHD or RHCE complementary DNAs could be reintroduced to generate RBCs that express specific Rh antigens such as RhD alone (designated D--), Goa+, or DAK+. The RBCs derived from these iPSCs (iRBCs) are compatible with standard laboratory assays used worldwide and can determine the precise specificity of Rh antibodies in patient plasma. Rh-engineered iRBCs can provide a readily accessible diagnostic tool and guide future efforts to produce an alternative source of rare RBCs for alloimmunized patients.

Phenotype Frequencies of “O” Blood Group (Rh, Kell, and MNS) among Donors in Transfusion Medicine Department of a Training Institute of Bangladesh

Background: Although blood transfusions can be lifesaving but it is not without risk. It is a necessity to have knowledge about the red cell antigen phenotype frequencies in a population to provide antigen-negative compatible blood to patients with multiple alloantibodies. This is the first study on extended phenotype of blood group systems in blood donors at AFIP, Dhaka. Aim: Present study is aimed to determine the antigen frequencies of “O” blood group phenotype among donors at AFIP, Dhaka. Methods: An observational study was carried out at AFIP, Dhaka from July 2019 to December 2019. A total of 40 “O” blood group donors from blood bank of AFIP were typed for D, C, c, E, e, K, k, M, N and S antigens either by adding antisera to 3-5% of donor RBCs suspension or by using Indirect Antiglobulin Test (IAT) according to manufacturer’s instruction. Coomb’s control cells, positive and negative control cells were used as quality control. Antigens and phenotype frequencies were expressed as percentages. Results: Forty (40) blood donors belonging to “O” blood group were included for extended phenotyping. D antigen was found in 100% donors, followed by e [42.5%], C [38.13%], c [11.88%], and E [7.5%] with DCe/DCe (R1R1, 55%) as the most common phenotype. k was found to be positive in 72% of donors. In the MNS system, 57.5% donors were typed as M+N+, 32.5% as M+N-, and 10% as M-N+. S-s+ was found amongst donors with 52.5% as the commonest phenotype. Conclusion: This study was conducted to provide information about the antigen frequency of a common blood group “O” in local donors to provide antigen negative compatible blood units to multi transfused alloimmunized patients. D antigen was found in 100% donors with DCe/DCe (R1R1, 55%) as the most common phenotype. J Bangladesh Coll Phys Surg 2022; 40: 171-174

Maternal-fetal Blood Major Crossmatching in Merino Sheep.

To determine the incidence of ex vivo incompatibility between ovine maternal RBCs and fetal plasma, we performed cross-matching of blood samples from ewes and from lambs delivered by cesarean section. Twenty-one date-mated singleton pregnant Merino ewes were anesthetized for cesarean delivery of the fetus. At the time of delivery, paired maternal and fetal blood samples were collected and subsequently separated for storage as packed red blood cells and fresh frozen plasma. Gel column major cross matching was performed within 2 wk. All fetus-dam crossmatches were major crossmatches, combining fetal (recipient) plasma with dam (donor) RBCs. 172 individual dam-dam cross matches were performed. Two of these tests were incompatible (1.2%). In addition, 19 fetal blood samples collected immediately after cesarean delivery were crossmatched with 21 maternal samples to generate 174 maternal-fetal individual cross matches. No maternal-fetal incompatibility reactions were observed. The results of this study demonstrate that all maternal donors and fetal recipients were compatible. In addition, the incidence of an incompatible crossmatch between adult ewes was 1.2%. These data suggest that lambs may not be born with antibodies against other blood types, but rather may acquire such antibodies at some time during early life. In addition, these data suggest the risk of incompatibility reactions between ewes of a similar breed and from a single farm of origin is very low.

ABO incompatibile graft management in pediatric transplantation.

Up to 40% of donor-recipient pairs in SCT have some degree of ABO incompatibility, which may cause severe complications. The aim of this study was to describe available options and survey current practices by means of a questionnaire circulated within the EBMT Pediatric Diseases Working Party investigators. Major ABO incompatibility (donor's RBCs have antigens missing on the recipient's cell surface, towards which the recipient has circulating isohemagglutinins) requires most frequently an intervention in case of bone marrow grafts, as immediate or delayed hemolysis, delayed erythropoiesis and pure red cell aplasia may occur. RBC depletion from the graft (82%), recipient plasma-exchange (14%) were the most common practices, according to the survey. Graft manipulation is rarely needed in mobilized peripheral blood grafts. In case of minor incompatible grafts (donor has isohemagglutinins directed against recipient RBC antigens), isohemagglutinin depletion from the graft by plasma reduction/centrifugation may be considered, but acute tolerability of minor incompatible grafts is rarely an issue. According to the survey, minor ABO incompatibility was either managed by means of plasma removal from the graft, especially when isohemagglutinin titer was above a certain threshold, or led to no intervention at all (41%). Advantages and disadvantages of each method are discussed.

