Donor Cells For Nuclear Transfer Research Articles

Generation of stable integration-free pig induced pluripotent stem cells under chemically defined culture condition.

Genome integration-free pig induced pluripotent stem cells (iPSCs) bring tremendous value in pre-clinical testing of regenerative medicine, as well as conservation and exploitation of endangered or rare local pig idioplasmatic resources. However, due to a lack of appropriate culture medium, efficient induction and stable maintenance of pig iPSCs with practical value remains challenging. Here, we established an efficient induction system for exogenous gene-independent iPSCs under chemically defined culture condition previously used for generation of stable pig pre-gastrulation epiblast stem cells (pgEpiSCs). WNT suppression was found to play an essential role in establishment of exogenous gene-independent iPSCs. Strikingly, stable integration-free pig iPSCs could be established from pig somatic cells using episomal vectors in this culture condition. The iPSCs had pluripotency features and transcriptome characteristics approximating pgEpiSCs. More importantly, this induction system may be used to generate integration-free iPSCs from elderly disabled rare local pig somatic cells and the iPSCs could be gene-edited and used as donor cells for nuclear transfer. Our results provide novel insights into potential applications for genetic breeding of livestock species and pre-clinical evaluation of regenerative medicine.

A “selective secondary tissue attachment” method for isolation and purification of mammary epithelial cells

BackgroundMammary epithelial cells (MECs) are specific target cells to study the underlying mechanism for mammary gland development and lactation, mammary gland bioreactor and breast cancer pathogenesis. However, the conventional isolation and purification methods of MECs have restricted the research and application of its related fields, because the isolated MECs population was always mixed with other cell types. ObjectiveIn order to solve the problem of incomplete purification of MECs isolated in vitro, it is very necessary to establish the optimal culture method for its isolation and purification. MethodIn this study, a method were called the “selective secondary tissue attachment method”, which were proved to be effective and accurate by the purity, cellular viability, biological characteristic, and transgenic efficiency of the purified MECs. Key resultsThe results showed that compared with traditional methods, this method could obtain 100% MECs population with high purity and high cell viability in vitro, and these purified cells showed high transgenic efficiency and a high number of positive clones. In addition, the early embryo development rate could significantly improve when the purified mammary epithelial cells were used as donor cells for nuclear transfer. ConclusionsTherefore, this study provides a versatile and effective method for the isolation of MECs with high purity, which can be used further for mammary-related research. ImplicationsIt is most effective approach to isolate mammary epithelial cells by “selective secondary tissue attachment method”.

Effects of Donor Cell Types on the Development of Bovine Embryos Using Cytoplasm Injection Cloning Technology

Cytoplasm injection cloning technology (CICT) is an efficient technique for evaluating the developmental potential of cloned embryos. In this study, we investigated the effects of donor cell type on the developmental potential and quality of cloned bovine embryos. Adult fibroblasts (AFs) and embryonic cells (ECs) were used as donor cells to clone bovine embryos using CICT. We initially used AF cells to develop cloned embryos and then cultured the cloned day-8 blastocysts for 10 days to obtain ECs as donor cells for second embryo cloning. We found that the bovine blastocysts cloned using AF cells had significantly reduced developmental rates, embryo quality, and ratios of inner cell mass (ICM) to the total number of cells compared to those using ECs as donor cells. Furthermore, there were significant differences in the DNA methyltransferase-, histone deacetylation-, apoptosis-, and development-related genes at the blastocyst stage in embryos cloned from AFs compared to those in embryos cloned from ECs. Our results suggest that using ECs as donor cells for nuclear transfer enhances the quantity and quality of cloned embryos. However, further investigation is required in terms of determining pregnancy rates and developing cloned embryos from different donor cell types.

Isolation of Bovine Skin-Derived Precursor Cells and Their Developmental Potential After Nuclear Transfer.

