Size Of DNA Fragments Research Articles

Systematic discovery of complex insertions and deletions in human cancers.

Complex indels are formed by simultaneously deleting and inserting DNA fragments of different sizes at a common genomic location. Here, we present a systematic analysis of somatic complex indels in the coding sequences of over 8,000 cancer cases using Pindel-C. We discovered 285 complex indels in cancer genes (e.g., PIK3R1, TP53, ARID1A, GATA3, and KMT2D) in approximately 3.5% of cases analyzed; nearly all instances of complex indels were overlooked (81.1%) or mis-annotated (17.6%) in 2,199 samples previously reported. In-frame complex indels are enriched in PIK3R1 and EGFR while frameshifts are prevalent in VHL, GATA3, TP53, ARID1A, PTEN, and ATRX. Further, complex indels display strong tissue specificity (e.g., VHL from kidney cancer and GATA3 from breast cancer). Finally, structural analyses support findings of previously missed, but potentially druggable mutations in EGFR, MET, and KIT oncogenes. This study indicates the critical importance of improving complex indel discovery and interpretation in medical research.

Automatic DNA Diagnosis for 1D Gel Electrophoresis Images using Bio-image Processing Technique.

BackgroundDNA gel electrophoresis is a molecular biology technique for separating different sizes of DNA fragments. Applications of DNA gel electrophoresis include DNA fingerprinting (genetic diagnosis), size estimation of DNA, and DNA separation for Southern blotting. Accurate interpretation of DNA banding patterns from electrophoretic images can be laborious and error prone when a large number of bands are interrogated manually. Although many bio-imaging techniques have been proposed, none of them can fully automate the typing of DNA owing to the complexities of migration patterns typically obtained.ResultsWe developed an image-processing tool that automatically calls genotypes from DNA gel electrophoresis images. The image processing workflow comprises three main steps: 1) lane segmentation, 2) extraction of DNA bands and 3) band genotyping classification. The tool was originally intended to facilitate large-scale genotyping analysis of sugarcane cultivars. We tested the proposed tool on 10 gel images (433 cultivars) obtained from polyacrylamide gel electrophoresis (PAGE) of PCR amplicons for detecting intron length polymorphisms (ILP) on one locus of the sugarcanes. These gel images demonstrated many challenges in automated lane/band segmentation in image processing including lane distortion, band deformity, high degree of noise in the background, and bands that are very close together (doublets). Using the proposed bio-imaging workflow, lanes and DNA bands contained within are properly segmented, even for adjacent bands with aberrant migration that cannot be separated by conventional techniques. The software, called GELect, automatically performs genotype calling on each lane by comparing with an all-banding reference, which was created by clustering the existing bands into the non-redundant set of reference bands. The automated genotype calling results were verified by independent manual typing by molecular biologists.ConclusionsThis work presents an automated genotyping tool from DNA gel electrophoresis images, called GELect, which was written in Java and made available through the imageJ framework. With a novel automated image processing workflow, the tool can accurately segment lanes from a gel matrix, intelligently extract distorted and even doublet bands that are difficult to identify by existing image processing tools. Consequently, genotyping from DNA gel electrophoresis can be performed automatically allowing users to efficiently conduct large scale DNA fingerprinting via DNA gel electrophoresis. The software is freely available from http://www.biotec.or.th/gi/tools/gelect.

A rapid and cost-effective method for DNA extraction from archival herbarium specimens

Here we report a rapid and cost-effective method for the extraction of total DNA from herbarium specimens up to 50-90-year-old. The method takes about 2 h, uses AMPure XP magnetic beads diluted by PEG-8000- containing buffer, and does not require use of traditional volatile components like chloroform, phenol, and liquid nitrogen. It yields up to 4 µg of total nucleic acid with high purity from about 30 mg of dry material. The quality of the extracted DNA was tested by PCR amplification of 5S rRNA and rbcL genes (nuclear and chloroplast DNA markers) and compared against the traditional chloroform/isoamyl alcohol method. Our results demonstrate that the use of the magnetic beads is crucial for extraction of DNA suitable for subsequent PCR from herbarium samples due to the decreasing inhibitor concentrations, reducing short fragments of degraded DNA, and increasing median DNA fragment sizes.