Changes in Mean Corpuscular Volume and RBC Distribution Width Predict Erythrocyte Engraftment Following ABO-Incompatible Hematopoietic Stem Cell Transplantation.

The purpose of this study was to identify laboratory parameters representing erythrocyte engraftment to be used as an indicator to change the recipient to donor ABO group and Rh type following an ABO-incompatible hematopoietic stem cell transplant (HSCT). Studies have shown that ABO incompatibility does not have an effect on outcome of HSCT; however, the serologic consequences of these ABO-incompatible transplants can make it difficult to decide when to begin support with donor ABO/Rh-type blood products. This study explored the use of RBC distribution width (RDW), mean corpuscular volume, and hemoglobin as regularly tested laboratory parameters that could be used as surrogate markers for RBC engraftment in 65 patients who received ABO/Rh-incompatible HSCT. The appearance of engrafted donor RBCs correlated with a peak in RDW (P = .002). In addition, our findings suggest that serologic changes in ABO/Rh appear to correspond with a peak in RDW (P = .002). High values of RDW likely result from a substantial proportion of large, young erythrocytes from recent engraftment with smaller, older pretransplant erythrocytes from the recipient. Our findings suggest that peak RDW may be an indicator of erythrocyte engraftment, following an ABO/Rh-incompatible HSCT.

Ibrutinib for Pure Red Cell Aplasia after Allogeneic Hematopoietic Stem Cell Transplant with Major ABO Incompatibility

<h3>Introduction</h3> Since Human leukocyte antigen (HLA) and ABO blood group system are inherited independently and with up to 50% of allogeneic hematopoietic cell transplantations (HCT) are performed with donor-recipient ABO incompatibility, recipients are at increased risk for acute and delayed hemolytic reaction and delayed RBC precursors engraftment; i.e. pure RBC aplasia (PRCA). PRCA is a sever consequence of major and bi-directional ABO mismatch after alloHCT, leading to frequent transfusions, iron overload and secondary complications. Risk factors for PRCA after Major ABO incompatibility include; stem cell source, conditioning intensity, and titer of iso-agglutinins. Treatment is mostly supportive with transfusions and growth factors as well as withdrawing immunosuppressive therapy (IS). Targeting recipient immune system with high-dose steroids, DLI, and rituximab have been reported with variable results. Here we report a case series of a novel method of targeting recipient iso-agglutinins-producing B cells by Ibrutinib. <h3>Methods</h3> We report 3 cases of PRCA refractory to conventional therapy who responded to ibrutinib, a BTK inhibitor targeting recipient B cells to allow engraftment of donor RBCs. Patient, transplant and disease characteristic including prior therapies, time to transfusion independence, and switch of blood group (BG) are summarized in Table 1. First patient's day 30 post-transplant bone marrow biopsy (BMBx) showed complete remission (CR) with full donor chimera, but BG remained O. He developed severe anemia requiring transfusions and Day 100 BMBx showed CR with markedly decreased number of erythroid progenitors. He did not respond to IS withdrawal, prednisone, rituximab or bortezomib. But BMBx 4 weeks after starting ibrutinib showed trilineage hematopoiesis. Second patient remained RBC transfusion dependent post-HCT with Day 100 biopsy showing PRCA and full donor chimera. BG remained O. He developed severe GVHD of skin and eyes after DLI and His PRCA was refractory to multiple lines of therapies but responded to ibrutinib. Third patient underwent HCT for refractory AML with MDS; Anti-A isoagglutinin level pre-HCT was high and patient underwent plasma exchange. Day 30 BMBx showed CR and full donor chimera. Day +73 BMBx showed CR with near absent erythropoiesis. PRCA was refractory to rituximab and responded to ibrutinib. <h3>Conclusion</h3> All three patients with PRCA refractory to multiple lines of therapy responded to ibrutinib with median time to transfusion independence of 4 weeks and median time to BG switch of 6 weeks. All patients tolerated therapy well. Our experience at City of Hope shows that ibrutinib could offer a safe and efficacious treatment option for cases of refractory PRCA. Prospective studies are needed to assess if early therapy with ibrutinib could reduce the morbidity resulting from frequent transfusions, and GVHD complications.