Nuclei from less differentiated stem cells yield high cloning efficiency. However, pluripotent stem cells are rather difficult to obtain from bovines. Skin-derived precursor (SKPs) cells exhibit a certain degree of pluripotency, which has been shown to enhance the efficiency of nuclear transfer (NT) in pigs. In this study, bovine SKPs were isolated and characterized. Results showed that bovine SKPs expressed nestin, fibronectin, vimentin, pluripotency-related genes, and characteristic neural crest markers, such as NGFR, PAX3, SOX9, SNAI2, and OCT4. Bovine SKPs and fibroblasts were used as NT donor cells to examine and compare the preimplantation developmental potential of reconstructed embryos after somatic cell nuclear transfer (SCNT). Bovine SKP-cloned embryos displayed higher developmental competence in terms of blastocyst formation rate and total cell number in blastocysts compared with the bovine embryonic fibroblast-cloned embryos. This study revealed that bovine SKPs may be considered excellent candidate nuclear donors for SCNT and may provide a promising platform for transgenic cattle generation.

Quiescence Loosens Epigenetic Constraints in Bovine Somatic Cells and Improves Their Reprogramming into Totipotency.

Reprogramming by nuclear transfer (NT) cloning forces cells to lose their lineage-specific epigenetic marks and reacquire totipotency. This process often produces molecular anomalies that compromise clone development. We hypothesized that quiescence alters the epigenetic status of somatic NT donor cells and elevates their reprogrammability. To test this idea, we compared chromatin composition and cloning efficiency of serum-starved quiescent (G0) fibroblasts versus nonstarved mitotically selected (G1) controls. We show that G0 chromatin contains reduced levels of Polycomb group proteins EED, SUZ12, PHC1, and RING2, as well as histone variant H2A.Z. Using quantitative confocal immunofluorescence microscopy and fluorometric enzyme-linked immunosorbent assay, we further show that G0 induced DNA and histone hypomethylation, specifically at H3K4me3, H3K9me2/3 and H3K27me3, but not H3K9me1. Collectively, these changes resulted in a more relaxed G0 chromatin state. Following NT, G0 donors developed into blastocysts that retained H3K9me3 hypomethylation, both in the inner cell mass and trophectoderm. G0 blastocysts from different cell types and cell lines developed significantly better into adult offspring. In conclusion, serum starvation induced epigenetic changes, specifically hypotrimethylation, that provide a mechanistic correlate for increased somatic cell reprogrammability.

Methyl-CpG-Binding Protein 2 Improves the Development of Mouse Somatic Cell Nuclear Transfer Embryos.

Methyl-CpG-binding domain proteins (MBPs) connect DNA methylation and histone modification, which are the key changes of somatic cell reprogramming. Methyl-CpG-binding protein 2 (MeCP2) was the first discovered MBP that has been extensively studied in the neurodevelopmental disorder Rett syndrome. However, a role for MeCP2 during cellular reprogramming associated with somatic cell nuclear transfer (SCNT) has not been examined. In this study, we discovered that MeCP2 expression was significantly lower in embryos generated by SCNT compared with those generated by intracytoplasmic sperm injection (ICSI). We genetically modified mouse embryonic fibroblasts (MEFs) to overexpress MeCP2 and serve as donor cells for nuclear transfer (NT) to investigate the effects of MeCP2 on preimplantation development of SCNT embryos. The blastocyst rate (35.71%) of MeCP2 overexpressed embryos (NT(+)) was significantly greater than in nontransgenic embryos (NT(-), 24.29%). Furthermore, immunofluorescence experiments revealed that 5-methylcytosine (5mC) was transferred to 5-hydroxymethylcytosine (5hmC) to a greater extent in NT(+) embryos than in NT(-) embryos. Real-time PCR evaluation of gene expression also showed that embryonic development-associated genes, such as Oct4 and Nanog, were significantly higher in the NT(+) group compared to the NT(-) group. Collectively, these results suggested that MeCP2 facilitated Tet3 activity, enhanced expression of pluripotency-related genes, and eventually improved the development of NT embryos. Finally, we performed chromatin immunoprecipitation to identify direct targets of MeCP2 and constructed a protein interaction network to elucidate several putative MeCP2 targets.

Improving the development of early bovine somatic-cell nuclear transfer embryos by treating adult donor cells with vitamin C.

