DNeasy Tissue Research Articles

PF-3 Is nigerian breast cancer associated with endogenous retrovirus Xq21.33?

Background: Wildschutte et al recently discovered a new HERV K HML-2 (HK2) endogenous retrovirus Xq21.33 (NCBI GenBank accession no. KU054272) to be uncommonly present in Pygmy populations and in Nigerian people in Africa (<4%). It has been estimated that this virus has been inserted in the human genome between ∼0.67–1.3 Mya and possibly earlier. Since this virus is fully intact and is similar to mouse mammary tumor virus, we looked to see if it is associated with breast cancer in Nigerian populations. Methods: Peripheral blood mononuclear cells were obtained with informed consent from Nigerian women with breast cancer (BCa) (237) and matched controls (225) without BCa. Samples from the United States included samples from a BCa study and HIV study carried out earlier. DNA was extracted using the DNeasy Blood and Tissue Kit (Qiagen). Samples were tested for the Xq21.33 virus using primer Xq21.33R2 ACGCTGTTTTGTCCCTTTGA and K1011 CGTCGACTTGTCCTCAATGACCACGCT to screen samples, and primers 1584R TTTGCGTTGACTGAGCCATTACCG, 2499R TTG AGC AAC ATC TTG GAG CCT TGC, 3460R ACTTGCCCAATATGCAGCCTTTCCTCC, 6115R TCAACTATGGCCTGTCCTTGC, F Flank TCAGTCTGAAGACAATGACATACT T and 5359F TCGGCTCAAAGAGCAGAGATGGTT to confirm positive samples. Samples were tested using the Long Amp PCR kit (New England Bio Labs) conditions suggested by the manufacturer using a total volume of 25ul. Hetero vs Homozygosity was determined using F Flank and Xq21.33R2 with Platinum taq Hi Fi Thermo Fisher also using conditions suggested by the manufacturer. Samples with adequate DNA were tested using primer K1011 and Xq21.1R2. Positive samples were all confirmed using Xq21.33R2 to 1584R, 2499R, 3460R and 5359F to F Flank. One batch of samples did not yield good quality DNA and some samples had such low yields of DNA that the data on these patients was not included in this study. Results: We detected 28/220 (12.7%) positive samples in women with BCa vs 23/236 (9.7%) in women without BCa. These differences were not statistically significantly different. 5/28 women with BCa (ages 38, 44, 50, 53, 82) vs 2/23 (ages 32, 58) normal women were homozygous for Xq21.33. As shown below women with BCa and virus were more likely to be post-menopausal (46%) than women without BCa and virus (8.7%). Similarly women with BCa and no virus were also more likely to be post-menopausal 35% vs women with no BCa and no virus 19.7%. There was not enough power in this study to determine if the virus is contributing to more cases of post-menopausal breast cancer in positive women. Among women who are older than 47 years, the proportion of virus xq21.33 positives is higher among women with BCa (14.9%) than women without BCa (5.13%), but it is not significant (P-value = 0.15) [see below] Virus xq21.33 in cases and controls in age groups >47 years n = 126. Among women who are 47 years or younger, the proportion of virus xq21.33 is lower among women with BCa (10.07%) than women without BCa (12.21%), but it is not significant (P-value = 0.60). Virus xq21.33 in cases and controls in age groups <47 years n = 321. We also tested for Xq21.33 in the following USA samples: Conclusions: Our sample size does not provide sufficient power to see if Xq21.33 presents an increased risk for breast cancer. However, the trend too increased risk in virus positive women 12.7% vs 9.7% in controls, and the increase in numbers of women >47 year with +BCa +virus (46.4%) vs the +BCa −virus (35.6%), and the striking low numbers of women in −BCa +virus (8.7%) vs (19.7%) in −BCa −virus and greater homozygosity in +Bca +virus women suggests differences which may be caused by carrying this provirus. We suggest designing trials with adequate sample sizes of virus+ and − young women without BCa to assess the future risk of cancer from this provirus. We are now sequencing the env gene to see if women with BCa have a more replicative competent virus. We are gathering pathological data to see if +women have different forms of BCa than –women. This virus may be still present in Nigerian rodent and primate populations and should be searched for in these animals. It may still infect people contributing to BCa without becoming endogenized. It could be detected by deep sequencing DNA from BCa tissue looking for integrated Xq21,33 in other sites than the X chromosome. Molecular clones and more cell lines, like DT22, should be established from BCa+ Virus+ to look for replicative virus with alternative integration sites. Virus should be searched for in HIV+ Nigerians to see if it contributes to other neoplasms. The discovery of a human BCa virus would present a new way of treating or preventing breast cancer using antiretrovirals.

