Domain-containing Protein Research Articles

Single-stranded DNA binding to the transcription factor PafBC triggers the mycobacterial DNA damage response.

The DNA damage response in mycobacteria is controlled by the heterodimeric transcription factor PafBC, a member of the WYL domain-containing protein family. It has been shown that PafBC induces transcription of its regulon by reprogramming the housekeeping RNA polymerase holoenzyme to recognize PafBC-dependent promoters through sigma adaptation. However, the mechanism by which DNA damage is sensed and translated into PafBC activation has remained unclear. Here, we demonstrate that the binding of single-stranded DNA (ssDNA) to the WYL domains of PafBC activates the transcription factor. Our cryo-electron microscopy structure of full-length PafBC in its active conformation, bound to the transcription initiation complex, reveals a previously unknown mode of interaction between the ssDNA and the WYL domains. Using biochemical experiments, we show that short ssDNA fragments bind to PafBC dynamically, resulting in deactivation as ssDNA levels decrease postrepair. Our findings shed light on the mechanism linking DNA damage to PafBC activation and expand our understanding of WYL domain-containing proteins.

Transcriptomic Response of Balamuthia mandrillaris to Lippia graveolens Extract Fractions

Balamuthia mandrillaris is a free-living amoeba pathogenic to humans, causing amoebic granulomatous encephalitis (GAE). Due to the associated mortality rates of <95%, the absence of treatments, and a clear understanding of the pathogenesis of this amoeba, Lippia graveolens could be an interesting alternative since it has been used against bacteria, fungi, and other pathogenic protozoa. This study employed RNA sequencing to analyze differentially expressed genes (DEGs), following treatment with two fractionated L. graveolens extracts (concentration: 150 µg/mL) at 48, 96, and 120 h. The DEGs identified are associated with several functions such as stress responses (Prohibitin domain-containing protein), and oxidative damage repair and cell stability (Peroxiredoxin). Genes implicated in virulence and host interaction also showed significant expression changes, such as the ADP ribosylation factor (Arf) GTPase and ephrin type-A receptor, alongside transcription factors involved in the phagocytosis of amoebas. Additionally, the analysis of Gene Ontology categories revealed terms including transmembrane signaling receptor and protein tyrosine activity, DNA replication initiation, the mitotic M phase, and membrane integrity. These results provide valuable insights into the molecular mechanisms utilized by B. mandrillaris to respond to environmental stressors and the repression of genes related to essential functions, which could serve as potential targets for developing novel strategies.

Identification of Elizabethkingia species by MALDI-TOF MS proteotyping.

Elizabethkingia species are groups of emerging opportunistic bacterial pathogens with a high mortality rate, causing healthcare-associated outbreaks worldwide. Rapid identification of Elizabethkingia species is important becausethese species show intrinsically carbapenem resistance and there are few data for using appropriate antibiotics. Until now, only whole-genome sequencing could accurately identify the seven Elizabethkingia species. Therefore, establishing rapid and accurate identification methods for Elizabethkingia species in clinical laboratories is vital. In this study, we developed new methods for identifying Elizabethkingia species using four biomarker protein peaks-ribosomal L29, L30, S21, and the YtxH domain-containing proteins by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) proteotyping. This study demonstrates the potential of routine MALDI-TOF MS -based laboratory examination for the early identification of Elizabethkingia species.

Contact and communication: ZO-2 and the Hippo pathway.

The PDZ domain-containing protein ZO-2 is defined as a tight junction (TJ) protein, but is also known to have a role in the maintenance of cellular apicobasal polarity and to function as a signalling molecule in several pathways, including the Hippo pathway. In this issue, Liu OX etal. [(2024) FEBS J, https://doi.org/10.1111/febs.17304] report how the multiple protein binding sites of ZO2 protein allow it to act as a scaffold to facilitate its signalling functions.