Mechanism Underlying a Role for Factor XIII (FXIII) Polymorphism in Sickle Cell Disease-Associated Priapism

Background: The pathophysiology of priapism in sickle cell disease (SCD) is poorly understood. While blood stasis is essential to tumescence, most research in SCD-associated priapism to date has focused on the potential role of abnormal signaling pathways. We have previously observed that a coding sequence single nucleotide polymorphism (rs5988) of the transglutaminase factor XIII gene (FXIII) is strongly associated with SCD priapism, with an odds ratio of 2.52 [C.I. 1.27 -5.03] for the risk genotype (G/G, expressing only FXIII E652) vs the most common non-risk genotype (G/C, expressing both FXIII E652 and FXIII Q652). We therefore explored the effect of the rs5988 polymorphism on various aspects of FXIII function.Methods: Recombinant FXIII (rFXIII) E652 and rFXIII Q652 were expressed by 293 kidney cells and isolated from serum-free tissue culture supernatant. Before use in assays, activation of rFXIII by thrombin was confirmed by generating activated rFXIII (rFXIIIa) with thrombin (10 U/ml), followed SDS-PAGE, western blotting for FXIII, and densitometry for quantitation. Whole blood samples and plasmas were obtained from previously genotyped subjects with SCD under an IRB-approved protocol. Plasma FXIII and rFXIII transglutaminase activity was measured by the ability to catalyze 5-(biotinamido)pentylamine incorporation into a suitable substrate. Plasma FXIII antigen was assayed by ELISA. Clot contraction was measured after tissue factor-initiated clotting of recalcified whole blood. Clot resistance to lysis was measured after exposure to tissue plasminogen activator (tPA).Results: Transglutaminase activity of each rFXIII was measured using fibrinogen and fibronectin as substrates. At 20 minutes, rFXIIIa E652 showed 1.44-fold more transglutaminase (crosslinking) activity toward fibrin(ogen) than rFXIIIa Q652 (p=0.027), and a nonsignificant trend toward more activity (1.32-fold, p=0.079) toward fibronectin. Kinetic assays also showed that rFXIII E652 had significantly greater activity toward both matrices (p=0.006 and 0.012, respectively), suggesting the risk genotype (homozygosity for the G allele) enhances fibrin(ogen) and/or fibronectin crosslinking. FXIII activity in the plasma of 18 genotyped SCD patients (3 CC, 7 GC, 8 GG) demonstrated a consistent, but not significant, trend toward increased FXIII activity with increasing presence of G alleles (80.01% CC, 98.90% CG, and 107.20% GG). Although results were not adjusted for genotype at other loci reported to affect FXIII expression, there was no significant difference in FXIII antigen among genotypes. Compared to contracted whole blood clots from patients with only one or no risk alleles, clots from SCD patients with two copies of the risk allele (GG, expressing only FXIII E652) did not differ in either RBC retention within clots or clot mass (weight). Moreover, inhibition of transglutaminase activity with T101 significantly increased RBC release and decreased clot weight to a similar degree in contracted clots from patients with either the GC or GG genotype. In clots formed from FXIII-deficient plasma supplemented with rFXIIIa E652 or rFXIIIa Q652 and ABO-compatible donor RBCs, clots containing rFXIIIa E652 were 14% more resistant to lysis than clots containing rFXIIIa Q652 (p=0.016). Parallel studies with SCD patient plasma samples also showed that clots containing only FXIII E652 were more resistant to lysis than clots containing both FXIII E652 and FXIII Q652(p=0.0001).Conclusions: These data suggest the FXIII rs5988 polymorphism does not alter protein expression or clot contraction but may regulate clot stability via slightly increased transglutaminase activity and enhanced resistance to lysis. These effects may predispose patients to formation of microclots during tumescence, thus impairing blood egress and increasing risk of priapism. Further studies should be conducted to determine if anticoagulation or fibrinolytic treatments are viable preventative or treatment strategies for SCD patients with the risk FXIIIGG genotype and recurrent priapism. DisclosuresTelen:Pfizer, Inc.: Consultancy, Research Funding. Wolberg:GlaxoSmithKline: Employment; Novo Nordisk: Research Funding.

Analysis of ABO chimera from peripheral red cells and reticulocytes by flow cytometry and micro gel column technique in patients post-ABO-incompatible HSCT.