Vitamin C (Vc) has been widely studied in cell and embryo culture, and has recently been demonstrated to promote cellular reprogramming. The objective of this study was to identify a suitable Vc concentration that, when used to treat adult bovine fibroblasts serving as donor cells for nuclear transfer, improved donor-cell physiology and the developmental potential of the cloned embryos that the donor nuclei were used to create. A Vc concentration of 0.15 mM promoted cell proliferation and increased donor-cell 5-hydroxy methyl cytosine levels 2.73-fold (P < 0.05). The blastocyst rate was also significantly improved after nuclear transfer (39.6% treated vs. 26.0% control, P < 0.05); the average number of apoptotic cells in cloned blastocysts was significantly reduced (2.2 vs. 4.4, P < 0.05); and the inner cell mass-to-trophectoderm ratio (38.25% vs. 30.75%, P < 0.05) and expression of SOX2 (3.71-fold, P < 0.05) and POU5F1 (3.15-fold, P < 0.05) were significantly increased. These results suggested that Vc promotes cell proliferation, decreases DNA methylation levels in donor cells, and improves the developmental competence of bovine somatic-cell nuclear transfer embryos.

Cloning Efficiency and a Comparison between Donor Cell Types

Dolly the sheep cloning “the first cloning process” was derived by somatic cell nuclear transfer and it had reported that the clone got premature senescence as a result of continues telomere shortening and ongoing decrease in telomerase activity by time; thus majority of recent researches is directed to use other types of donor cells to be transferred into the recipient enucleated oocyte to maintain full-term and healthy postnatal development for the clone. Embryonic cells such as embryonic stem cell and primordial germ cell were on top as a product of high activity of telomerase, but it cannot be used to clone an adult and primordial germ cell could only be used in nuclear transfer in early stages of embryonic development. Adult stem cell and adult germ cell also had shown increase in telomerase activity but using germ cell as a donor cell at specific day postcoitum had shown incompetence to satisfy full-term development of embryo making it inadequate to be donor cell in cloning process. Another effective cell that could reverse cellular aging in cloning is fibroblast cell. Sertoli cell in male and cumulus cell in female had shown the high efficiency to be donor cells in nuclear transfer. As we suppose that cloning will soon be applicable in many fields such as pharmacy, agriculture, biotechnology and medicine, here, we review current progress in cloning including several types of donor cells had been used in cloning.

Expression pattern of JMJD1C in oocytes and its impact on early embryonic development.

Cell reprogramming mediated by histone methylation and demethylation is crucial for the activation of the embryonic genome in early embryonic development. In this study, we employed quantitative real-time polymerase chain reaction (qRT-PCR) to detect mRNA levels and expression patterns of all known histone demethylases in early germinal vesicle stage and in vitro-matured metaphase II (MII) oocytes (which are commonly used as donor cells for nuclear transfer). On screening, the Jumonji domain containing 1C (JMJD1C) gene had the highest level of expression and hence was used for subsequent experiments. We also found that JMJD1C was primarily expressed in the nucleus and showed relatively high levels of expression at the 2-cell, 4-cell, 8-cell, 16-cell, morula, and blastocyst stages of embryos developed from MII oocytes fertilized in vitro. Further, we knocked down the JMJD1C gene in MII oocytes using siRNA and monitored the cleavage of zygotes and development of early embryos after in vitro fertilization. The results showed that the zygote cleavage and blastocyst rates of the transfection group were reduced by 57.1 ± 0.07 and 50 ± 0.01% respectively, which were significantly lower than those of the negative control group (P < 0.05). These data suggest that JMJD1C plays a key role in the normal development of early bovine embryos. Our results also provide a theoretical basis for the investigation of the role and molecular mechanism of histone demethylation in the early development of bovine embryos.