Effective detection of environmental DNA from the invasive American bullfrog

The American bullfrog (Rana catesbeiana) is one of the most damaging invasive species worldwide. Recently developed environmental DNA (eDNA)-based methods have proven to be promising tools to detect aquatic invasive species at low abundance. To develop an eDNA-based assay for bullfrog monitoring, we designed a primer and probe set that targeted the bullfrog DNA and compared its species specificity in in silico PCR and in vitro quantitative PCR. We demonstrated that our primers successfully amplified the bullfrog DNA, but not DNA of native anuran species in the Beijing area, in silico and in vitro. Additionally, in silico PCR identified only a small number of potentially amplifiable species occurring in North America. In contrast, a previously reported primer pair that specifically targeted the bullfrog in France amplified the DNA of a wide range of teleost fish and amphibians in silico and a common native species in vitro. We also compared three commonly used eDNA extraction methods—the phenol–chloroform–isoamyl alcohol (PCI) method, cetyltrimethylammonium bromide (CTAB)-based extraction, and Qiagen’s DNeasy blood and tissue kit—for their efficiency in recovering bullfrog eDNA from laboratory aquariums. The CTAB method showed a significantly higher extraction efficacy than the PCI method or the DNeasy kit and considerably outperformed the other methods in terms of time efficiency and costs. Our study provides a useful primer set and extraction protocol for eDNA-based active surveillance of bullfrog invasions over a potentially wide geographical range, which has important implications for the management of this invasive species.

The Quality of DNA Isolated from Processed Food and Feed via Different Extraction Procedures.

The extraction of DNA is a critical step for species identification by PCR analysis in processed food and feed products. In this study, eight DNA extraction procedures were compared—DNeasy Blood and Tissue Kit, DNeasy mericon Food Kit, chemagic DNA Tissue 10 Kit, Food DNA Isolation Kit, UltraPrep Genomic DNA Food Mini Prep Kit, High Pure PCR Template Preparation Kit, phenol—chloroform extraction, and NucleoSpin Food—Using self-prepared samples from both raw and heat-processed and/or mechanically treated muscles and different types of meat products and pet food (pork, beef, and chicken). The yield, purity, and suitability of DNA for PCR amplification was evaluated. Additionally, comparisons between the effectiveness of various extraction methods were made with regard to price, and labor- and time-intensiveness. It was found that the DNeasy mericon Food Kit was the optimal choice for the extraction of DNA from raw muscle, heat-treated muscle, and homemade meat products from multiple and single species.

COMPARATIVE EVALUATION OF FIVE DIFFERENT METHODS FOR DNA EXTRACTION FROM SEMEN OF BUFFALO BULL

Success of PCR based molecular method is highly dependent on quality extraction of DNA template. There are many methods currently available for DNA purification from semen; but, problems related to contamination with foreign DNA, PCR inhibitors, and susceptibility to fragmentation are very common. In the present study, five different DNA extraction procedures were examined to ascertain their relative effectiveness for extracting DNA from semen samples of buffalo bull. The five methods included- two commercially supplied kits (Qiagen DNeasy Blood and Tissue Kit, Purelink Invitrogen), modified Qiagen DNeasy Blood and Tissue Kit method, Chelex 100 method and Phenol-chloroform with modified lysis buffer method. The quality and quantity assessment of the differentially extracted DNA revealed significant differences among the five procedures. Modified Qiagen DNeasy Blood and Tissue Kit method was found to be most appropriate for extracting high quality and suitable quantity of DNA from semen of buffalo bull.

Species-level biodiversity assessment using marine environmental DNA metabarcoding requires protocol optimization and standardization.

DNA extraction from environmental samples (environmental DNA; eDNA) for metabarcoding‐based biodiversity studies is gaining popularity as a noninvasive, time‐efficient, and cost‐effective monitoring tool. The potential benefits are promising for marine conservation, as the marine biome is frequently under‐surveyed due to its inaccessibility and the consequent high costs involved. With increasing numbers of eDNA‐related publications have come a wide array of capture and extraction methods. Without visual species confirmation, inconsistent use of laboratory protocols hinders comparability between studies because the efficiency of target DNA isolation may vary. We determined an optimal protocol (capture and extraction) for marine eDNA research based on total DNA yield measurements by comparing commonly employed methods of seawater filtering and DNA isolation. We compared metabarcoding results of both targeted (small taxonomic group with species‐level assignment) and universal (broad taxonomic group with genus/family‐level assignment) approaches obtained from replicates treated with the optimal and a low‐performance capture and extraction protocol to determine the impact of protocol choice and DNA yield on biodiversity detection. Filtration through cellulose‐nitrate membranes and extraction with Qiagen's DNeasy Blood & Tissue Kit outperformed other combinations of capture and extraction methods, showing a ninefold improvement in DNA yield over the poorest performing methods. Use of optimized protocols resulted in a significant increase in OTU and species richness for targeted metabarcoding assays. However, changing protocols made little difference to the OTU and taxon richness obtained using universal metabarcoding assays. Our results demonstrate an increased risk of false‐negative species detection for targeted eDNA approaches when protocols with poor DNA isolation efficacy are employed. Appropriate optimization is therefore essential for eDNA monitoring to remain a powerful, efficient, and relatively cheap method for biodiversity assessments. For seawater, we advocate filtration through cellulose‐nitrate membranes and extraction with Qiagen's DNeasy Blood & Tissue Kit or phenol‐chloroform‐isoamyl for successful implementation of eDNA multi‐marker metabarcoding surveys.