How to choose an appropriate method to monitoring dynamic ABO chimera post-ABO-incompatible HSCT is crucial to not only assess the status of erythroid engraftment but also achieve personalized safety transfusion. We evaluated the efficacy of micro gel column technique (MGCT) and flow cytometry (FCM) by series of artificial ABO chimera mixtures from 0.5% to 50% and by investigating 15 cases of ABO-incompatible HSCT patients with longitudinally ABO blood grouping and ABO chimera from RBCs and reticulocytes. 5% and 2% of ABO chimera mixtures can be efficiently detected by MGCT and FCM, respectively. 6.3% of donor RBCs with 44.77% of donor reticulocytes in the early phase and 7.9% of patient RBCs with 96% of donor reticulocytes in the phase of complete donor type can be detected by FCM rather than failure by MGCT simultaneously. However, in case 8#, 8.6% of donor reticulocytes rather than 99.1% of donor RBCs on the 98th day post-HSCT could adequately predict early relapse. Investigation of ABO chimera from reticulocytes by FCM is a more effective strategy rather than ABO blood grouping and RBCs by FCM to indicate the true progress of erythroid alteration and achieve personalized safety transfusion post-ABO-incompatible HSCT.

Glucose-6-Phosphate Dehydrogenase Deficiency in Blood Donors Is Associated with Decreased Post-Transfusion Red Cell Recovery

Background:Pre-transfusion refrigerated storage of red cells (RBCs) induces a series of metabolic and structural changes in stored RBCs (i.e., the “storage lesion”). The resulting, progressive, time-dependent decrease in RBC quality leads to decreased post-transfusion RBC recovery (PTR). Markers of oxidative stress increase during storage, suggesting the possibility that oxidative stress may be a key contributor to the storage lesion. Glucose-6-phosphate dehydrogenase (G6PD) deficiency, an X-linked condition, decreases the ability of RBCs to withstand oxidative stress by compromising their ability to synthesize NADPH. Therefore, we hypothesized that RBCs from G6PD-deficient donors would have inferior storage quality, as compared to RBCs from G6PD-normal (i.e., control) donors.Aims:This study examined whether G6PD deficiency, the most common enzyme deficiency worldwide, which impairs the RBC response to oxidative stress, also decreases RBC storage quality.Methods:Male volunteers were screened for G6PD deficiency by enzymatic assay, and next generation sequencing was performed to identify the G6PD variant in deficient subjects. In addition, participants were screened for the presence of hemoglobin variants and thalassemia by high performance liquid chromatography and complete blood count. Twenty seven control and 10 G6PD-deficient volunteers each received informed consent, donated 1 unit of leukoreduced RBCs that was stored in AS-3 under standard blood banking conditions, and completed an autologous 51-Chromium-labeled PTR study after 40-42 days of storage. Hemolysis rate in the transfused unit was measured on the day of the PTR study using a Drabkin assay. Results for control and G6PD-deficient PTRs and hemolysis rates were compared using unpaired t-tests.Results:A total of 145 males were screened for G6PD deficiency, yielding 15 deficient (10%) and 130 G6PD normal control (90%) subjects. Twenty seven control (G6PD normal) and 10 deficient participants who did not have hemoglobin variants or microcytosis completed the study. All blood donors met the hemoglobin acceptance criteria for autologous whole blood donation of at least 11.5 g/dL. G6PD gene sequencing of the 10 enrolled G6PD-deficient subjects identified the A- variant in 9 volunteers and the Mediterranean variant in 1. The autologous mean 24-hour PTR for control RBC units was 86.8 ± 2.8% (mean ± SD). The autologous mean 24-hour PTR for G6PD-deficient RBC units was 81.0 ± 7.2% (mean ± SD), which was significantly lower than that for control RBCs (p=0.001). None of the control volunteers (0/27) had PTR results below 75%, one of the key FDA acceptability criteria for stored RBCs. In contrast, two G6PD-deficient volunteers (2/10) had PTR results below 75% (i.e., 68.8% and 70.1%). There was no association between enzymatic G6PD activity and PTR when adjusted for G6PD status (i.e., among control or G6PD-deficient subjects, the enzymatic G6PD activity did not predict PTR). Finally, there was no difference between control and deficient RBC units in mean in vitro hemolysis rates at the end of storage (0.29 ± 0.18% vs. 0.24 ± 0.07%, respectively; p=0.38)Conclusions:This is the first report of the effect of G6PD deficiency on the storage quality at outdate of transfused donor RBCs stored in AS-3 additive solution as assessed by PTR, the FDA gold standard. These results demonstrate that the storage quality of G6PD-deficient RBCs is inferior to G6PD-normal RBCs. In particular, based on the FDA criteria that acceptable RBC units should have a 24-hour PTR of ≥75% at the end of storage, RBC units from G6PD-deficient donors had a 20% failure rate. The clinical consequences of the mean 5.8% decreased PTR of G6PD-defcient RBC units remain to be determined. Patients with sickle cell disease often require lifetime transfusions and up to 12.3% of phenotypically-matched RBC units utilized in their care may be G6PD-deficient. Thus, these data raise the question of whether there is value in screening blood donors for G6PD deficiency, particularly in the setting of chronic transfusion therapy, such as for patients with sickle cell disease and thalassemia. DisclosuresSpitalnik:New Health Sciences: Consultancy, Membership on an entity's Board of Directors or advisory committees.