Evaluation of twin-arginine translocation substrate proteins as potential antigen candidates for serodiagnosis of brucellosis

IntroductionBrucellosis, an infectious zoonotic disease caused by members of the genus Brucella, results in chronic multi-organ injury. Improving the specificity and sensitivity of serological methods for diagnosing brucellosis necessitates the development of novel diagnostic antigens. The twin-arginine translocation (Tat) pathway is responsible for transporting folded proteins across the cytoplasmic membrane and has been implicated in the virulence of Brucella. Three Tat substrate proteins—L,D-transpeptidase ErfK (A0577), linear amide C-N hydrolase YxeI (A1479), and thioesterase domain-containing protein EntF (B0249)—contribute significantly to Brucella virulence. However, the roles of these Tat substrate proteins in diagnosing brucellosis remain unclear.MethodsIn this study, ErfK, YxeI, and EntF were expressed in prokaryotic cells and utilized as diagnostic antigens. The clinical sera from bovines and sheep diagnosed with brucellosis were analyzed using indirect ELISA with these proteins.ResultsFor bovine serum, the combined protein group (ErfK + YxeI + EntF) and YxeI demonstrated the highest diagnostic accuracy of 94.23% and 93.58%, respectively. Meanwhile, the combined protein group showed the strongest ability to detect Brucella in sheep serum, achieving an accuracy of 88.10%. Both the combined protein group and YxeI displayed no cross-reactivity with rabbit serum immunized against Yersinia enterocolitica O9, Escherichia coli O157:H7, Mycobacterium tuberculosis, Vibrio cholerae, Legionella, and Salmonella, indicating relatively good specificity.ConclusionThe findings of this study suggest that Tat substrate proteins serve as promising candidate antigens with significant potential value for the clinical diagnosis of brucellosis.

Translational regulation of SND1 governs endothelial homeostasis during stress.

Translational control shapes the proteome and is particularly important in regulating gene expression under stress. A key source of endothelial stress is treatment with tyrosine kinase inhibitors (TKIs), which lowers cancer mortality but increases cardiovascular mortality. Using a human induced pluripotent stem cell-derived endothelial cell (hiPSC-EC) model of sunitinib-induced vascular dysfunction combined with ribosome profiling, we assessed the role of translational control in hiPSC-ECs in response to stress. We identified staphylococcal nuclease and tudor domain-containing protein 1 (SND1) as a sunitinib-dependent translationally repressed gene. SND1 translational repression was mediated by the mTORC1/4E-BP1 pathway. SND1 inhibition led to endothelial dysfunction, whereas SND1 OE protected against sunitinib-induced endothelial dysfunction. Mechanistically, SND1 transcriptionally regulated UBE2N, an E2-conjugating enzyme that mediates K63-linked ubiquitination. UBE2N along with the E3 ligases RNF8 and RNF168 regulated the DNA damage repair response pathway to mitigate the deleterious effects of sunitinib. In silico analysis of FDA-approved drugs led to the identification of an ACE inhibitor, ramipril, that protected against sunitinib-induced vascular dysfunction in vitro and in vivo, all while preserving the efficacy of cancer therapy. Our study established a central role for translational control of SND1 in sunitinib-induced endothelial dysfunction that could potentially be therapeutically targeted to reduce sunitinib-induced vascular toxicity.

Blood pressure regulation through circadian variation: PRDM16 as a target in vascular smooth muscle cells.

The precise mechanisms of blood pressure (BP) regulation are not fully elucidated, and understanding BP regulation is crucial for managing hypertension and improving outcomes for cardiovascular disease. In this issue of the JCI, Wang et al. identified the transcription factor PR domain-containing protein 16 (PRDM16) as a regulator of both vascular smooth muscle cell contraction and the circadian response to BP control. PRDM16 directly transcriptionally controlled the expression of the adrenergic receptor α 1d and several clock genes crucial for BP circadian regulation. These findings identify a mechanism of how molecular pathways govern circadian BP variation, highlighting PRDM16 as a potential target for hypertension.