Evaluation of two independent protocols for the extraction of DNA and RNA from different tissues of sea cucumber Isostichopus badionotus

Isostichopus badionotus is a sea cucumber species of great ecological and economic relevance for Mexico and Central American and Caribbean countries; however, the protocols for the extraction of the nucleic acids have not yet been published. In this study, we describe the first protocols to obtain DNA and RNA from different tissues of I. badionotus, which include the respiratory tree, gonad, longitudinal muscle bands, anterior intestine and cloaca. The extraction of high-quality DNA was performed using the DNeasy Blood & Tissue kit (Qiagen, Valencia, CA, USA) with minor modifications in different points of the protocol.Concerning the RNA, the method of TRIzol was used. This method is particularly advantageous in situations where cells or tissues are enriched for endogenous RNases or when the separation of cytoplasmic RNA from nuclear RNA is impractical. The methodologies used in this study allowed us to obtain DNA and RNA of high quality and integrity in the different tissues of I. badionotus, which will be the basis for future genomic and transcriptomic studies.•The successful extraction of DNA and RNA was achieved in the different tissues of I. badionotus.•The concentrations of DNA and RNA obtained were adequate for a diversity of analyses at a molecular level.

PO-185 Lifestyle intervention modify DNA methylation of adipose tissue in overweight and obese men with insomnia symptoms

Objective To study whether diet and exercise intervention affect sleep and obesity-related genes’ DNA methylation in overweight and obese men with insomnia symptoms
 Methods The study participants were a subgroup of a large intervention and consisted of 10 overweight or obesity men aged 34-65 years with insomnia symptoms. They participated in a 6-month progressive aerobic exercise training and individualized dietary consoling program and were randomly selected from diet (n=4), exercise (n=3) and control (n=3) groups. Body composition included fat mass and lean mass in the whole body and abdominal android region were assessed by dual-energy X-ray densitometry. The fitness level (VO2max) was determined by 2-km walk test using a standard protocol. Blood samples from venous were taken at fasted state in the morning. Total cholesterol, high density lipid cholesterol, low density lipid cholesterol, triglycerides, glucose, insulin, non-esterified fatty acid, alanine aminotransferase, aspartate aminotransferase and γ-glutamyltransferase were assessed by conventional methods. Subcutaneous adipose tissue was taken from abdominal region before and after the intervention. DNA was extracted from subcutaneous adipose tissue using a QIAamp DNeasy Tissue Kit. Whole genome-wide DNA methylation was obtained using MethylRAD-Seq. MethylRAD library preparation started from DNA digestion by FspEI, then digested products were run on agarose gel to verify digestion and DNA ligase was added to the digestion solution. After ligation products amplication, PCR was conducted by MyCycler thermal cycler (Bio-Rad). The target fragment was excised from polyacrylamide gel and DNA was diffused from the gel in nuclease-free water. For relative quantification of MethylRAD data, DNA methylation levels were determined using the normalized read depth (reads per million, RPM) for each site. For each restriction site, its methylation level was estimated by dividing the log-transformed depth of each site by the log-transformed maximum depth (representing 100% methylation; i.e. M-index ¼ log(depth site)/ log(depth max)), where depth max was summarized from the top 2% of sites (approx. 500 for the standard library) with the highest sequencing coverage. Heat map images are generated with Matlab 7.0 software and pathways are analysed by WEB-based Gene SeT AnaLysis Toolket. A statistical significance for methylated CpGs and pathways were set to p=0.001 and p=0.05, respectively.
 Results No significant group differences by time were found in sleep-related variables, body composition, lifestyle factors nor with measured lipid and glucose biomarkers. However, whole genome-wide DNA methylation was decreased after dietary intervention, but was increased after exercise intervention, respectively. Correspondingly, 1253 and 708 differentially methylated loci were found in diet and exercise groups by contrast to the control group. Among them, the overlap genes between diet and exercise had multiple differentially methylated CpGs, including e.g. MYT1L (4 CpGs), CAMTA1 (3 CpGs), NRXN1 (3 CpGs), RPS6KA2 (3 CpGs), SEMA4D (3 CpGs). DNA methylation in PCDH8 was negatively correlated with wake after sleep onset after exercise intervention and MYRIP associated with sleep duration showed lower methylation after the dietary intervention. Further, 13 (DIO1, GCK, GYS1,
 LMNA, LY86, PNMT, PPARA, PPARD, SERPINE1, TH, TMEM18, TNFRSF1B and UBL5) and 2 (SDCCAG8 and TNF) obesity-related genes’ DNA methylation profile changed in response to diet and exercise, respectively. Percentage changes of CpGs within KLHDC8A, ANKS1A, FGFRL1 and KDM3B were correlated with energy yield fat and carbohydrate, HOMA-IR and VO2max, respectively.
 Conclusions We found that both exercise and dietary interventions have impacts on these genes related to sleep indicating by DNA methylation in PCDH8 and MYRIP, respectively. Further diet may be more effective than aerobic exercise intervention since greater number of modified obesity-related genes observed after dietary intervention. Our results indicate that reduce insomnia symptoms may need to more focus on control obesity.