Breast Tissue Engineering

INTRODUCTION: Decellularization of tissues provides inductive extra-cellular matrices (ECM) for effective organ reconstruction: this promising approach has not been translated to breast reconstruction yet.1,2 We investigated the effectiveness of different decellularization protocols applied to porcine mammary glands with the purpose of developing an inductive biological matrix for prospective breast tissue engineering. METHODS: We cut porcine mammary glands into homogeneous samples (10x10x2cm) and processed these according to three different decellularization protocols (A, B, C). All protocols combined multiple chemical treatments (A: 0.02% trypsin, 0.05% ethylenediaminetetraacetic acid-EDTA, 3% Triton X-100, 4% deoxycholic acid; B: collagenase 3mg/g, 0.02% trypsin, 0.05% EDTA, 10U/mL, 10U/mL lipase; C: collagenase 3mg/g, 0.05% EDTA, 4% sodium deoxycholate, 1% sodium dodecyl sulfate, 0.9% NaCl in TRIS-HCl containing protease inhibitors). We analyzed processed specimens by macroscopic (morphologic) and microscopic methods (Hematoxylin and Eosin staining, Immuno-fluorescent labeling with 4′,6-diamidino-2-phenylindole-DAPI, quantitative measurement of DNA and DNA fragment size) to assess quality of decellularization and structural preservation of the matrix. RESULTS: Harvested mammary glands could be molded to required shape; adjacent glands could be harvested together (up to 700grams). Maximal size of obtainable glands based on a single blood supply varied (average: 20x40x3cm). Blood supply was based on a single reliable vascular pedicle, potentially suitable for microsurgical anastomosis in vivo. Decellularization protocols had variable effectiveness: all samples showed macroscopic evidence of decellularization preserving original morphology at gross examination. DAPI, quantitative measurement of DNA (below 50 ng/mg dry tissue weight) and of DNA fragment size (below 200 base-pairs) showed effective reduction of immunogenic components in each protocol. At histological analysis (Hematoxylin and Eosin) protocol A provided a morphology more closely resembling native architecture of ECM and a more effective preservation of the vascular and ductal networks. Protocols B and C, instead, slightly damaged and altered histological structure of the matrix. CONCLUSIONS: Decellularization of porcine mammary tissue represents a novel and reliable preliminary approach to develop a bio-inductive matrix for potential subsequent breast tissue engineering.

Construction of a DNA Vaccine Encoding Mtb32C and HBHA Genes of Mycobacterium tuberculosis.

Background:Tuberculosis (TB) is a contagious disease caused by Mycobacterium tuberculosis. Development of a new vaccine for tuberculosis requires immunogenic antigens capable of inducing suitable and long-lasting T cell immunity. The emergence of multidrugs and extensively drug-resistant strains of M. tuberculosis has made it a global public health concern.Objectives:DNA vaccine is a straightforward method to introduce antigens to the host. In the present study, two immunodominant mycobacterial antigens (Mtb32C and HBHA) were isolated and cloned into pcDNA3.1 (+) to design and construct a new DNA vaccine. This vector is capable of producing new potent chimeric protein.Materials and Methods:Mtb32C (Rv0125) and heparin-binding haemagglutinin adhesion (HBHA) genes were amplified using polymerase chain reaction (PCR) of M. tuberculosis H37Rv genome and ligated into pcDNA3.1 (+). Colony-PCR and restriction enzyme analysis were used to confirm the accuracy of the cloning procedure.Results:In the current study, recombinant pcDNA3.1 (+) vector containing Mtb32C and HBHA genes was successfully constructed. The desired size of DNA fragment was observed using single and double digestion methods.Conclusions:Mtb32C and HBHA genes were successfully isolated from H37Rv genome and cloned into an eukaryotic expression vector. This vector can be considered as a vaccine to evaluate immune responses in animal models.

Biases underlying species detection using fluorescent amplified-fragment length polymorphisms yielded from roots.