The HRAS-binding C2 domain of PLCη2 suppresses tumor-like synoviocytes and experimental arthritis in rheumatoid arthritis.

Fibroblast-like synoviocytes (FLSs), which are stromal cells that play key roles in rheumatoid arthritis (RA) pathophysiology, are characterized by a tumor-like phenotype and immunostimulatory actions. C2 domains in various proteins play roles in intracellular signaling and altering cellular characteristics, and some C2 domain-containing proteins exacerbate or alleviate certain malignant or inflammatory diseases. However, the roles of C2 domains in regulating the functions of RA FLSs remain unclear. Here we performed functional C2 domainomics with 144 C2 domain-containing viral vectors and identified the C2 domain of PLCη2 as a key regulator of RA FLSs. In mice, overexpressing PLCη2 or only its C2 domain PLCη2 (PLCη2_C2) diminished the proliferation, migration, invasion and inflammatory responses of RA FLSs, mitigating RA pathology; the absence of PLCη2 amplified these proinflammatory and destructive processes in RA FLSs in vivo. Mechanistically, PLCη2 and PLCη2_C2 participate in the pathological signaling of RA FLSs in a calcium-independent manner through protein-protein interactions. Specifically, PLCη2_C2 disrupted HRAS-RAF1 interactions, suppressing downstream signaling pathways, including the NF-κB, JAK-STAT and MAPK pathways. Collectively, these findings establish PLCη2 and PLCη2_C2 as novel inhibitory regulators in RA, suggesting promising therapeutic avenues for addressing FLS-driven disease mechanisms.

TAT-N24 enhances retinal ganglion cell survival by suppressing ZBP1-PANoptosome-mediated PANoptosis in an acute glaucoma mouse model.

The abrupt and substantial elevation of intraocular pressure (IOP) in acute glaucoma induces retinal ischemia/reperfusion (I/R) injury, resulting in progressive retinal ganglion cell (RGC) death and irreversible visual impairment. PANoptosis, a form of regulated cell death consisting of pyroptosis, apoptosis and necroptosis, is reported to be involved in high IOP-induced RGC death. However, the precise mechanisms of RGC death remain unclear, and neuroinflammation is considered to play a vital role. TAT-N24, a synthetic inhibitor targeting the p55 regulatory subunit of phosphatidylinositol 3-kinase (p55PIK) signaling, demonstrates anti-inflammatory effect in uveitis and may have certain neuroprotective effects. Therefore, we investigated whether TAT-N24 could shield RGCs from immunoinflammatory damage in an acute glaucoma mouse model and explored the potential mechanism associated with PANoptosis. A mouse model of acute ocular hypertension (AOH) was established. Intravitreal injection of TAT-N24 was conducted to evaluate its impact on RGC death. The expression levels of key components in PANoptosis were analyzed using RT-qPCR and Western blotting. Immunohistochemistry and immunofluorescence staining on eyeball sections were employed to assess the expression of p55PIK, Brn3a, and ionized calcium binding adaptor molecule 1 (Iba1). Retinal structure was examined by H&E staining, while cell apoptosis was evaluated by TdT-mediated dUTP nick end labeling (TUNEL). The results showed that intravitreal injection of TAT-N24 effectively alleviated RGC death and retinal damage induced by AOH injury. The key components in PANoptosis were markedly upregulated after AOH injury, while these components were significantly inhibited after TAT-N24 treatment. Moreover, the expression levels of Z-DNA-binding protein 1 (ZBP1)-PANoptosome (ZBP1, RIPK1, RIPK3, and Caspase-8), NLR family pyrin domain-containing protein 3 (NLRP3), and NLR family CARD domain-containing protein 4 (NLRC4) inflammasomes were notably elevated after AOH injury, which was significantly suppressed by TAT-N24. In conclusion, PANoptosis was involved in AOH-induced RGC death and retinal damage. TAT-N24 exhibited an anti-PANoptotic effect, protecting RGCs by inhibiting ZBP1-PANoptosome as well as NLRP3 and NLRC4 inflammasomes after AOH injury.