Genome sequencing and conservation genomics in the Scandinavian wolverine population.

Genetic approaches have proved valuable to the study and conservation of endangered populations, especially for monitoring programs, and there is potential for further developments in this direction by extending analyses to the genomic level. We assembled the genome of the wolverine (Gulo gulo), a mustelid that in Scandinavia has recently recovered from a significant population decline, and obtained a 2.42Gb draft sequence representing >85% of the genome and including >21,000protein-coding genes. We then performed whole-genome resequencing of 10Scandinavian wolverines for population genomic and demographic analyses. Genetic diversity was among the lowest detected in a red-listed population (mean genome-wide nucleotide diversity of 0.05%). Results of the demographic analyses indicated a long-term decline of the effective population size (Ne ) from 10,000well before the last glaciation to <500 after this period. Current Ne appeared even lower. The genome-wide FIS level was 0.089 (possibly signaling inbreeding), but this effect was not observed when analyzing a set of highly variable SNP markers, illustrating that such markers can give a biased picture of the overall character of genetic diversity. We found significant population structure, which has implications for population connectivity and conservation. We used an integrated microfluidic circuit chip technology to develop an SNP-array consisting of 96 highly informative markers that, together with a multiplex pre-amplification step, was successfully applied to low-quality DNA from scat samples. Our findings will inform management, conservation, and genetic monitoring of wolverines and serve as a genomic roadmap that can be applied to other endangered species. The approach used here can be generally utilized in other systems, but we acknowledge the trade-off between investing in genomic resources and direct conservation actions.

First Report of 'Candidatus Phytoplasma asteris' Associated with Witches' Brooms on Sharp-Flowered Rush (Juncus acutiflorus) in Poland.

Juncus acutiflorus L. (Juncaceae) is a species of rush widespread in Europe, North Africa, and Southwest Asia. The health of sharp-flowered rush is threatened by witches’ brooms occurrence. Typical symptoms are dense masses of shoots, usually growing from a single point, with the resulting structure resembling a broom. Witches’ brooms are typically formed in response to Livia junci (Liviinae, Hemiptera) feeding, oligofag, which typically feeds on Juncus sp. These symptoms are similar to those observed in Juncus articulatus L. (Juncaceae) related to phytoplasma infection in Silesia, Poland (Jarzembowski et al. 2015). In August 2017, samples were collected from nine symptomatic and four asymptomatic plants growing in Jagniątkow, Poland. DNA from 100 mg of inflorescence and leaf samples was extracted using a DNeasy Plant Mini Kit (Qiagen, Syngen Biotech, Wroclaw, Poland) according to the manufacturer’s protocol. Additionally, 10 L. junci specimens (adult and the last larva stage) were collected from symptomatic plants and preserved in ethanol (75%). DNA from the insects (treated as one sample) was extracted using a DNeasy Blood and Tissue Kit (Qiagen, Syngen Biotech). The extracts were used as the template in polymerase chain reaction (PCR) assays with the universal phytoplasma primers P1/P7 followed by R16F2/R16R2 (Lee et al. 1998). Additionally, primers rp1/rp2 followed by rp3/rp4, allowing amplification of fragments of rpl22 and rps3 genes (Nakamura et al. 1996), and primers AYsecYF1/AYsec for amplification of secY gene were applied. Water blank samples were included as negative controls. PCR products of expected size for each primer set were amplified from the insects and six symptomatic plants that were assayed. No amplification was observed in symptomless J. acutiflorus samples or in water blanks. Amplicons representing three genetic loci were sequenced at Genomed S.A., Warsaw, Poland. DNA samples were sequenced at least twice in both directions. Sequencing results of the PCR products confirmed that six symptomatic plants and the insects were infected by a phytoplasma. The obtained sequences were nearly identical, and representative sequences of 16S rDNA fragments (accession nos. MG976242 to MG976246), secY gene (MG983765 to MG983769), and ribosomal protein gene (MG983760 to MG983764) from four plants and one insect sample were deposited in GenBank. Determination of the phytoplasma classification group was based on the nucleotide sequence of the F2n/R2 PCR fragment within the 16S gene. Using iPhyClassifier, the online tool for phytoplasma classification (https://plantpathology.ba.ars.usda.gov/cgi-bin/resource/iphyclassifier_legacy.cgi), the sequence of J. acutiflorus phytoplasma shared 99.9% identity with that of the ‘Candidatus Phytoplasma asteris’ reference strain (GenBank accession no. M30790). BLAST analysis performed for ribosomal proteins and secY genes confirmed the highest identity (99%) of analyzed sequences with those of ‘Ca. P. asteris’ (CP015149 and KJ394491, respectively). To our knowledge, this is the first report of a phytoplasma of group 16SrI affecting J. acutiflorus in Poland and in the world. The impact of the detected phytoplasma in the regional ecosystem is being assessed. It is highly probable that L. junci is a possible vector for ‘Ca. P. asteris’.