Case study: Use of A2 and donor red blood cells for anti ABO a titer

ABO incompatibility (ABOi) is no longer an absolute contraindication for kidney transplantation. Recipients who are either blood group O or B have successfully received kidney transplants from donors who are blood group A, as long as their titer against the donor A antigen is low. Although the predominant A antigen subtype in the population is A1, less than 20% of blood group A individuals are of other subtypes, with weaker antigen expression, A2 being the most common of these. Accurate quantification of the amount of Anti A antibody titer in the recipient against the intended donor is important to determine compatibility for ABOi transplants. A review of the literature demonstrated that there is a high degree of technique variability, especially concerning the target cells utilized to determine such titers. Accordingly, we decided to use A2 and donor RBCs as well as our standard A1 RBCs in our assays, in order to determine the differences in titer when various A subtype cells are utilized as the target. Our case is a 54 year old male; 0% CPRA, blood group O recipient, whose donor was ABO typed as a non-A1. Flow T and B cell crossmatch negative. The transplant program decided to move forward with the ABO incompatible transplant since no other live donors were available. Determination of the Anti-A titer was as follows: Recipient sera was serially diluted with saline from 1:1 to 1:512. One drop of RBC suspension is added to 2 drops (100 ul) of each sera dilution. Three different titrations were performed using commercially produced A1 and A2 RBC as well as donor RBC. Tubes were incubated at RT for 30 minutes, centrifuged and agglutination macroscopically observed and recorded. Tubes were then incubated at 37C for 30 minutes, washed 4 times with saline, IgG added then centrifuged and agglutination recorded again. This procedure allows for determination of both IgM and IgG antibodies against blood group A antigens. IgG titers were 1:16 with A1 RBC; 1:8 with A2 RBC; and 1:8 with donor RBC. Our transplant program considers an IgG titer less than or equal to 1:8 acceptable and the transplant was performed. Recipient is out 11 weeks with no rejection episodes.

Steap3 Is a Novel Candidate Gene for Regulating the RBC Blood Storage Lesion By Mitigating Peroxidation of Membrane Lipids in a Mouse Model

