DNA Films Research Articles

Direct Damage to the Backbone of DNA Oligomers Is Influenced by the OH Moiety at Strand Ends, by the Type of Base, and by Context

Previous studies on high molecular weight DNA found that backbone damage, as monitored by free base release, is relatively independent of the type of base; i.e., the yields of all four bases were nearly equal. This could be due to a lack of influence of any given base over damage to its own deoxyribose or it could be a consequence of averaging out disparities due to each base sampling a wide range of base contexts. This study is aimed at distinguishing between these two possibilities. Transparent films, prepared from palindromic oligodeoxynucleotides of d(CTCTCGAGAG), d(CTCTCGAGAGp), d(pCTCTCGAGAGp), d(GAGAGCTCTC), d(ACGCGCGCGT), d(AACGCGCGCGTT), d(CTCTCTTAATAATTATAATTATTAAGAGAG), and d(CTCTCTTAATATTAAGAGAG), were used for this investigation. The DNA films, hydrated to approximately 2.5 waters per nucleotide, were irradiated at RT under air using X-rays generated by a tungsten tube, immediately dissolved in nuclease-free water, and stored at 277 K for 24 h, and then unaltered free base release was measured using HPLC. Yields of free base release were based on a target mass consisting of the DNA and one counterion+2.5 H2O/nucleotide. The yields of each base, G(C), G(G), G(T), and G(A) were determined for each of the above sequences. The observed yields lead to the following conclusions: (i) base release at the oligomer ends is favored over release at internal positions (called the end effect), (ii) phosphorylation of the OH moiety at the oligomer ends quenches the end effect, (iii) the magnitude of the end effect is influenced by the base at the end and the bases proximal to it, and (iv) the release of base is influenced by the base and its context.

Induction of DNA Strand Breaks, Base Lesions and Clustered Damage Sites in Hydrated Plasmid DNA Films by Ultrasoft X Rays around the Phosphorus K Edge

To characterize the DNA damage induced by K-shell ionization of phosphorus atom in DNA backbone on the level of hydration, the yields of DNA strand breaks and base lesions arising from the interaction of ultrasoft X rays with energies around the phosphorus K edge were determined using dry and fully hydrated pUC18 plasmid DNA samples. Base lesions and bistranded clustered DNA damage sites were revealed by postirradiation treatment with the base excision repair proteins endonuclease III (Nth) and formamidopyrimidine-DNA glycosylase (Fpg). The yield of prompt single-strand breaks (SSBs) with dry DNA irradiated at the phosphorus K resonance energy (2153 eV) is about one-third that below the phosphorus K edge (2147 eV). The yields of prompt double-strand breaks (DSBs) were found to be less dependent on the X-ray energy, with the yields being about two times lower when irradiated at 2153 eV. Heat-labile sites were not produced in detectable amounts. The yields of base lesions were dependent on the energy of the X rays, especially when the DNA was fully hydrated. Bistranded clustered DNA damage sites, revealed enzymatically as additional DSBs, were produced in dry as well as in hydrated DNA with all three energies of X rays. The yields of these enzyme-sensitive sites were also lower when irradiated at the phosphorus K resonance energy. On the other hand, the yields of prompt SSBs and enzyme-sensitive sites for the two off-resonance energies were, larger than those determined previously for gamma radiation. The results indicate that the photoelectric effect caused by X rays and dense ionization and excitation events along the tracks of low-energy secondary electrons are more effective at inducing SSBs and enzyme-sensitive sites. The complex types of damage, prompt and enzymatically induced DSBs, are preferentially induced by phosphorus K resonance at 2153 eV rather than simple SSBs and isolated base lesions, particularly in hydrated conditions. It is concluded that not only the phosphorus K resonance and resulting emission of low-energy LMM-Auger electrons ( approximately 120 eV) but also the level of hydration plays an important role in the induction of complex damage in plasmid DNA.

Spectral change in X-ray absorption near edge structure of DNA thin films irradiated with monochromatic soft X-rays

To reveal the chemical changes induced in DNA by irradiation with ionizing radiation, we have investigated the spectral change in the X-ray absorption near edge structure (XANES) of DNA resulting from exposure to monochromatic soft X-rays. We used a thin film of calf thymus DNA as a sample and observed nitrogen K-shell and oxygen K-shell XANES spectra. The typical monochromatic soft X-ray energies used for the irradiation (395, 408, 528, and 538 eV) were obtained from a soft X-ray beamline (BL23SU, SPring-8). These energies correspond to those just below or just above the nitrogen and oxygen K-shell ionization energy, respectively. The obtained XANES spectra show significant changes by irradiation. Particularly a new π* resonance peak in oxygen XANES spectra evidently appeared by the irradiation above oxygen K-shell ionization potential. These results suggest that carbonyl groups, presumably a propenal group (O C–C C), may be produced in the sample by oxygen ionization. Thus characteristic damage induced by induction in the DNA molecule would be predicted following exposure to monochromatized synchrotron soft X-rays.