Evaluation of DNA Extraction Methods from Waterlogged Bones: A Pilot Study.

When deaths occur in water, soft tissue decomposes after a temperature-dependent period, making DNA identification dependent on bone. This study examined the effects of water on bone DNA purity and quantity, and determined the best of three extraction methods for isolating DNA. The organic phenol-chloroform method consistently extracted DNA approximating the accepted 260/280 purity value (~1.8); ChargeSwitch® gDNA Plant Kit and DNeasy Blood and Tissue Kit produced fair and unacceptable values, respectively. The purity value for humerus and rib samples was consistent across accumulated degree days (ADD). Significant differences in quantification among extraction methods and between bone types were identified. Ribs and ChargeSwitch® gDNA Plant Kit samples produced the lowest mean Ct values of the bone types and the extraction methods, respectively. Therefore, this study proposes that magnetic bead technology extraction methods and ribs be considered when processing bones that have been submerged in water for any length of time.

Standardization of a multiplex real-time PCR test for the identification of Angiostrongylus cantonensis, A. costaricensis and A. vasorum

Angiostrongyliasis is a disease caused by Angiostrongylus nematodes that is present worldwide. The infections with the highest impact on human and animal health are caused by A. cantonensis, A. costaricensis, and A. vasorum. Clinical forms of the disease in humans are eosinophilic meningitis and abdominal angiostrongyliasis, while the most common effect on dogs are cardiopulmonary damages. It is deemed as an emerging disease as the result of the global dissemination of the African snail Lissachatina fulica, an intermediary host of these parasites. The few diagnostic methods for Angiostrongylus spp. are unspecific, costly, and not very sensitive. It is urgent to develop a sensitive, specific and accessible diagnostic tool for the control of human and animal angiostrongyliasis. To develop a qPCR multiple test to identify the three pathogenic species of Angiostrongylus. Through a bio-informatic analysis, we selected a sequence of the ITS-2 region of the Angiostrongylus genome to guarantee the specificity of primers and probes. We extracted DNA from adult parasites as positive control, and from larvae using the DNeasy Blood&Tissue® kit. Quantitative PCR reactions were conducted on a Smartcycler Cepheid® thermocycler using a master mix QuantiTect® kit. DNA from human beings, other parasites and the African snail was used as negative control. The threshold cycle values for positive DNA controls were: 21 for Angiostrongylus cantonensis, 22 for A. costaricensis, and 31 for A. vasorum. In negative controls, the threshold cycle was zero. qPCR showed an amplification efficiency of 2 (100%). A multiple qPCR was standardized at the laboratory for three clinically significant species of Angiostrongylus.

Methods for the extraction, storage, amplification and sequencing of DNA from environmental samples

Advances in the sequencing of DNA extracted from media such as soil and water offer huge opportunities for biodiversity monitoring and assessment, particularly where the collection or identification of whole organisms is impractical. However, there are myriad methods for the extraction, storage, amplification and sequencing of DNA from environmental samples. To help overcome potential biases that may impede the effective comparison of biodiversity data collected by different researchers, we propose a standardised set of procedures for use on different taxa and sample media, largely based on recent trends in their use. Our recommendations describe important steps for sample pre-processing and include the use of (a) Qiagen DNeasy PowerSoil ® and PowerMax ® kits for extraction of DNA from soil, sediment, faeces and leaf litter; (b) DNeasy PowerSoil ® for extraction of DNA from plant tissue; (c) DNeasy Blood and Tissue kits for extraction of DNA from animal tissue; (d) DNeasy Blood and Tissue kits for extraction of DNA from macroorganisms in water and ice; and (e) DNeasy PowerWater ® kits for extraction of DNA from microorganisms in water and ice. Based on key parameters, including the specificity and inclusivity of the primers for the target sequence, we recommend the use of the following primer pairs to amplify DNA for analysis by Illumina MiSeq DNA sequencing: (a) 515f and 806RB to target bacterial 16S rRNA genes (including regions V3 and V4); (b) #3 and #5RC to target eukaryote 18S rRNA genes (including regions V7 and V8); (c) #3 and #5RC are also recommended for the routine analysis of protist community DNA; (d) ITS6F and ITS7R to target the chromistan ITS1 internal transcribed spacer region; (e) S2F and S3R to target the ITS2 internal transcribed spacer in terrestrial plants; (f) fITS7 or gITS7, and ITS4 to target the fungal ITS2 region; (g) NS31 and AML2 to target glomeromycota 18S rRNA genes; and (h) mICOIintF and jgHCO2198 to target cytochrome c oxidase subunit I (COI) genes in animals. More research is currently required to confirm primers suitable for the selective amplification of DNA from specific vertebrate taxa such as fish. Combined, these recommendations represent a framework for efficient, comprehensive and robust DNA-based investigations of biodiversity, applicable to most taxa and ecosystems. The adoption of standardised protocols for biodiversity assessment and monitoring using DNA extracted from environmental samples will enable more informative comparisons among datasets, generating significant benefits for ecological science and biosecurity applications.