Upregulation of p52-ZER6 (ZNF398) increases reactive oxygen species by suppressing metallothionein-3 in neuronal cells.

ZNF398/ZER6 belongs to the Krüppel-associated box (KRAB) domain-containing zinc finger proteins (K-ZNFs), the largest family of transcriptional repressors in higher organisms. ZER6 exists in two isoforms, p52 and p71, generated through alternative splicing. Our investigation revealed that p71-ZER6 is abundantly expressed in the stomach, kidney, liver, heart, and brown adipose tissue, while p52-ZER6 is predominantly found in the stomach and brain. The role of p52-ZER6 in neurons has remained unclear. Leveraging open-source RNA-seq data, we identified metallothionein 3 (MT3) as a target gene of p52-ZER6 in mouse hippocampal neuronal HT-22cells. Through chromatin immunoprecipitation assays, we identified the putative DNA-binding motif (CTAGGGGGGTTGTTATCTCTTTGG) of p52-ZER6 in the promoter region of MT3. Furthermore, we demonstrated an interaction between p52-ZER6 and estrogen receptor alpha (ERα) in the nucleus of SH-SY5Y cells, which led to the inhibition of p52-ZER6's DNA occupancy on the promoter of the MT3 gene. MT3 is a cysteine-rich, low molecular-weight protein known for reducing oxidative stress, reactive oxygen species (ROS), and metal toxicity. Our study revealed that overexpression of p52-ZER6 reduced the levels of MT3, increasing ROS levels, which was mitigated by co-overexpression of ERα. Notably, we also observed upregulation of p52-ZER6 and reduction of MT3 in the cortex of 5xFAD, an Alzheimer's disease (AD) mouse model. These findings suggest a potential pathological mechanism involving p52-ZER6-mediated ROS production in AD pathogenesis.

SH2B1 promotes apoptosis in diabetic cataract via p38 MAPK pathway.

Patients with diabetes face an increased risk of developing cataracts, with unclear mechanisms. Our study illuminates these mechanisms by identifying differentially expressed proteins in the lens anterior capsule of patients with diabetic cataract (DC) and age-related cataract using quantitative proteomics. We found SH2 domain-containing adapter protein B1 (SH2B1) to be crucial in DC progression. Reduced SH2B1 expression was confirmed through PCR and western blotting in patient samples, diet-induced obese mice, and high-glucose (HG)-cultured human lens epithelial cells. Under HG conditions, cell proliferation decreased, while migration and apoptosis, alongside changes in Bcl2 and caspase-3 expression, increased. Overexpressing SH2B1 alleviated these changes and influenced the p38 mitogen-activated protein kinase (MAPK) signaling pathway. This suggests SH2B1 and the p38 MAPK pathway as significant in DC pathogenesis and potential therapeutic targets. Clinically, this could lead to therapies aimed at halting or slowing DC progression.

Genome-wide association study to identify candidate genes for submergence tolerance during rice seed germination.

Submergence tolerance QTLs for rice germination were identified via a genome-wide association study, and a new causal gene, LOC_Os06g17260, was identified. Submergence stress is a major obstacle limiting the application of direct seeding in rice cultivation. Rapid bud and root growth helps plants establish a stronger growth base and improve their submergence tolerance. Therefore, mining genes for bud length (BL) and root length (RL) helps in the development of varieties that are adaptable to submergence and improve seedling emergence and yield of direct-seeded rice. In this study, a genome-wide association study of BL and RL was performed on a diverse rice collection consisting of 300 accessions. We identified a total of 37 QTLs, 13 of which had phenotypic contributions > 10%. The novel QTLs qBL6.2/qRL6.8, qBL6.3/qRL6.9, qBL6.4/qRL6.10, and qBL6.5/qRL6.11 on chromosome 6 were stably detected across BL and RL, and a total of 31 genes were detected in these four intervals. Concerning the gene annotation information and expression profiles, LOC_Os06g17090, LOC_Os06g17120, LOC_Os06g17140, LOC_Os06g17220, and LOC_Os06g17260 were selected as possible target genes. Through the validation of a knockout transgenic experiment, LOC_Os06g17260 was identified as the causal gene for submergence tolerance in rice at the germination stage. LOC_Os06g17260 encodes UDP-glucoronosyl and a UDP-glucosyl transferase domain-containing protein and contains two major haplotypes, with the Hap1 germplasm presenting greater submergence tolerance at the germination stage. These results provide new clues for exploring the molecular mechanisms that regulate submergence tolerance in rice and provide a promising source of genes for the molecular breeding of direct-seeded rice.