BackgroundRoots of different plant species are typically morphologically indistinguishable. Of the DNA-based techniques, fluorescent amplified-fragment length polymorphisms (FAFLPs) are considered reliable, high throughput, inexpensive methods to identify roots from mixed species samples. False-negatives, however, are not uncommon and their underlying causes are poorly understood. We investigated several sources of potential biases originating in DNA extraction and amplification. Specifically, we examined the effects of sample storage, tissue, and species on DNA yield and purity, and the effects of DNA concentration and fragment size on amplification of three non-coding chloroplast regions (trnT-trnL intergenic spacer, trnL intron, and trnL-trnF intergenic spacer).ResultsWe found that sample condition, tissue and species all affected DNA yield. A single freeze–thaw reduces DNA yield, DNA yield is less for roots than shoots, and species vary in the amount of DNA yielded from extractions. The effects of template DNA concentration, species identity, and their interaction on amplicon yield differed across the three chloroplast regions tested. We found that the effect of species identity on amplicon production was generally more pronounced than that of DNA concentration. Though these factors influenced DNA yield, they likely do not have a pronounced effect on detection success of fragments and only underscore the restriction on the use of FAFLPs for measuring species presence rather than their abundance. However, for two of the regions tested—the trnT-trnL intergenic spacer and the trnL intron—size-based fragment competition occurred and the likelihood of detection was higher for smaller than larger fragments. This result reveals a methodological bias when using FAFLPs.ConclusionsTo avoid potential bias with the use of FAFLPs, we recommend users check for the disproportionate absence of species detected belowground versus aboveground as a function of fragment size, and explore other regions, aside from the trnT-trnL intergenic spacer and trnL intron, for amplification.Electronic supplementary materialThe online version of this article (doi:10.1186/s13007-015-0079-1) contains supplementary material, which is available to authorized users.

8C.07

Objective: Tumor cells undergoing apoptosis or necrosis release cell-free DNA fragments (cf-DNA) of different sizes into the bloodstream. Primary aldosteronism (PA) caused by aldosterone-producing adenoma (APA), but not by bilateral hyperplasia (BAH), has somatic mutations in KCNJ5 gene. Hence, the detection of KCNJ5 mutations in cf-DNA from peripheral blood could allow pinpointing PA patients with APA that must be submitted to Adrenal Vein Sampling (AVS). The aim of the study was to investigate the feasibility of using cf-DNA to detect KCNJ5 mutations in plasma of PA patients. Design and method: Plasma was collected from the right/left adrenal veins from 6 APA patients undergoing AVS. Plasma from 7 patients with stomach cancer and from 6 healthy subjects was used as positive/negative control, respectively, for cf-DNA quality. The integrity index (DII) was calculated as a ratio of 400pb/200pb amplicons. A DII cut off equal or greater than 1.0 was assumed to denote cf-DNA integrity. DNA sequences entailing the region with KCNJ5 gene mutations (G151R, L168R, T158A) were amplified using PCR real time (qPCR) to obtain long (400 bp) and short (200 bp) fragments. Results: The DII for KCNJ5 amplicons on average was consistently > 1.0 in gastric cancer samples, 1.0 in healthy subjects whereas it was < 1.0 in APA patients. The cf-DNA concentration of KCNJ5 amplicons was 10-fold higher in gastric cancer patients than in AVS plasma (4.8 ± 1 vs 0.4 ± 0.1 ng/ul p < 0.01). The latter showed no significant differences between the APA and the contralateral side (0.41 ± 0.1 vs 0.36 ± 0.1). Conclusions: These results confirm the feasibility of isolating cf-DNA not only from patients with malignancies, but also with PA. With current technology the cf-DNA amount and integrity that were obtained suggest the feasibility of using this strategy to detect malignancies. However, at present the results obtained in this study do not support the use of this approach to pinpoint PA with APA based on identification of KCNJ5 mutations. Therefore, further work is needed to develop this innovative and non-invasive strategy that could be useful to pinpoint the patients with APA before the AVS.

Live Cell Characterization of DNA Aggregation Delivered through Lipofection.

DNA trafficking phenomena, such as information on where and to what extent DNA aggregation occurs, have yet to be fully characterised in the live cell. Here we characterise the aggregation of DNA when delivered through lipofection by applying the Number and Brightness (N&B) approach. The N&B analysis demonstrates extensive aggregation throughout the live cell with DNA clusters in the extremity of the cell and peri-nuclear areas. Once within the nucleus aggregation had decreased 3-fold. In addition, we show that increasing serum concentration of cell media results in greater cytoplasmic aggregation. Further, the effects of the DNA fragment size on aggregation was explored, where larger DNA constructs exhibited less aggregation. This study demonstrates the first quantification of DNA aggregation when delivered through lipofection in live cells. In addition, this study has presents a model for alternative uses of this imaging approach, which was originally developed to study protein oligomerization and aggregation.