Positive Correlation Between the Efficiency of Induced Pluripotent Stem Cells and the Development Rate of Nuclear Transfer Embryos When the Same Porcine Embryonic Fibroblast Lines Are Used As Donor Cells

Induced pluripotent stem cells (iPSCs) and nuclear transfer (NT) are two of the primary routes to reprogram differentiated cells back to the pluripotent state. However, it is still unknown whether there is any correlation between the reprogramming efficiency of iPSCs and NT if the same donor cells are employed. In this study, six porcine embryonic fibroblast (PEF) lines from Landrace (L1, L6, L9) or Congjiang local pigs (C4, C5, C6) were used for iPSC induction and NT. Furthermore, the resultant iPSCs from four PEF lines (L1, L6, C4, and C5) were used for NT (iPSC-NT), and the expression of exogenous genes was detected in iPSC-NT embryos by real-time PCR. The results showed that the efficiency of iPSC lines established from different PEF lines were significantly different. When the same PEF lines were used as donor cells for NT, the blastocysts rates were also different among different PEF lines and positively related with iPSCs induction efficiency. When the iPSCs were used as donor cells for NT, compared with the source PEFs, the blastocysts rates were significantly decreased. Real-time PCR results indicated that exogenous genes (Oct4, c-Myc) continued to be expressed in iPSC-NT embryos. In summary, our results demonstrate that there was a positive correlation between iPSCs and NT reprogramming efficiency, although the mechanism of these two routes is different. This may provide a new method to select the appropriate donor cells for inducing iPSCs.

Efficient generation of mouse ESCs-like pig induced pluripotent stem cells

Dear Editor, Porcine induced pluripotency stem cells (piPSCs) are promised in basic research, animal husbandry and regenerative medicine. However, the efficiency of the piPSCs induction has been low and the generated piPSCs varied in cell morphology and cell characteristics. Here we report a novel approach to improve efficiency of piPSCs generation. The induced piPSCs are dome-shaped mouse embryonic stem cells (ESCs)-like and display molecular properties of mouse ESCs. Electroporation study reveals that mouse ESCslike status facilitates genetic manipulating of piPSCs. Importantly, we demonstrate that the domed piPSC colonies are more suitable as donor cells for nuclear transfer (NT) to generate reconstructed embryos than those flattened piPSCs. The potential applications of the newly generated piPSCs in ungulate pluripotent research are discussed.

Stable transfection and identification of a hair follicle-specific expression vector of IGFBP-5 in goat fetal fibroblasts

The insulin-like growth factor-binding protein-5 (IGFBP-5) is one of the 6 members of the IGFBP family and is involved in the regulation of cell growth, apoptosis, and other IGF-stimulated signaling pathways. To determine the significance of IGFBP-5 in the Inner Mongolia Cashmere goat (Capra hircus), a hair follicle-specific expression vector of IGFBP-5, pCDsRed2-K-IGFBP5 (6.7 kb), was constructed by cloning IGFBP-5 downstream of the keratin-association protein (KAP)6-1 promoter and inserting this fragment into pCDsRed2, which contains a red fluorescent protein (DsRed) expression unit. Inner Mongolia Cashmere goat fetal fibroblast (GFb) cells were transfected with the expression vector by using Lipofectamine(TM) 2000. Cell clones that stably expressed red fluorescence were obtained after selection with Geneticin (G418). The transgene in the cell clones was examined by polymerase chain reaction to verify that exogenous DNA (pKAP6-1 and IGFBP-5) had integrated stably into GFb cells. These data suggest that this method can be used for the construction of a hair follicle-specific expression vector for functional genetic analyses and for obtaining stable transfection donor cells for nuclear transfer.

Effect of potassium simplex optimization medium (KSOM) and embryo screening on the production of human lactoferrin transgenic cloned dairy goats