Gold Nanoparticles Enhance DNA Damage Induced by Anti-cancer Drugs and Radiation

The chemotherapeutic agent cisplatin was chemically linked to pGEM-3Zf(-) plasmid DNA to produce a cisplatin-DNA complex, Gold nanoparticles, which bind electrostatically to pure DNA, could also be added to this complex. Dry films of pure plasmid DNA and DNA-cisplatin, DNA-gold nanoparticles and DNA-cisplatin-gold nanoparticles complexes were bombarded by 60 keV electrons. The yields of single- and double-strand breaks were measured as a function of exposure by electrophoresis. From a comparison of such yields from the different type of films, we found that the binding of only one gold nanoparticle to a plasmid-cisplatin complex containing 3197 base pairs increases by a factor of 3 the efficiency of the chemotherapeutic agent cisplatin to produce double-strand breaks in irradiated DNA. Furthermore, adding two cisplatin molecules and one gold nanoparticle to DNA enhances radiation-induced DSBs by a factor of 7.5. A number of phenomena could contribute to this huge enhancement, including the higher density of low-energy electrons and reactive species around the gold nanoparticles and the weakening of bonds adjacent to cisplatin in the DNA backbone. The addition of gold nanoparticles to cisplatin and other platinum agents may therefore provide interesting avenues of research to improve the treatment of cancer by concomitant chemoradiation.

Damage Induced to DNA by Low-Energy (0−30 eV) Electrons under Vacuum and Atmospheric Conditions

In this study, we show that it is possible to obtain data on DNA damage induced by low-energy (0-30 eV) electrons under atmospheric conditions. Five monolayer films of plasmid DNA (3197 base pairs) deposited on glass and gold substrates are irradiated with 1.5 keV X-rays in ultrahigh vacuum and under atmospheric conditions. The total damage is analyzed by agarose gel electrophoresis. The damage produced on the glass substrate is attributed to energy absorption from X-rays, whereas that produced on the gold substrate arises from energy absorption from both the X-ray beam and secondary electrons emitted from the gold surface. By analysis of the energy of these secondary electrons, 96% are found to have energies below 30 eV with a distribution peaking at 1.4 eV. The differences in damage yields recorded with the gold and glass substrates is therefore essentially attributed to the interaction of low-energy electrons with DNA under vacuum and hydrated conditions. From these results, the G values for low-energy electrons are determined to be four and six strand breaks per 100 eV, respectively.

Self‐assembled monolayers of DNA on cysteamine modified Au(111) surface: Atomic force microscopy study

The lambda-DNA molecules self-assemble on cysteamine-modified gold (111) surface to form flat-lying self-assembled monolayers (SAMs). The formation kinetics of such DNA SAMs is studied by atomic force microscopy (AFM). AFM results show that DNA molecules do not arrange themselves on cysteamine-modified gold (111) surface into a well-ordered monolayer. It is also found that the surface density of DNA monolayer does not increase as the DNA concentration increases. The high temperature of DNA solution and the immersing in ultrapure water produce some obvious DNA bundles. Whereas divalent cations in DNA solution result in the formation of more compact DNA films. The obtained information may be useful for practical application of the DNA films and further theoretical studies.

Mechanisms of Strand Break Formation in DNA due to the Direct Effect of Ionizing Radiation: The Dependency of Free Base Release on the Length of Alternating CG Oligodeoxynucleotides