Modeling radiation-induced cell death: role of different levels of DNA damage clustering.

Some open questions on the mechanisms underlying radiation-induced cell death were addressed by a biophysical model, focusing on DNA damage clustering and its consequences. DNA "cluster lesions" (CLs) were assumed to produce independent chromosome fragments that, if created within a micrometer-scale threshold distance (d), can lead to chromosome aberrations following mis-rejoining; in turn, certain aberrations (dicentrics, rings and large deletions) were assumed to lead to clonogenic cell death. The CL yield and d were the only adjustable parameters. The model, implemented as a Monte Carlo code called BIophysical ANalysis of Cell death and chromosome Aberrations(BIANCA), provided simulated survival curves that were directly compared with experimental data on human and hamster cells exposed to photons, protons, α-particles and heavier ions including carbon and iron. d=5μm, independent of radiation quality, and CL yields in the range ~2-20CLsGy(-1)cell(-1), depending on particle type and energy, led to good agreement between simulations and data. This supports the hypothesis of a pivotal role of DNA cluster damage at sub-micrometric scale, modulated by chromosome fragment mis-rejoining at micrometric scale. To investigate the features of such critical damage, the CL yields were compared with experimental or theoretical yields of DNA fragments of different sizes, focusing on the base-pair scale (related to the so-called local clustering), the kbp scale ("regional clustering") and the Mbp scale, corresponding to chromatin loops. Interestingly, the CL yields showed better agreement with kbp fragments rather than bp fragments or Mbp fragments; this suggests that also regional clustering, in addition to other clustering levels, may play an important role, possibly due to its relationship with nucleosome organization in the chromatin fiber.

Application of the SCCmec element in the molecular typing of methicillin-resistant Staphylococcus aureus.

Acquisition of the staphylococcal chromosome cassette mec (SCCmec) is one of the key reasons for the resistance of methicillin-resistant Staphylococcus aureus (MRSA). SCCmec is composed of a mec gene complex encoding the PBP2a determinant that is responsible for the β-lactam resistance of MRSA, and a ccr gene complex encoding recombinases that mediate the integration of SCCmec into and its excision from the recipient chromosome, and so-called three junkyard (J) regions of different sizes. The SCCmec elements carried by MRSA from different geographic locations are diverse, and each type contains characteristic DNA fragments in size. These characteristics of SCCmec element may facilitate the usage of SCCmec in the molecular typing of MRSA strains. In this review, we summarize the structure and function of SCCmec elecments, and discuss the application of SCCmec elements in the molecular typing of MRSA.

Typing of Mycobacterium avium subspecies paratuberculosis isolates from Newfoundland using fragment analysis.

Short Sequence Repeat (SSR) typing of Mycobacterium avium subspecies paratuberculosis (Map) isolates is one of the most commonly used method for genotyping this pathogen. Currently used techniques have challenges in analyzing mononucleotide repeats >15 bp, which include some of the Map SSRs. Fragment analysis is a relatively simple technique, which can accurately measure the size of DNA fragments and can be used to calculate the repeat length of the target SSR loci. In the present study, fragment analysis was used to analyze 4 Map SSR loci known to provide sufficient discriminatory power to determine the relationship between Map isolates. Eighty-five Map isolates from 18 animals from the island of Newfoundland were successfully genotyped using fragment analysis. To the best of our knowledge, this is the first report on Map SSR diversity from Newfoundland dairy farms. Previously unreported Map SSR-types or combinations were also identified during the course of the described work. In addition, multiple Map SSR-types were isolated from a single animal in many cases, which is not a common finding.