In this study, we produced cloned transgenic dairy goat based on dairy goat ear skin fibroblast as donor cells for nuclear transfer (NT), which were modified by human lactoferrin ( hLF ) gene. The developmental competence of NT embryos was compared with either between different embryo culture medium, potassium simplex optimization medium (KSOM) and tissue culture medium (TCM 199), or different classification of NT embryos (48 h after fusion). First we cultured NT embryos to cleavage stage (48 h after fusion) by TCM 199 supplemented with 1 mg/ml bovine serum albumin BSA and KSOM, then used TCM 199 supplemented with 10% FBS to culture them to blastula stage. The results show that the NT embryos in KSOM (19.5%) were superior to TCM 199 (10.6%) in blastulation. In the second experiment, we found that the growth rate of NT embryos (48 h after fusion) was different, then we divided them into four groups: 2-cell, 3- to 4-cell, 5- to 8-cell and >8-cell in stereo microscope and cultured them in vitro respectively. The results show day-2 embryos at 3-4cell and 5-8cell stage (31.9 and 28.2%, P 8-cell (8.3%) stage, and finally three healthy cloned transgenic goat were successfully produced using 3-8 cell embryos at Day-2 (82%). Using Hoechst 33342 staining, we also found that the >8 cells embryos at Day- 2 demonstrated higher frequency of fragmentation, which may be the one cause of the low blastocyst formation rate. This study therefore demonstrates that KSOM medium could be selected as the early embryo culture medium, and 3-8 cell embryos at day-2 (48 h after fusion) may be the suitable embryos for transplantation, which could reduce the nuclei fragmentation and result in good quality blastocysts that may also enhance the efficiency of transgenic cloned dairy goats production, as well as decrease the economic loss due to embryonic mortality when embryos are transferred to synchronized recipients. Key words: Nuclear transfer, KSOM, transgenic, human lactoferrin, dairy goat.

Production of myostatin-targeted goat by nuclear transfer from cultured adult somatic cells

Myostatin, a member of the transforming growth factor-β family, acts as a negative regulator of skeletal muscle mass. In this study, myostatin-targeted caprine fibroblasts were obtained and subjected to SCNT to determine whether myostatin-knockout goats could be created. Fibroblasts from a 2-mo-old goat were transfected with a myostatin-targeted vector to prepare transgenic donor cells for nuclear transfer. After serum-starvation (for synchronization of the cell cycle), the percentage of transgenic fibroblasts in the G0/G1 phase increased (66.2% vs. 82.9%; P < 0.05) compared with that in the control group, whereas the apoptosis rate and mitochondrial membrane potential were unaffected (P > 0.05). There were no significant differences between in vivo- and in vitro-matured oocytes as recipient cytoplasts for rates of fusion (86.5% vs. 78.4%), pregnancy (21.6% vs. 16.7%), or kidding (2.7% vs. 0%). One female kid from an in vivo-matured oocyte was born, but died a few hours later. Microsatellite analysis and polymerase chain reaction identification confirmed that this kid was genetically identical to the donor cells. Based on Western blot analysis, myostatin of the cloned kid was not expressed compared with that of nontransgenic kids. In conclusion, SCNT using myostatin-targeted 2-mo-old goat fibroblasts as donors has potential as a method for producing myostatin-targeted goats.

Generation of human lactoferrin transgenic cloned goats using donor cells with dual markers and a modified selection procedure

The objective was to use dual markers to accurately select genetically modified donor cells and ensure that the resulting somatic cell nuclear transfer kids born were transgenic. Fetal fibroblast cells were transfected with dual marking gene vector (pCNLF-ng) that contained the red-shifted variant of the jellyfish green fluorescent protein (LGFP) and neomycin resistance (Neo) markers. Cell clones that were G418-resistant and polymerase chain reaction-positive were subcultured for several passages; individual cells of the clones were examined with fluorescence microscopy to confirm transgenic integration. Clones in which every cell had bright green fluorescence were used as donor cells for nuclear transfer. In total, 86.7% (26/30) cell clones were confirmed to have transgenic integration of the markers by polymerase chain reaction, 76.7% (23/30) exhibited fluorescence, but only 40% (12/30) of these fluorescent cell clones had fluorescence in all cell populations. Moreover, through several cell passages, only 20% (6/30) of the cell clones exhibited stable LGFP expression. Seven transgenic cloned offspring were produced from these cells by nuclear transfer. Overall, the reconstructed embryo fusion rate was 76.6%, pregnancy rates at 35 and 60 days were 39.1% and 21.7%, respectively, and the offspring birth rate was 1.4%. There were no significant differences between nuclear transfer with dual versus a single (Neo) marker (overall, 73.8% embryo fusion rate, 53.8% and 26.9% pregnancy rates, and 1.9% birth rate with five offspring). In conclusion, the use of LGFP/Neo dual markers and an optimized selection procedure reliably screened genetically modified donor cells, excluded pseudotransgenic cells, and led to production of human lactoferrin transgenic goats. Furthermore, the LGFP/Neo markers had no adverse effects on the efficiency of somatic cell nuclear transfer.