Background: There is substantial donor-to-donor variability in the post-transfusion survival of stored human RBCs. RBCs from different strains of inbred mice also store differently; RBCs from C57BL/6 (B6) mice store well, whereas RBCs from FVB/NJ (FVB) mice store poorly, as defined as 24-hr post-transfusion RBC recoveries (24hr-recoveries). We hypothesized that observed differences in RBC storage between inbred mouse strains are heritable and can be mapped using mouse genetic tools.Methods: B6 and FVB mice were crossed to generate F1 mice, which were then intercrossed to generate 156 F2 animals. RBCs from single donor mice were stored for 7 days, followed by transfusion into B6xFVB F1 recipients that were transgenic for GFP, which is expressed in essentially 100% of F1 RBCs. 24hr-recoveries were measured by bleeding recipients 24 hours post-transfusion and enumerating non-fluorescent donor RBCs. The use of F1 recipients avoided crossing allo-antigenic barriers. Prior to transfusion, a sample of each donor RBC unit was frozen at -80oC; all frozen samples were subjected to LC-MS/MS to generate an untargeted metabolomics profile. DNA from each mouse was applied to a 1,414 SNP Illumina BeadChip. Quantitative Trait Loci (QTL) analysis was performed for 24hr-recoveries and also for each LC-MS/MS analyte identified, by means of fitting a linear model at each SNP, and adjusting for the number of tests using a false discovery rate (FDR) procedure. For each LC-MS/MS analyte, correlation coefficients were calculated to 24-hr recoveries. Correlations of LC-MS/MS metabolites to 24hr-recoveries were combined with QTL mapping and referenced to known metabolic pathways to generate a blood storage metabolomics profiles associated with an RBC storage phenotype and linked to genotype. Additional genetic mapping resolution was obtained by backcrossing F2 mice with poor storage to B6 parents, and selecting poor-storing progeny to breed for each next generation.Results: 24hr-recoveries exhibited a Gaussian distribution in F2 mice. LC-MS/MS quantified 554 analytes in each stored RBC sample. QTL analysis of the 24hr-recoveries using 813 informative SNPs identified a significant QTL (maximum peak p=2.09x10-31), that we have termed Rbcstor1, spanning a ~149 Mb interval on chromosome 1 (rs13475827 to rs13476300). Fine mapping using backcrossed populations refined Rbcstor1 to a 9.5 Mb interval containing 64 genes. Filtering for coding genes harboring nonsynonymous B6-FVB SNPs identified 5 genes (Gli2, Steap3, Ccdc93, Rab3gap1, Tli). Steap3 is a functional enzyme in erythroid cells, in which it is the primary ferrireductase converting Fe3+ to Fe2+, both mitigating oxidative stress as well as allowing transferrin-dependent iron uptake. Steap3 harbors two FVB-B6 non-synonymous SNPs (p.A350V and p.N455S). Metabolomics analysis revealed that oxidized products of lipid metabolism strongly correlated with post-transfusion RBC survival, including the bioactive lipids Leukotriene B4 (r=0.71, p=1.7x10-25) and Prostaglandin E2 (r=0.81, p=2.6x10-37). In addition, a wide variety of dicarboxylic fatty acids (e.g. dodecanedioate (r=-0.81, p=1.1x10-44) and octanedioate (r=-0.85, p=3.4x10-53)) strongly correlated with RBC storage. Based upon additional QTL analysis of products of lipid peroxidation, a significant QTL was identified, which we have termed Rbcstormet1. Rbcstormet1 overlaps extensively with Rbcstor1.Conclusion: We have identified Rbcstor1 on chromosome 1 as a QTL strongly associated with 24hr-recoveries. Within this region, Steap3 is a strong candidate gene. Steap3 has been previously implicated in erythroid phenotypes: mice lacking Steap3 are profoundly anemic, and a human family carrying a STEAP3 nonsense mutation has been reported to exhibit a congenital hypochromic anemia. However, to the best of our knowledge, Steap3 has no known function in mature RBC biology or RBC storage. We hypothesize that the FVB Steap3 allele is a hypomorphic variant, which adversely impacts RBC storage biology by decreasing the ability of RBCs to handle oxidative stress, leading to lipid peroxidation that generates inflammatory lipids, lysolipids, and dicarboxylic acids. In addition to identifying a novel genetic locus associated with 24hr-recoveries of stored RBCs, these studies suggest that polymorphisms in Steap3 or in related proteins could contribute to human blood donor variability. DisclosuresNo relevant conflicts of interest to declare.

Successful Unintentional ABO-Incompatible Renal Transplantation

To report a successful unintentional transplantation of a deceased donor kidney from an "incompatible" A1B donor into a recipient who was blood group A2B with unsuspected preformed anti-A1 antibodies. The donor and recipient were both typed for ABO antigens. The recipient was tested for ABO and non-ABO antibodies. The recipient was typed for HLA class I and class II antigens, including HLA antibody screen. The T-and B-flow cytometry crossmatch test was performed using standard protocol. The donor-recipient pair was a complete six-antigen human leukocyte antigen mismatch, but final T- and B-flow cytometry cross-match tests were compatible. The recipient was a 65-year-old woman with a medical history of end-stage renal disease secondary to diabetic nephropathy who underwent kidney transplantation from a 46-year-old brain-dead standard criteria donor. The recipient's RBCs were negative with A1 lectin, and the recipient was thus typed as an A2 subgroup. Anti-A1 could be demonstrated in the recipient's plasma. The donor's RBCs were positive with A1 lectin, thereby conferring an A1 blood type. It is safe to transplant across the A1/A2 blood group barrier provided that the preformed antibodies are not reactive at 37°C and with anti-human globulin.

Enhancement of Antibody Titre and Development of Additional Red Cell Alloantibodies Following Intrauterine Transfusion.