Nuclear-localized HKDC1 promotes hepatocellular carcinoma through phosphorylating RBBP5 to upregulate H3K4me3.

Metabolic enzymes play significant roles in the pathogenesis of various cancers through both canonical and noncanonical functions. Hexokinase domain-containing protein 1 (HKDC1) functions beyond glucose metabolism, but its underlying mechanisms in tumorigenesis are not fully understood. Here, we demonstrate that nuclear-localized HKDC1 acts as a protein kinase to promote hepatocellular carcinoma (HCC) cell proliferation. Mechanistically, HKDC1 phosphorylates RB binding protein 5 (RBBP5) at Ser497, which is crucial for MLL1 complex assembly and subsequent histone H3 lysine 4 trimethylation (H3K4me3) modification. This leads to the transcriptional activation of mitosis-related genes, thereby driving cell cycle progression and proliferation. Notably, targeting HKDC1's protein kinase activity, but not its HK activity, blocks RBBP5 phosphorylation and suppresses tumor growth. Clinical analysis further reveals that RBBP5 phosphorylation positively correlates with HKDC1 levels and poor HCC prognosis. These findings highlight the protein kinase function of HKDC1 in the activation of H3K4me3, gene expression, and HCC progression.

A Novel Missense Variant in SORBS2 Is Causative With Familial Alzheimer's Disease.

Alzheimer's disease (AD) is a common neurodegenerative disorder with a substantial genetic component. Despite advances in elucidating the genetic underpinnings of AD, much of its heritability remains unexplained. Discovering novel genetic variants and understanding their pathogenic roles are crucial challenges in AD research. This study aimed to identify pathogenic genes and elucidate their role in familial early-onset AD (EOAD). Blood samples from an EOAD pedigree and Sorbin and SH3 Domain-Containing Protein 2 (SORBS2) T189M transgenic mice were analyzed. Cognitive function was assessed via the Morris water maze (MWM). Protein expression was evaluated by western blotting, while amyloid-β (Aβ) levels were quantified via immunohistochemistry and enzyme-linked immunosorbent assay. Inflammatory markers were measured using immunofluorescence and quantitative reverse transcription polymerase chain reaction (PCR). Neuronal morphology, including dendritic and spine alterations, was examined using Golgi staining. We identified a novel SORBS2 variant (c. 566C>T, p. T189M) in a Han Chinese family, segregating with AD in a Mendelian fashion. SORBS2 T189M transgenic mice exhibited cognitive deficits, cortical Aβ accumulation, and an increased Aβ42/Aβ40 ratio. Additionally, elevated levels of interleukin (IL)-1β, IL-6, tumor necrosis factor α (TNF-α), and ionized calcium-binding adaptor molecule 1 (Iba1)-positive microglia, along with neuronal loss, were observed in the brains of T189M mice. Our study suggest that the SORBS2 T189M variant is a novel candidate causal mutation associated with familial AD in a Chinese pedigree, contributing to AD pathogenesis by promoting neuroinflammation and neuronal injury. Notably, this study is the first to establish a link between SORBS2 mutations and AD.

DCBLD1 Modulates Angiogenesis by Regulation of the VEGFR-2 Endocytosis in Endothelial Cells.