First Report of Stem Rot on Potato Caused by Dickeya chrysanthemi in Minnesota

Bacterial soft rot and black leg diseases of potato occur sporadically in the Upper Midwestern United States. Multiple members of the soft rot Enterobacteriaceae (SRE) cause diseases in potato. The taxonomy of SREs has undergone extensive revision, resulting in the establishment of new genera and species to better reflect the phylogeny and diversity of strains formerly classified as Erwinia carotovora or E. chrysanthemi (Marrero et al. 2013). One such species, Dickeya dianthicola, has been associated with recent severe black leg outbreaks in the eastern United States. To identify the SREs in the Upper Midwest, a 2016 survey of commercial and seed potato fields in Minnesota and North Dakota was conducted. SREs (123) were isolated from 78 tissue samples exhibiting symptoms of black leg, stem rot, and soft rot. Small tissue samples from the margin of symptomatic and healthy tissues were suspended in 0.02 M potassium phosphate buffer, pH 7.2, for 30 min. Cell suspensions were serially diluted and spread onto crystal violet pectate (CVP) agar. Bacterial colonies producing pitting on CVP were subsequently reisolated on CVP and purified on nutrient broth yeast extract medium. Three isolates from one sample were obtained from a stem sample collected in Sherburne County, Minnesota. One isolate, SR64, was retained for phenotypic characterization and genetic identification. Symptoms associated with SR64 included dry, black-brown necrotic stem lesions with cracking and exposed vasculature. SR64 was determined to be gram negative based on reaction in 3% KOH. Growth on King’s B agar medium failed to produce fluorescence characteristic of Pseudomonas. SR64 also exhibited facultative anaerobic respiration in Hugh-Leifson medium and the ability to grow at 37°C on nutrient agar. Reinoculation of potato tuber slices with SR64 and incubation at 25°C for 2 days produced tissue maceration and dark ooze typical of SRE. DNA extracted from a pure culture of SR64 using DNeasy blood and tissue kits (Qiagen, Valencia, CA, U.S.A.) was used as template for genetic analysis. PCR was conducted using two primer sets: ADE1/ADE2 (Nassar et al. 1996) and Df/Dr (Laurila et al. 2010). SR64 template DNA produced 420 and 119 bp amplicons via ADE1/ADE2 and Df/Dr primers, respectively, as expected for Dickeya. The 16S rDNA was amplified using primer set F27/R1492 (Monciardini et al. 2002), and the ∼1.2 kb amplicon was sequenced and submitted for GenBank nucleotide BLAST analysis. SR64 shared 98% identity with that of the 16S rDNA sequence of type strain Dickeya chrysanthemi LMG 2804 (NZ_CM001974) (Samson et al. 2005). To confirm the species identification, additional housekeeping genes, dnaJ (DCH402_RS02710), dnaX (DCH402_RS15110), and gyrB (DCH402_RS00180) were amplified using primer sets reported by Marrero et al. (2013). Housekeeping gene sequences were concatenated creating a 1,955 bp fragment for analysis with CLC Main Workbench software (Qiagen). The pairwise percent identity between the concatenated sequences of SR64 and D. chrysanthemi LMG 2804ᵀ, D. zeae LMG 2505ᵀ, D. dianthicola LMG 2485ᵀ, D. dadantii subsp. dadantii LMG 25991ᵀ, and D. solani LMG 25993ᵀ was 99.13, 89.42, 90.85, 89.88, and 85.89%, respectively. The low incidence of Dickeya observed in this survey could be owing to limitations of the protocols used to isolate SREs. Alternatively, it could indicate that Dickeya is not currently prevalent in the region. This is the first report of D. chrysanthemi on potato in Minnesota.

Evaluation of alternative DNA extraction protocols for the species determination in turkey salami authentication tests

ABSTRACTFighting food industry standard violations has become an important stake especially in developing countries. In this work, different common DNA extraction protocols, namely NaOH, Phenol Chloroform Isoamyl alcohol, CTAB, Chloroform and the commercialized DNeasy blood and tissue kit were tested and compared for turkey salami genomic authentication in mitochondrial genes species detection by Polymerase Chain Reaction (PCR). The obtained results proved that a protocol based on NaOH after an advanced grinding step was the most adequate alternative in terms of simplicity, rapidity and detection threshold even in swabs. The selected protocol encourages wide range cost-effective routine authentications.