Embryonic Development and Implantation Related Gene Expression of Oocyte Reconstructed with Bovine Trophoblast Cells

The temporal progressive increase of interferon tau (IFNτ) secretion from the bovine trophoblast is a major embryonic signal of establishing pregnancy. Here, we cultured and isolated bovine trophoblast cells (BTs) from IVM/IVF oocytes and in vitro produced blastocysts, used them, for the first time, as donor cells for nuclear transfer and compared them with adult fibroblasts (AFs) as donor cells. BTs were reprogrammed in enucleated oocytes to blastocysts with similar efficiency to AFs (14.5% and 15.6% respectively, P≤0.05). The levels of IFNτ, CDX2 and OCT4 expression in IVF-, BT- and AF-derived blastocysts were analyzed using reverse transcription polymerase chain reaction and reverse transcription quantitative polymerase chain reaction (RT-PCR and RT-qPCR). IVF-produced embryos were used as reference to analyze the linear progressive expression of IFNτ through mid, expanded and hatching blastocysts. RT-PCR and RT-qPCR studies showed that IFNτ expression was higher in BT-derived blastocysts than IVF- and AF-derived blastocysts. Both IVF- and BT-derived blastocysts showed a progressive increase in IFNτ expression as blastocyst development advanced when it compared with AF-derived blastocysts. OCT4 was inversely related with IFNτ expression, while CDX2 was found to be directly related with IFNτ temporal expression. Persistence of high expression of IFNτ and CDX2 was found to be higher in BT-derived embryos than in IVF- or AF-derived embryos. In conclusion, using BTs expressing IFNτ as donor cells for bovine NT could be a useful tool for understanding the IFNτ genetics and epigenetics.

118 INDUCING PLURIPOTENCY IN SOMATIC CELLS FROM THE SNOW LEOPARD (PANTHERA UNCIA), AN ENDANGERED FELID

Induced pluripotency is a new approach to produce embryonic stem-like cells from somatic cells that provides a unique means to understand both pluripotency and lineage assignment. To investigate whether this technology could be applied to endangered species, where the limited availability of gametes makes research on embryonic stem cells difficult, we attempted generation of induced pluripotent stem (iPS) cells from snow leopard (Panthera uncia) fibroblasts by retroviral transfection with Moloney-based retroviral vectors (pMX) encoding either 4 (Oct-4, Sox-2, Klf-4 and cMyc) or 5 (Oct-4, Sox-2, Klf-4, cMyc and Nanog) human transcription factors. Transduction efficiency of the retrovirus was ascertained using pMX-green fluorescent protein transgene expression and averaged 96% from 3 repeated experiments. The reprogramming efficiency of initial colony formation was 0.000308% (37/120 000 cells plated) for 4-factor induction compared with 0.000517% (62/120 000) for 5-factor induction. Transduction with 4 factors resulted in the formation of small colonies of cells, which could not be maintained for more than 4 passages (P4). However, addition of Nanog to the transfection cocktail produced stable iPS cell colonies, which formed as early as Day 3. Colonies of cells were selected at Day 5 and expanded in vitro on mouse embryonic fibroblast feeder cells. The resulting cell line was positive for alkaline phosphatase, Oct-4, Nanog and stage-specific embryonic antigen-4 at P14. Also, RT-PCR confirmed that endogenous Oct-4 and Nanog were expressed by snow leopard iPS cells from P4; although all 5 human transgenes were transcribed at P4, Oct-4, Sox-2 and Nanog transgenes were silenced as early as P14, suggesting that reprogramming of the endogenous pluripotent genes had occurred. When injected into immune-deficient mice, snow leopard iPS cells formed teratomas containing tissues representative of the 3 germ layers. This study describes the first derivation of iPS cells from the endangered snow leopard and is also the first report on induced pluripotency in felid species. Our results demonstrate that addition of Nanog to the reprogramming cocktail was essential for derivation of iPS lines in this felid and that iPS cells provide a unique source of pluripotent cells with utility in conservation for cryopreservation of genetics, as a source of reprogrammed donor cells for nuclear transfer or for directed differentiation to gametes in the future.