Unwanted angiogenesis is involved in the progression of various malignant tumors and cardiovascular diseases, and the factors that regulate angiogenesis are potential therapeutic targets. We tested the hypothesis that DCBLD1 (discoidin, CUB, and LCCL domain-containing protein 1) is a coreceptor of VEGFR-2 (vascular endothelial growth factor receptor-2) and modulates angiogenesis in endothelial cells. A carotid artery ligation model and retinal angiogenesis assay were used to study angiogenesis using globe knockout or endothelial cell-specific conditional Dcbld1 knockout mice in vivo. Immunoblotting, immunofluorescence staining, plasma membrane subfraction isolation, Coimmunoprecipitation, and mass spectrum assay were performed to clarify the molecular mechanisms. Loss of Dcbld1 impaired VEGF (vascular endothelial growth factor) response and inhibited VEGF-induced endothelial cell proliferation and migration. Dcbld1 deletion interfered with adult and developmental angiogenesis. Mechanistically, DCBLD1 bound to VEGFR-2 and regulated the formation of VEGFR-2 complex with negative regulators: protein tyrosine phosphatases, E3 ubiquitin ligases (neuronal precursor cell-expressed developmentally downregulated gene 4, Nedd4 and c-Casitas B-lineage lymphoma, c-Cbl), and also Dcbld1 knockdown promoted lysosome-mediated VEGFR-2 degradation in endothelial cells. These findings demonstrated the essential role of endothelial DCBLD1 in regulating VEGF signaling and provided evidence that DCBLD1 promotes VEGF-induced angiogenesis by limiting the dephosphorylation, ubiquitination, and lysosome degradation after VEGFR-2 endocytosis. We proposed that endothelial DCBLD1 is a potential therapeutic target for ischemic cardiovascular diseases by the modulation of angiogenesis through regulation of the VEGFR-2 endocytosis.

Elevated SAMD3 expression in T cells predicts improved survival in pancreatic ductal adenocarcinoma patients

ObjectivePancreatic ductal adenocarcinoma (PDAC) has an immune-suppressive tumor microenvironment that contributes to resistance to immunotherapy. This study aimed to demonstrate that elevated sterile alpha motif domain-containing protein 3 (SAMD3) expression in effector CD8+ T cells was associated with improved survival in PDAC patients.DesignWe investigated the heterogeneity and gene expression profiles of T cells using a single-cell RNA sequencing (sc-RNA-seq) dataset comprised of human PDAC samples. SAMD3 mRNA expression was further evaluated in a tumor-specific OT-I/ovalbumin (OVA) mouse model. SAMD3 levels and their clinical significance were evaluated via immunohistochemistry (IHC) analysis.ResultsSAMD3 was highly expressed in cytotoxic CD8+ T cells, with expression significantly downregulated during T cell exhaustion. SAMD3 levels were positively correlated with CD8+ T cell function. In PDAC patients, high SAMD3 levels in T cells were associated with improved overall survival (OS), disease-free survival (DFS), and T cell infiltration. A patient exhibiting partial response to combination immunotherapy also showed high SAMD3 levels in T cells.ConclusionSAMD3 is a biomarker of T cell function, with elevated expression in T cells predicting improved survival. These findings highlight the potential of precision immunotherapy approaches for treating PDAC.

Toona sinensis fruit polyphenols alleviate cerebral ischemia-reperfusion injury in rats by inhibiting MAPK signaling pathways and NLRP3 inflammasome/pyroptosis.