Identification of Aroma Gene (Mutated &lt;i&gt;badh&lt;/i&gt;2) and Properties of Aroma on Aromatic BC&lt;sub&gt;5&lt;/sub&gt;F&lt;sub&gt;2&lt;/sub&gt; Ciherang

Aromatic rice varieties have some weaknesses such as low productivity, and less resistant to pests and diseases. This study aimed to obtain homozygous strain of BC5F2 Ciherang aromatic through the identification of aroma gene (mutated badh2) and properties of the aroma. Ciherang paddy (nonaromatic paddy) was used as the female parent, whereas Mentik Wangi paddy (aromatic paddy) was used as the male parent. The experiment was conducted in BC5F2 because it is expected to generate plants with properties 98.4% close to female parent. The DNA from five strains of paddy plants BC5F2Ciherang X Mentik Wangi was isolated by a modified CTAB method. The concentration of DNA was determined by measuring absorbance at 260 nm wavelength, while its purity was determined from the ratio of the absorbance at a wavelength of 260/280 nm. PCR-based molecular selection was done by using the Bradbury primers. PCR results showed that of the 250 samples, there were 66 samples had DNA fragment of the same size as that of Mentik Wangi, i.e. 257 bp, 67 samples had the same size as the DNA fragment of Ciherang, i.e. 355 bp, and 117 samples had the same size with the both of DNA fragments, i.e. 257 bp and 355 bp. Plants with amplified 257 bp DNA fragment was subjected to leaf aroma test using 1.7% KOH. The results showed that 42 positive samples, out of 66 samples. Samples positive on leaf aroma test were tested again on rice aroma test. Rice aroma test results showed the majority (85.4%) samples that are positive on leaf aroma test is also positive on the rice aroma test.

Predicting Anticancer Drug Efficacy by Assessing DNA Repair Ability

A significant challenge in cancer therapy is the development of drug resistance by tumor cells. Evidences suggest a direct connection between DNA repair ability and tumor resistance in chemotherapy. This paper describes a new single cell halo assay (HaloChip) which was developed in our lab that can be used to quantify DNA repair ability. In this method, surface micropatterns are used to capture single cells on silicon substrate via electrostatic attraction. Attached cells are embedded inside agarose gel and treated with alkaline solution. Damaged DNAs will unwind and diffuse inside the gel with diffusion coefficients inversely proportional to DNA fragment sizes. After staining DNAs with ethidium bromide (EB), cells are imaged using fluorescence microscopy, where fluorescence signals are proportional to the amount of DNA. The level of DNA damage is quantified using a relative nuclear diffusion factor (rNDF) derived from the surface area of the nucleus and halo. DNA repair ability characterized by halo shrinkage is measured in a similar way except that damaged cells are allowed to recover. This method has been used to assess DNA repair ability of several repair competent and repair deficient cells. Further, this method has also been used to evaluate DNA repair ability of drugs in the presence of DNA repair inhibitors and under hypoxia conditions. This paper highlights the importance of understanding DNA repair ability and modulating of DNA repair processes can be used in the development of novel cancer treatment. This method has remarkable potentials to greatly improve healthcare by understanding the role of DNA repair ability in chemotherapy.

Efficient inversions and duplications of mammalian regulatory DNA elements and gene clusters by CRISPR/Cas9.

The human genome contains millions of DNA regulatory elements and a large number of gene clusters, most of which have not been tested experimentally. The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated nuclease 9 (Cas9) programed with a synthetic single-guide RNA (sgRNA) emerges as a method for genome editing in virtually any organisms. Here we report that targeted DNA fragment inversions and duplications could easily be achieved in human and mouse genomes by CRISPR with two sgRNAs. Specifically, we found that, in cultured human cells and mice, efficient precise inversions of DNA fragments ranging in size from a few tens of bp to hundreds of kb could be generated. In addition, DNA fragment duplications and deletions could also be generated by CRISPR through trans-allelic recombination between the Cas9-induced double-strand breaks (DSBs) on two homologous chromosomes (chromatids). Moreover, junctions of combinatorial inversions and duplications of the protocadherin (Pcdh) gene clusters induced by Cas9 with four sgRNAs could be detected. In mice, we obtained founders with alleles of precise inversions, duplications, and deletions of DNA fragments of variable sizes by CRISPR. Interestingly, we found that very efficient inversions were mediated by microhomology-mediated end joining (MMEJ) through short inverted repeats. We showed for the first time that DNA fragment inversions could be transmitted through germlines in mice. Finally, we applied this CRISPR method to a regulatory element of the Pcdhα cluster and found a new role in the regulation of members of the Pcdhγ cluster. This simple and efficient method should be useful in manipulating mammalian genomes to study millions of regulatory DNA elements as well as vast numbers of gene clusters.