59 HISTONE DEACETYLASE 1 KNOCK-DOWN IN BOVINE FIBROBLAST CELLS AND CLONED EMBRYOS

Histone deacetylase 1 (HDAC1) is one of the most conserved enzymes present in the nuclei of cells. It was thought to be the most important enzyme in the regulation of histone deacetylation process. However, the function of HDAC1 in bovine fibroblast cells and nuclear transfer embryos is not clear. In the present study, sh299 (5′GCAAGCAGATGCAGAGATTTCAAGA GAATCTCTGCATCTGCTTGCTT3′) targeting of HDAC1 mRNA sequence was designed in the PGP/U6/GFP vector (short hairpin RNA, shRNA, expression vector). The sh299 vector was transfected into bovine fibroblast cells by transfection reagent FuGENE HD and the positive cells were identified by the expression of green fluorescent protein (GFP). Histone deacetylase 1 down-regulation in bovine fibroblast cells was measured by quantitative real-time PCR (qRT-PCR with the 2–ΔΔCT method) at 48 h after sh299 vector transfection at mRNA level. Immunocytochemistry was performed at 96 h after sh299 vector transfection to examine the HDAC1 protein level. Bovine fibroblast cells of the control group, negative control vector transfection group and sh299 vector transfection group were used as donor cells for nuclear transfer. Cleavage rates and expression of HDAC1 mRNA in bovine cloned embryos were examined at 48 h after nuclear transfer. Blastocyst rates and total cell numbers of blastocysts were examined on Day 7 post-nuclear transfer. Data were analysed with Statistics Production for Service Solution (version 16.0; SPSS) by 1-way ANOVA. A value of P &lt; 0.05 was considered to be significantly different. Our results showed that the expression level of HDAC1 was significantly reduced by transfection of the sh299 expression vector. The GFP-positive cells showed decreased signal for HDAC1 by immunocytochemistry. It was suggested that the transfection of the sh299 expression vector reduced HDAC1 expression in bovine fibroblast cells at both mRNA level and protein level. Following nuclear transfer, expression of HDAC1 was significantly reduced in the sh299 vector transfection group (donor cells were transfected by the sh299 vector) compared to the other 2 groups. No significant difference (P &gt; 0.05) was seen in cleavage rates among bovine cloned embryos in the sh299 vector transfection group (52.3 ± 3.4%), control group (51.1 ± 5.4%) and negative control vector transfection group (56.2 ± 3.1%). However, blastocyst rates and total cell numbers of blastocysts were significantly lower (P &lt; 0.05) in the sh299 vector transfection group (4.2 ± 1.3% and 75.4 ± 9.2, n = 89) compared to the control group (18.2 ± 3.7% and 97.6 ± 7.3, n = 78) and negative control vector transfection group (18.9 ± 1.7% and 104.2 ± 10.3, n = 83). In conclusion, HDAC1 down-regulation in bovine fibroblast cells and cloned embryos by the sh299 expression vector indicated that HDAC1 was essential for the development of bovine cloned embryos. This work was supported by the grant from National Transgenic Animal Program (No.2009ZX08007-004B) in China.