Toona sinensis fruit polyphenols (TSFP) are polyphenols that have been separated and extracted from mature Toona sinensis fruits. TSFP anti-inflammatory and neuroprotective properties have demonstrated promise. However, the underlying mechanisms require more elucidation. The aim of this study is to investigate the mechanisms by which TSFP alleviates cerebral ischemia-reperfusion injury (CIRI) through the mitogen-activated protein kinase (MAPK) and NOD-,LRR- and pyrin domain-containing protein 3 (NLRP3) inflammasome pathways on middle cerebral artery occlusion/reperfusion (MCAO/R) rats. The TSFP neuroprotective effect was evaluated using transmission electron microscope (TEM), 2,3,5-triphenyltetrazolium chloride (TTC), neurological function, and hematoxylin-eosin (H&E) staining. An enzyme-linked immunosorbent assay (ELISA) and immunofluorescence were used to measure the TSFP influence on inflammation. In addition, a Western blot assay was performed to assess the NLRP3 inflammasome and MAPK pathway proteins expressions in the prefrontal cortex (PFC) and hippocampus, and double immunofluorescence methods were used to identify gasdermin D (GSDMD) secretion in neurons. The TSFP group in the MCAO/R model had improved levels of cerebral infarction and brain pathological damage. The TEM demonstrated that TSFP ameliorated ischemia-induced neuronal pyroptosis, and there was a significant decrease in the expressions of NLRP3, the apoptosis-associated speck-like protein containing Caspase recruitment domain (ASC), cysteine aspartate-specific protease-1 (caspase-1), and GSDMD in the TSFP groups. TSFP reduced the phosphorylation of p38 mitogen-activated protein kinase (p38) and extracellular signal-regulated kinase 1/2 (ERK1/2), promoted the phosphorylation of extracellular signal-regulated kinase 5 (ERK5), and reduced the phosphorylation of c-Jun amino terminal kinase (JNK) in the hippocampus. The results also revealed that TSFP significantly lowered the interleukin-1β (IL-1β) and interleukin-1β (IL-18) expressions and attenuated glial cell activation caused by ischemia in the PFC and hippocampus DG areas. This study provided evidence for the efficacy of TSFP in the treatment of CIRI, with potential mechanisms that involved the control of the MAPK signaling pathways and NLRP3 inflammasome/pyroptosis, which highlights the potential benefits of TSFP in the treatment of CIRI.

ATAD2 is a potential immunotherapy target for patients with small cell lung cancer harboring HLA-A∗0201.

Small cell lung cancer (SCLC) represents a highly aggressive neuroendocrine tumour with a dismal prognosis. Currently, the identification of a specific tumour antigen that can facilitate immune-based therapies for SCLC remains elusive. We employed liquid chromatography-tandem mass spectrometry (LC-MS/MS) to analyse cancer/testis antigens (CTAs) in SCLC cell lines and human tumour specimens. Immunohistochemistry of clinical specimens was performed to compare protein expression in SCLC, non-small cell lung cancer (NSCLC), and matched normal-adjacent tissues. Additionally, publicly available RNA sequencing databases were interrogated to identify gene expression patterns in different SCLC subtypes and in different disease stages. Distinct numbers and types of CTAs were identified across SCLC subtypes, with significantly higher expression levels of ATPase family AAA domain-containing protein 2 (ATAD2) observed in SCLC compared to normal adjacent tissues and NSCLC tissues. A dynamic expression pattern of ATAD2 was found throughout the clinical course of SCLC and exhibited a positive correlation with achaete-scute family bHLH transcription factor 1 (ASCL1) expression in SCLC. Immunopeptidomics analysis identified the YSDDDVPSV sequence derived from the HLA-A∗02:01 restriction epitope of ATAD2 as a highly promising tumour antigen candidate for potential immunotherapy applications. YSDDDVPSV immunopeptides were confirmed to be present in SCLC-A and SCLC-N with HLA-A∗02:01 restriction. Notably, HLA-A∗02:01T cells exhibited a robust response upon stimulation with YSDDDVPSV immunopeptide pulsed by T2 cells. Our findings highlight the potential of targeting the ATAD2 YSDDDVPSV immunopeptide for SCLC immunotherapy, thereby offering a promising avenue for the development of adoptive T cell therapies to effectively treat ASCL1-positive or NEUROD1-positive SCLC carrying HLA-A∗02:01. This study was supported by the National key R&D program of China (2022YFC2505000); National Natural Science Foundation of China (NSFC) general program (82272796) NSFC special program (82241229); CAMS Innovation Fund for Medical Sciences (CIFMS 2022-I2M-1-009); CAMS Key Laboratory of Translational Research on Lung Cancer (2018PT31035); Aiyou foundation (KY201701). National key R&D program of China (2022YFC2505004). NSFC general program (81972905). Medical Oncology Key Foundation of Cancer Hospital Chinese Academy of Medical Sciences (CICAMS-MOCP2022012).