Comparative evaluation of DNA extraction methods for amplification by qPCR of superficial vs intracellular DNA from Bacillus spores

This study was designed to assess the efficiency of eight extraction methods regarding their ability to release superficial (exogenous) and intracellular (endogenous) DNA from B. cereus spores for subsequent analysis by quantitative PCR (qPCR). B. cereus spore suspensions were subjected to both commercial DNA extraction kits and mechanical DNA extraction methods. The spores were observed by transmission electron microscopy to evaluate any damage caused during extraction. The efficiency of both extraction and purification were assessed using a qPCR assay targeting the bclA gene. Most of the extraction methods assessed, except the passage through the French press or the use of the QIAamp DNA Blood Mini kit without 95°C treatment, allowed the amplification of significant amounts of DNA. By using propidium monoazide, which is a photoreactive DNA-binding dye, the presence of non-negligible amounts of amplifiable DNA at the spore surface was highlighted. A further set of extraction assays was then performed on spores previously treated with PMA. The results of this study show that both superficial and intracellular spore DNA can be released by extraction methods to a greater or lesser extent and then further amplified by qPCR. The Precellys extraction allowed the detection of both intracellular and superficial DNA, the DNeasy Blood & Tissue kit the specific detection of intracellular DNA, while the Instagene kit detected only superficial DNA. Of the methods tested in this study, the Precellys extraction was the most efficient in terms of further DNA detection. Significance and impact of the studyIn order to verify the presence or absence of B. cereus spores in food or on surfaces in the food environment, the use of an efficient extraction method is required, followed by a qPCR analysis on the DNA released. Conversely, in order to quantify the population of Bacillus spores, any superficial DNA must be blocked, e.g. with PMA, prior to intracellular DNA extraction and further amplification.

Evaluation of Filtration and DNA Extraction Methods for Environmental DNA Biodiversity Assessments across Multiple Trophic Levels

Metabarcoding of marine environmental DNA (eDNA), the DNA suspended in seawater originating from tissue, cells, or extracellular DNA, offers the opportunity to survey the biological composition of communities across multiple trophic levels from a non-invasive seawater sample. Here we compare results of eDNA metabarcoding of multiple trophic levels from the same seawater samples collected from a kelp forest in Monterey Bay, California in order to establish methods for future cross-trophic level eDNA analysis. Triplicate 1 L water samples were filtered using five different 47 mm diameter membrane filters (PVDF, PES, GFF, PCTE, and NC) and DNA was extracted from triplicates of each filter-type using three widely-used extraction methods (the DNeasy Blood and Tissue kit, the MoBio PowerWater DNA Isolation kit, and standard phenol/chloroform methods) resulting in 45 individual eDNA samples prepared with 15 workflow combinations. Each DNA extract was amplified using PCR primers for the 16S rRNA gene (microorganisms; Bacteria and Archaea), 18S rRNA gene (phytoplankton), and the 12S rRNA gene (vertebrates) genes, and PCR products were sequenced on an Illumina MiSeq platform. The richness and community composition of microbial, phytoplankton, and vertebrate OTUs were not significantly different between any of the 0.2 μm pore-size filter types extracted with the DNeasy or MoBio kits. However, phenol/chloroform extraction resulted in significantly different community structures. This study provides insight into multiple choices for extraction and filtration methods to use eDNA metabarcoding for biodiversity assessment of multiple trophic levels from a single sample. We recommend any combination of either DNeasy or MoBio with PES, PCTE, PVDF, or NC filters for a cross trophic level comparison.

Evaluation of the impact of six different DNA extraction methods for the representation of the microbial community associated with human chronic wound infections using a gel-based DNA profiling method

Infected chronic wounds are polymicrobial in nature which include a diverse group of aerobic and anaerobic microorganisms. Majority of these communal microorganisms are difficult to grow in vitro. DNA fingerprinting methods such as polymerase chain reaction-denaturation gradient gel electrophoresis (PCR-DGGE) facilitate the microbial profiling of complex ecosystems including infected chronic wounds. Six different DNA extraction methods were compared for profiling of the microbial community associated with chronic wound infections using PCR-DGGE. Tissue debris obtained from chronic wound ulcers of ten patients were used for DNA extraction. Total nucleic acid was extracted from each specimen using six DNA extraction methods. The yield, purity and quality of DNA was measured and used for PCR amplification targeting V2–V3 region of eubacterial 16S rRNA gene. QIAGEN DNeasy Blood and Tissue Kit (K method) produced good quality genomic DNA compared to the other five DNA extraction methods and gave a broad diversity of bacterial communities in chronic wounds. Among the five conventional methods, bead beater/phenol–chloroform based DNA extraction method with STES buffer (BP1 method) gave a yield of DNA with a high purity and resulted in a higher DGGE band diversity. Although DNA extraction using heat and NaOH had the lowest purity, DGGE revealed a higher bacterial diversity. The findings suggest that the quality and the yield of genomic DNA are influenced by the DNA extraction protocol, thus a method should be carefully selected in profiling a complex microbial community.