Intrauterine blood transfusion is the mainstay of managing foetuses with severe anemia. It may however result in fetomaternal hemorrhage, which in cases of Rh isoimmunisation may increase the severity of the disease by enhancing the maternal immunological response to fetal antigens. This study was conducted to determine the frequency, specificity and origin of additional red cell antibodies which developed after IUT. The change in the titre of allo anti-D following IUT was also determined. Antibody detection and titration was done on the blood samples of all the patients before and after intrauterine blood transfusion to check for the development of additional antibody and change in the titre of existing anti-D. Severe anemia was found in 17 (58.6%) fetuses who received a total of 42 ultrasound-guided IUTs. Development of antibodies additional to anti-D in maternal serum was seen in 5 (29.4%) cases. The specificity of additional alloantibodies was anti-C in four cases whereas it was anti-E in one case. Four fold or greater increase in existing allo-anti D titre was seen in 6 (35.3%) cases after IUT. Enhancement of maternal sensitisation leading to an increase in maternal antibody titre is particularly seen after the first IUT. Matching of the donor RBCs particularly for Rh antigens might prevent the induction of additional alloantibodies against these antigens. IUT as a treatment modality should be given judiciously and only when the need is inevitable.

Hyperhemolytic Transfusion Reactions in Non-Sickle Cell Anemia Patients

AbstractAbstract 1183 IntroductionHyperhemolytic transfusion reaction syndrome (HHTR) has been appreciated in allo-immunized patients with sickle cell anemia. In these patients, transfusion precipitates hemolysis of both donor RBCs and the recipient's native RBCs, leading to post-transfusion hemoglobin level below baseline. Recognition is important because it is life-threatening and has unique management. Despite the severe degree of anemia, the most important treatment for HHTR is generally to halt the cascade of hemolysis by withholding transfusion. We present the first case series of HHTR in non-sickle cell patients observed in a tertiary academic medical center. MethodsWe reviewed records of four patients treated by one of us. We also retrospectively search for any additional patient charts from those with diagnosis of HHTR from 1996 to 2012 from institutional database and also searched patients under ICD-9 codes for hemolytic transfusion reactions (999.83 to 85) from 2009 to 2011. Patients with sickle cell disease were excluded. HHTR was defined as post-transfusion hemoglobin level below baseline accompanied by clinical and laboratory evidences of hemolysis, and the recurrence of HHTR after repeated transfusions. ResultsFour non-sickle cell patients who fulfilled criteria of HHTR were identified. Mean age was 34.7. Three were African-Americans, one was Caucasian, and all were females. Two patients had iron deficiency anemia, one had systemic lupus erythematosus, and one had no past medical history. The average amount of transfused PRBC was 5.83±0.3units per person. After transfusion, hemoglobin reached nadir (mean decrease from baseline 38%) within two to three weeks of initial transfusion. Corrected reticulocyte counts were typically low (<2%). All had symptomatic hemolysis often accompanied by chills, jaundice, elevated LDH and unconjugated bilirubin. Post-transfusion analysis of allo-immunization revealed three patients with de novo development of multiple allo-antibodies. The most common alloantibodies were anti-C, c and E. Various therapies including IV steroid, IVIg and erythropoietin were applied, but the most effective management was withholding further transfusion. One patient with consecutive transfusions expired after severe hemolysis. Three patients survived from HHTR and hemoglobin recovered to 72% of their baselines. ConclusionWe have demonstrated the first case series of HHTR in non-sickle cell patients and defined its clinical characteristics. HHTR in non-sickle cell patients results in 38% decline of hemoglobin within two to three weeks of transfusion. De novo development of allo-antibodies strongly suggests that the exaggerated destruction of self and non-self cells may be secondary to acute induction of allo-immunity against non-self RBCs and subsequent complement activation leading to bystander hemolysis of self RBCs. HHTR is a unique and lethal complication of transfusion which occurs in both sickle and non-sickle cell patients. Withholding transfusion is a crucial strategy to HHTR. Thus, it is important not to reserve the diagnosis to sickle cell patients of African-American descent, but to recognize that this can occur in any transfused patient. [Display omitted] Disclosures:No relevant conflicts of interest to declare.

Erythrocyte enrichment in hematopoietic progenitor cell cultures based on magnetic susceptibility of the hemoglobin.