The Anti-inflammatory Potential of Tricyclic Antidepressants (TCAs): A Novel Therapeutic Approach to Atherosclerosis Pathophysiology

Atherosclerosis, a chronic inflammatory disease, is driven by complex molecular mechanisms involving inflammatory cytokines and immune pathways. According to recent research, tricyclic antidepressants (TCAs), which are typically prescribed to treat depressive disorders, have strong anti-inflammatory effects. TCAs, including imipramine and amitriptyline, alter inflammatory signaling cascades, which include lowering the levels pro-inflammatory cytokines like TNF-α, IL-1β, and IL-6 and inhibiting NF-κB activation. By inhibiting the NLRP3 inflammasome and suppressing pathways including JAK/STAT, MAPK, and PI3K, these effects are produced, improving endothelial function and reducing oxidative stress. The intricacy of TCAs’ anti-inflammatory actions has demonstrated by the existence of contradictory findings about how they alter IL-6 levels. The dependence of the heterogeneity of the reaction on the use of particular TCAs and experimental settings is shown by the fact that some studies show reduced IL-6 production, while others indicate increases or no changes. This review explores the multifaceted mechanisms through which TCAs modulate inflammatory pathways. TCAs inhibit NF-κB activation, reduce oxidative stress, and suppress the production of key inflammatory mediators, including IL-6 and TNF-α. They also regulate Toll-like receptor (TLR) signaling and NOD-, LRR-, and NLR family pyrin domain-containing protein 3 (NLRP3) inflammasome activation, reducing the release of IL-1β and IL-18, critical drivers of endothelial dysfunction and plaque instability. Given their capacity to target critical inflammatory molecules and pathways, TCAs provide great potential in the therapy of atherosclerosis, particularly for individuals with associated depression and cardiovascular risk factors. Nevertheless, further research is essential to clarify the precise molecular mechanisms, resolve inconsistencies in current findings, and establish the clinical applicability of TCAs as anti-inflammatory agents in atherosclerosis management.

Discovery of a sushi domain-containing protein 2-positive phenotype in circulating tumor cells of metastatic breast cancer patients

Cell lines derived from circulating tumor cells (CTCs) in the blood provide important biological information on cancer metastasis. CTC-ITB-01 is a CTC cell line derived from a patient with metastatic estrogen receptor-alpha (ER-alpha) positive breast cancer two months before the death of the patient. After a LC-MC/MS based proteomics analysis of CTC-ITB-01, we found extraordinary high levels of the poorly characterized protein SUSD2 (sushi domain-containing protein 2) in CTC-ITB-01. Expression of SUSD2 on subsets of CTCs was validated on clinical blood samples of patients with metastatic breast cancer. SUSD2-positive CTCs could be captured specifically by a MACS-based approach. We overexpressed SUSD2 in the poorly-metastatic cell line MCF-7. This resulted in upregulation of ER-alpha, the tumor progression protein GRP78 (78-kDa glucose-regulated protein) and downregulation of the tumor suppressor protein PDCD4 (programmed cell death protein 4). We observed downregulation of SUSD2 and PDCD4 after hypoxia and simulation of re-oxygenation in the blood in MCF-7 and MDA-MB-468, while in CTC-ITB-01 SUSD2 levels remained unchanged, and only PDCD4 was downregulated under hypoxia. In conclusion, we show, for the first time, that SUSD2 is expressed in CTCs and appears to affect key proteins in tumor progression and survival.