Whole genome and RNA sequencing reveal the distinct genomic landscape of acral melanoma.

9589 Background: Acral melanoma is a common subtype of melanoma in Asians with extremely poor prognosis, and therapy strategy has not been clearly established for acral melanoma. The aim of this study is to perform genomic and RNA profiling of acral melanoma to obtain the comprehensive genomic view of this subtype of melanoma. Methods: Genomic DNA was extracted with Qiagen DNeasy Blood or Tissue Kit . DNA libraries were prepared using a CancerPROTM-P88 BOX library Prep kit and sequencing was performed using the Illumina HiSeq X10. RNA was isolated with Qiagen RNeasy mini-spin column. cDNA was synthesized from total RNA using the SuperScript III first-strand synthesis system . RNA libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit and sequencing was performed using the Illumina HiSeq X10. Results: To obtain a comprehensive genomic and functional genomic view of acral melanoma, we sequenced the genomes of 14 acral melanoma and transcriptomes of 11 of these melanoma samples. We found a new mutation in the V28 codon of BRAF in three patients. Furthermore, we identified recurrent non-synonymous single nucleotide variants in previously described oncogene NRAS, as well as in genes encoding keratin associated proteins (KRTAP4-7, KRTAP4-5) and mucin (MUC2, MUC21). Notably, a recurrent noncoding hotspot mutation was discovered in 4 of 11 cases. By analyzing the RNA sequencing data, we found significant divergence on transcriptome between patients with or without ulcer. In total, we identified 201 genes were significantly up-regulated and 386 genes significantly down-regulated in acral melanoma patients with ulcer. Differentially expressed genes were enriched in pathways associated with cancers, melanogenesis, cell death signaling, skin diseases, etc. Conclusions: Our study reveals potentially different driver mutations and distinct transcriptome in acral melanoma patients compared with cutaneous melanoma patients and sheds lights to the further personalized medicine for acral melanoma patients.

Validating sonication as a DNA extraction method for use with carrion flies

Entomological evidence can be critical in establishing a postmortem interval estimate. DNA-based species identification can be an extremely valuable tool for forensic entomology. The problem of processing samples in a consistent, cost-effective manner that retains the morphological attributes of the specimen for vouchering has led us to investigate sonication as a primary means of non-destructive DNA extraction from carrion flies. We analyze the efficacy of this technique and compare it to an established DNA extraction technique — the Qiagen DNeasy tissue kit. Our results indicate that sonication produces a significant reduction in the sequence length and lower PHRED quality scores when compared to sequences using DNA obtained using the DNeasy kit, but species identification and phylogenetic inferences between sonication and DNeasy extractions are equivalent.

The composition of the gastrointestinal bacterial flora of mouse embryos and the placenta tissue bacterial flora

Objective: To explore the composition of the gastrointestinal bacterial flora of mouse embryos and the placenta tissue bacterial flora. Method: Twenty-four specimens were collected from pregnant Kunming mouse including 8 mice of early embryonic (12-13 days) gastrointestinal tissues, 8 cases of late embryonic (19-20 days)gastrointestinal tissues, 8 of late pregnancy placental tissues.The 24 samples were extracted by DNeasy Blood & Tissue kit for high-throughput DNA sequencing. Result: The level of Proteobacteria, Bacteroidetes, Actino-bacteria and Firmicutes were predominantin all specimens.The relative content of predominant bacterial phyla in each group: Proteobacteria (95.00%, 88.14%, 87.26%), Bacteroidetes(1.71%, 2.15%, 2.63%), Actino-Bacteria(1.16%, 4.10%, 3.38%), Firmicutes(0.75%, 2.62%, 2.01%). At the level of family, there were nine predominant bacterial families in which Enterobacteriaeae, Shewanel laceae and Moraxellaceae were dominant.The relative content of dominant bacterial family in eachgroup: Enterobacteriaeae (46.99%, 44.34%, 41.08%), Shewanellaceae (21.99%, 21.10%, 19.05%), Moraxellaceae(9.18%, 7.09%, 5.64%). From the species of flora, the flora from fetal gastrointestinal in early pregnancy and late pregnancy (65.44% and 62.73%) were the same as that from placenta tissue in the late pregnancy.From the abundance of bacteria, at the level of family, the same content of bacteria in three groups accounted for 78.16%, 72.53% and 65.78% respectively. Conclusion: It was proved that the gastrointestinal bacterial flora of mouse embryos and the placenta tissue bacterial flora were colonized. At the same time the bacteria are classified.