Using novel media formulations, it has been demonstrated that human placenta and umbilical cord blood-derived CD34+ cells can be expanded and differentiated into erythroid cells with high efficiency. However, obtaining mature and functional erythrocytes from the immature cell cultures with high purity and in an efficient manner remains a significant challenge. A distinguishing feature of a reticulocyte and maturing erythrocyte is the increasing concentration of hemoglobin and decreasing cell volume that results in increased cell magnetophoretic mobility (MM) when exposed to high magnetic fields and gradients, under anoxic conditions. Taking advantage of these initial observations, we studied a noninvasive (label-free) magnetic separation and analysis process to enrich and identify cultured functional erythrocytes. In addition to the magnetic cell separation and cell motion analysis in the magnetic field, the cell cultures were characterized for cell sedimentation rate, cell volume distributions using differential interference microscopy, immunophenotyping (glycophorin A), hemoglobin concentration and shear-induced deformability (elongation index, EI, by ektacytometry) to test for mature erythrocyte attributes. A commercial, packed column high-gradient magnetic separator (HGMS) was used for magnetic separation. The magnetically enriched fraction comprised 80% of the maturing cells (predominantly reticulocytes) that showed near 70% overlap of EI with the reference cord blood-derived RBC and over 50% overlap with the adult donor RBCs. The results demonstrate feasibility of label-free magnetic enrichment of erythrocyte fraction of CD34+ progenitor-derived cultures based on the presence of paramagnetic hemoglobin in the maturing erythrocytes.

Delayed Hemolytic Transfusion Reaction Without Detectable Autoantibodies or Alloantibodies: A Possible Role of Phosphatidylserine Exposure on Donor RBCs

Delayed hemolytic transfusion reactions (DHTRs) may occur when there is an antigen mismatch between transfused RBCs and recipient RBC antibodies where sensitized RBCs are cleared by macrophages or complement activation leading to immunoglobulin G (IgG) mediated hemolysis. Some DHTR etiologies remain unknown since there are cases of DHTR when an RBC autoantibody or alloantibody is absent. Mechanisms have been proposed to explain these types of cases of DHTR, including bystander or reactive hemolysis by hyperactive macrophages. Studies in patients with sickle cell disease (SCD) have shown abnormalities in the structure and function of the RBC membranes including exposure of phosphatidylserine (PS) leading to macrophage clearance of sickled erythrocytes. We report on a case demonstrating that DHTR may occur as a result of PS exposure on antigen-matched RBC, resulting in macrophage clearance and hemolysis without detection of autoantibodies or alloantibodies. An in vitro measurement showed an increased exposure of PS on compatible donor RBCs using the patient’s plasma, which may be responsible for increased hemolysis during DHTR. * DHTR : delayed hemolytic transfusion reaction IgG : immunoglobulin G PS : phosphatidylserine SCD : sickle cell disease Hb : hemoglobin DAT : direct antiglobulin test IAT : indirect antiglobulin test HLA : human leukocyte antigen CT : computed tomography DHTR/H : delayed hemolytic transfusion reaction/hyperhemolysis

D+ platelet transfusions in D– patients: cause for concern?

Abstract Patients whose RBCs are D– may produce anti-D if they are exposed to D on donor RBCs. Except in emergency situations, patients whose RBCs lack D are transfused with only D– RBCs. Platelets carry no Rh antigens, but platelet units may be contaminated by RBCs that could carry D when these units are collected from D+ donors. The purpose of this study was to determine whether our policy of allowing D+ platelets to be transfused to patients whose RBCs type as D–, without the use of prophylactic Rh immunoglobulin (RhIG), results in D alloimmunization. The transfusion records of all patients who received platelet transfusions from December 2004 to March 2007 were reviewed. Transfusion recipients were evaluated with pretransfusion ABO and D typings, and an antibody screen. Recipients were reevaluated in the same manner before subsequent transfusions. Transfusion records of 114 D– patients were analyzed. Overall, 104 patients received D+ platelets; 67 had repeat antibody screening after transfusion. No patients were shown to make anti-D after platelet transfusion. There was no evidence of D alloimmunization as a result of transfusion of D+ platelets in any D– patient during this study. The data do not support the practice of restricting D– patients to receiving only D– apheresis platelets, even among patients with chronic transfusion requirements. Prophylactic use of RhIG for D+ apheresis platelet transfusions in D– patients also appears to be unnecessary. Immunohematology 2009;25:5–8.

Fatal drug-induced immune hemolytic anemia due to cefotetan; A case study

A case is described here of drug-induced immune hemolytic anemia (DIIHA) due to cefotetan administered to a post-partum woman who received the drug for infection prophylaxis at the time of caesarean section. Renewed fatal hemolysis occurred when the drug was given a second time 12 days after the first dose. The initial immunohematologic findings included a positive direct antiglobulin test (DAT) due to IgG and complement coating of the patient’s RBCs as well as an eluate that did not react with RBCs in the absence of drug. The antibody was drug-dependent, reacting with both drug-coated RBCs as well as when the drug was added to a mixture of her serum and donor RBCs. Cefotetan has been a common cause of this uncommon problem. The clinical features of cefotetan DIIHA, classification of drug-induced antibodies, and the differential diagnosis of a positive DAT are briefly discussed.