19 CHANGES IN PLASMA STEROID CONCENTRATIONS DURING GESTATION IN COWS WITH SPONTANEOUS ABORTION OF SOMATIC CELL CLONED FETUSES

Cloning of mammals by nuclear transfer frequently results in gestational failure with a variety of abnormalities that are likely due to inappropriate epigenetic reprogramming. Monitoring the placental function during gestation is important to clarify the cause of abnormalities in cloned animals. Sex steroids are produced in the bovine placenta and their levels in maternal peripheral blood are a useful measure of placentation. The objective of this study was to investigate changes in plasma concentrations of sex steroids during gestation in cows aborting cloned fetuses. Donor cells for nuclear transfer were obtained from subculture of cumulus cells retrieved from ovarian follicles of a Japanese Black cow. Recipient oocytes were derived from ovaries obtained at an abattoir and matured in vitro. Metaphase II oocytes were enucleated and each fused with a donor cell by DC pulses. Nuclear-transferred oocytes were activated and cultured for 7 days. Embryos developed to the blastocyst stage were each transferred into the uterine horn ipsilateral to the ovary bearing the CL of 39 multiparous Japanese Black and Holstein crossbred cows at 7 to 8 days after the day of standing oestrus (day 0). Fourteen recipient cows were diagnosed pregnant on Day 40 by ultrasonography and 7 cows delivered at full term. The other seven miscarried on Day 66, 81, 85, 89, 97, 104 and 211. Blood was collected from these cows at least once a week following the pregnancy diagnosis. Progesterone, estrone, oestradiol-17β and estrone sulfate in the blood plasma were measured by RIA and were compared with those in pregnant AI cows. Statistical differences at stages of gestation were analysed with repeated-measures ANOVA. In all miscarried cows, progesterone concentrations were similar to those in AI cows until several days before abortion and then rapidly decreased to the basal level. Concentrations of all estrogens stayed low until abortion in six cows aborting by day 104, whereas estrone and oestradiol-17β started to increase around Day 80 and estrone sulfate gradually increased from around Day 50 and started to increase drastically around Day 80 in AI cows. In another cow aborting on Day 211, profiles of estrone and oestradiol-17β were similar to those in AI cows until around Day 150. Thereafter, concentrations of these estrogens gradually decreased to the basal levels by Day 160 and stayed low until abortion. In this cow, gradual increase in estrone sulfate during Day 50 to 80 was not observed, but the difference in the concentration was not statistically significant from AI cows. The following profile of estrone sulfate was similar to those in active estrogens. The fetus was still alive on day 160 and fetal death was confirmed on day 180 by ultrasonography. These results suggest the possibility that developmental or functional failure of placenta associated with steroid synthesis may be a cause of mid-term miscarriage of a cloned fetus.

Inducing pluripotency in somatic cells from the snow leopard (Panthera uncia), an endangered felid

Induced pluripotency is a new approach to produce embryonic stem-like cells from somatic cells that provides a unique means to understand both pluripotency and lineage assignment. To investigate whether this technology could be applied to endangered species, where the limited availability of gametes makes production and research on embryonic stem cells difficult, we attempted generation of induced pluripotent stem (iPS) cells from snow leopard (Panthera uncia) fibroblasts by retroviral transfection with Moloney-based retroviral vectors (pMXs) encoding four factors (OCT4, SOX2, KLF4 and cMYC). This resulted in the formation of small colonies of cells, which could not be maintained beyond four passages (P4). However, addition of NANOG, to the transfection cocktail produced stable iPS cell colonies, which formed as early as D3. Colonies of cells were selected at D5 and expanded in vitro. The resulting cell line was positive for alkaline phosphatase (AP), OCT4, NANOG, and Stage-Specific embryonic Antigen-4 (SSEA-4) at P14. RT-PCR also confirmed that endogenous OCT4 and NANOG were expressed by snow leopard iPS cells from P4. All five human transgenes were transcribed at P4, but OCT4, SOX2 and NANOG transgenes were silenced as early as P14; therefore, reprogramming of the endogenous pluripotent genes had occurred. When injected into immune-deficient mice, snow leopard iPS cells formed teratomas containing tissues representative of the three germ layers. In conclusion, this was apparently the first derivation of iPS cells from the endangered snow leopard and the first report on induced pluripotency in felid species. Addition of NANOG to the reprogramming cocktail was essential for derivation of iPS lines in this felid. The iPS cells provided a unique source of pluripotent cells with utility in conservation through cryopreservation of genetics, as a source of reprogrammed donor cells for nuclear transfer or for directed differentiation to gametes in the future.