DNA studies using atomic force microscopy: capabilities for measurement of short DNA fragments.

Short DNA fragments, resulting from ionizing radiation induced DNA double strand breaks (DSBs), or released from cells as a result of physiological processes and circulating in the blood stream, may play important roles in cellular function and potentially in disease diagnosis and early intervention. The size distribution of DNA fragments contribute to knowledge of underlining biological processes. Traditional techniques used in radiation biology for DNA fragment size measurements lack the resolution to quantify short DNA fragments. For the measurement of cell-free circulating DNA (ccfDNA), real time quantitative Polymerase Chain Reaction (q-PCR) provides quantification of DNA fragment sizes, concentration and specific gene mutation. A complementary approach, the imaging-based technique using Atomic Force Microscopy (AFM) provides direct visualization and measurement of individual DNA fragments. In this review, we summarize and discuss the application of AFM-based measurements of DNA fragment sizes. Imaging of broken plasmid DNA, as a result of exposure to ionizing radiation, as well as ccfDNA in clinical specimens offer an innovative approach for studies of short DNA fragments and their biological functions.

Pathotyping of Local Isolates Newcastle Disease Virus from Field Specimens by RT-PCR and Restriction Endonuclease Analysis

Newcastle Disease is one of the serious viral infection disease in poultry, especially chicken. The etiological agent of Newcastle Disease is Newcastle Disease Virus (NDV). The objective of this research was to develop a method for determining pathotype of NDV in various species of poultry from field specimens rapidly and efficiently by using RT-PCR and REA method. This study was conducted for identification, differentiation and pathotyping of NDV from local isolates by using amplification of RT-PCR followed by REA of F protein encoding gene of NDV. To differentiate virulent and avirulent NDV, the RT-PCR product of F gene in size of 767 basepairs (bp) was analyzed by Hin 1l and Bam HI restriction enzymes. RT-PCR amplification for F gene NDV generated DNA fragments in size of 767bp. RT-PCR and REA method by using Hin 1l and Bam HI enzymes can be used to determine pathotype of NDV from field specimens, for total ten field specimen samples of NDV, three samples are avirulent NDV and seven samples are virulent NDV. RT-PCR and REA methods are appropriate with DNA sequencing method to determine the NDV.

Easy method for production of a home-made DNA ladder in every laboratory.

Background:Molecular DNA markers are one of the essential tools in molecular biology labs with varied applications. In the present study, we suggest an efficient and available strategy to produce molecular size marker in routine laboratories.Materials and Methods:To achieve the desired sizes of DNA fragments, we recruited PCR and bioinformatics techniques to synthesize 14 DNA fragments ranging from 100 to 3000 bp.Results:Holistic analysis of different parameters in primers design resulted in amplification of fragments in just one PCR program without any by-product and purification step. Our applied method enables researchers to modify amplified DNA fragments by wide range of chemical modifications toward varied applications.Conclusion:Method of home-made DNA ladder production by available ingredients and routine techniques reported in this study can be used in common laboratories for different applications.

Gel-free electrophoresis of DNA and proteins on chips featuring a 70 nm capillary-well motif.

We present an integrated glass capillary system on silicon for size-based sieving of distinct mixtures of proteins, short DNA, and long DNA fragments into sharp peaks. The minimum resolvable size difference achieved is noted as 3.45 kDa for 45-52.8 kDa proteins, 20 bp for 200-300 bp DNA strands, and 182 bp for 5.6-5.8 kbp DNA chains. This high-resolution sieving arises from vastly steep entropic barriers created at the onsets of extremely restrictive (resistive) capillary segments and their pivotal role in shifting the equilibrium entropic sieving to intense fields (>1000 V/cm). DNA fragments of various sizes are shown fully resolved in less than 7 min at a steady voltage of 2000 V being directly applied across the length of a 2 cm long sieve featuring thousands of entropic barriers. The utility of higher field strengths and longer sieves is also demonstrated without triggering dielectric breakdown by time-division multiplexing up to 2000 V across the 1 cm long sieve segments. The self-enclosed 70 nm diameter capillaries were fabricated using coarse (>1 μm) photolithography and standard semiconductor manufacturing techniques.

First Report of Bursaphelenchus mucronatus kolymensis Associated with Pinus sylvestris in Serbia.

Bursaphelenchus mucronatus kolymensis (Korentchenko) Braasch et al. (1), also referred to as the European type of B. mucronatus, is morphologically very similar to the pine wood nematode (PWN) B. xylophilus (Steiner & Buhrer) Nickle, the causal agent of pine wilt disease. The main morphological difference between the two species is the shape of the female tail mucro (3); however, some populations of PWN vary in mucro shape, which can lead to misidentification. Since PWN was found and identified for the first time in Portugal in 1999 (4), concern about the spread of PWN to pines and other conifers all over Europe has increased. Therefore, the PWN survey in every European country is essential. In 2011, the Serbian Ministry of Agriculture, Forestry and Water Management implemented phytosanitary measures for detection of PWN in the territory of the Republic of Serbia. In September 2013, wood samples were collected from a 40-year-old wilted Pinus sylvestris located on Divcibare Mountain, western Serbia. Nematodes were extracted by a modified Baermann funnel method. Nematode specimens (10 females and 10 males) were characterized by an Aphelenchoid-type esophagus, female vulva flap, mucro on the end of female tail, and males with paired arcuate spicules. Morphological identification matched that of B. mucronatus kolymensis (1). The specific morphometric evidence for this European type subspecies of B. mucronatus was sub-cylindrical female tail with mucro 3 to 4 μm long, digitate, well offset from tail (5). Species identification was confirmed by PCR-RFLP of the rDNA ITS region using one female and one male nematode separately (2). The sizes of restricted DNA fragments as determined with agarose gel and capillary electrophoresis were in compliance with reported data in the literature (2,4) and support the identification of the nematode as B. mucronatus kolymensis. To our knowledge, this is the first report of any species belonging to Bursaphelenchus genus in Serbia. The presence of B. mucronatus kolymensis in Serbia indicates the possibility of establishment and spread of PWN. Therefore, the measures taken in case of PWN occurrence should be prepared and training foresters to identify pine wilt disease symptoms should be encouraged in Serbia.

FIRST REPORT OF MIXED INFECTION OF PAPAYA RINGSPOT VIRUS AND PAPAYA LEAF DISTORTION MOSAIC VIRUS ON CARICA PAPAYA L.

Papaya ringspot virus (PRSV) and Papaya leaf distortion mosaic virus (PLDMV) from the family Potyviridae produce similar symptoms in papaya such as foliar mosaic, ringspots and distortion, water soaking streaks on petioles, and ringspots on fruit. PRSV is the most widespread and destructive viral disease damaging papaya production in the world, whereas PLDMV was recently identified in China (Tuo et al., 2013). In March 2014, 23 papaya trees displaying disease symptoms similar to those of PRSV or PLDMV were observed in Haikou (Hainan Island, China). Six samples were co-infected with PRSV and PLDMV, as shown by DAC-ELISA with antisera to PRSV or PLDMV. Mixed infection was subsequently confirmed by RT-PCR using PRSV-specific primers designed in a highly conserved region of gene P3 (P3-F, 5′TTGTGTACGACTTCTCACCGAA3′ and P3-R, 5′CGAATGTCATCCAAAGACT GATGATAAAC3′) and PLDMV-specific primers designed in a highly conserved region of the coat protein (CP) gene (CP-F, 5′GGCATGTGGTTTATGATGCAAGG G3′ and CP-R, 5′GCTCCGTGTTCTCAGTCGCATT3′). DNA fragments of the expected size (613 and 355 bp, respectively) were amplified from each mixed infected sample using PRSV and PLDMV-specific primers, and then cloned and sequenced. BLASTn analysis of the nucleotide sequences obtained from the cloned PCR products showed 99% identity with a PRSV isolate from Hainan (GenBank accession No. EF183499) and 100% identity with a PLDMV isolate from Hainan (GenBank accession no. JX974555) (Lu et al., 2008; Tuo et al., 2013). To our knowledge, this is the first report of mixed infection of PRSV and PLDMV on papaya, prompting the need for evaluating the potential threat of the mixed virus infection to papaya production.