The question of how NA base sequence influences the yield of DNA strand breaks produced by the direct effect of ionizing radiation was investigated in a series of oligodeoxynucleotides of the form (d(CG)(n))(2) and (d(GC)(n))(2). The yields of free base release from X-irradiated DNA films containing 2.5 waters/nucleotide were measured by HPLC as a function of oligomer length. For (d(CG)(n))(2), the ratio of the Gua yield to Cyt yield, R, was relatively constant at 2.4-2.5 for n = 2-4 and it decreased to 1.2 as n increased from 5 to 10. When Gua was moved to the 5' end, for example going from d(CG)(5) to d(GC)(5), R dropped from 1.9 +/- 0.1 to 1.1 +/- 0.1. These effects are poorly described if the chemistry at the oligomer ends is assumed to be independent of the remainder of the oligomer. A mathematical model incorporating charge transfer through the base stack was derived to explain these effects. In addition, EPR was used to measure the yield of trapped-deoxyribose radicals at 4 K following X-irradiation at 4 K. The yield of free base release was substantially greater, by 50-100 nmol/J, than the yield of trapped-deoxyribose radicals. Therefore, a large fraction of free base release stems from a nonradical intermediate. For this intermediate, a deoxyribose carbocation formed by two one-electron oxidations is proposed. This reaction pathway requires that the hole (electron loss site) transfers through the base stack and, upon encountering a deoxyribose hole, oxidizes that site to form a deoxyribose carbocation. This reaction mechanism provides a consistent way of explaining both the absence of trapped radical intermediates and the unusual dependence of free base release on oligomer length.

Comparison of DNA‐Reactive Metabolites from Nitrosamine and Styrene Using Voltammetric DNA/Microsomes Sensors

Voltammetric sensors made with films of polyions, double-stranded DNA and liver microsomes adsorbed layer-by-layer onto pyrolytic graphite electrodes were evaluated for reactive metabolite screening. This approach features simple, inexpensive screening without enzyme purification for applications in drug or environmental chemical development. Cytochrome P450 enzymes (CYPs) in the liver microsomes were activated by an NADPH regenerating system or by electrolysis to metabolize model carcinogenic compounds nitrosamine and styrene. Reactive metabolites formed in the films were trapped as adducts with nucleobases on DNA. The DNA damage was detected by square-wave voltammetry (SWV) using [Formula: see text] as a DNA-oxidation catalyst. These sensors showed a larger rate of increase in signal vs. reaction time for a highly toxic nitrosamine than for the moderately toxic styrene due to more rapid reactive metabolite-DNA adduct formation. Results were consistent with reported in vivo TD(50) data for the formation of liver tumors in rats. Analogous polyion/ liver microsome films prepared on 500 nm silica nanoparticles (nanoreactors) and reacted with nitrosamine or styrene, provided LC-MS or GC analyses of metabolite formation rates that correlated well with sensor response.

Electrical and interface properties of Au/DNA/ n-Si organic-on-inorganic structures

The effect of the thickness and coverage rate of a DNA film on the electrical and interface properties of Au/DNA/ n-Si organic-on-inorganic structures has been investigated. The thin film properties of the DNA deposited on n-Si wafer were characterized by atomic force microscopy. The effect of the thickness and coverage rate of the DNA layer was investigated by evaluating electrical parameters, such as the barrier height, ideality factor, series resistance, and interface state density. The thickness and coverage rate of the DNA layer significantly affects the electrical properties of the Au/DNA/ n-Si organic-on-inorganic structures. The interface state density properties of the Au/DNA/ n-Si diodes were determined by conductance technique. The results show that the interface state density decreases with decrease in both film thickness and coverage rate of the DNA in an acetate buffer, modifying the electronic parameters of the Au/DNA/ n-Si diodes.

Detection of DNA π-Stack Lesions Using Scanning Electrochemical Microscopy

The Scanning electrochemical microscopy (SECM) is used to selectively detect intervening mismatches and abasic sites within monolayers of ds-DNA self-assembled onto gold electrodes. The electrocatalytic cycle involving oxidation of leucomethylene blue (LB), an electrochemically reduced form of methylene blue intercalated within the ds-DNA monolayer self-assembled on gold electrode, by the SECM tip-generated ferricyanide allows regeneration of LB via long-range heterogenous electron transfer mediated by the DNA π-stack. Monolayers featuring disruptions in the DNA π-stack via a single-base mismatch or abasic site exhibit strongly attenuated methylene blue electrochemistry within the DNA film leading to a disruption of the catalytic cycle, thereby diminishing the SECM tip current. The inherent differences in catalytic tip currents can be used to distinguish monolayer domains containing native ds-DNA versus ds-DNA containing π-stack lesions within the micron-level lateral spatial resolution of SECM.

Interaction of metal ions and DNA films on gold surfaces: an electrochemical impedance study

Electrochemical impedance spectroscopy (EIS) has been used to investigate the effects of a number of metal ions with DNA films on gold surfaces exploiting [Fe(CN)6](3-/4-) as a solution-based redox probe. Alkaline earth metal ions Mg2+, Ca2+, trivalent Al3+, La3+ and divalent transition metal ions Ni2+, Cu2+, Cd2+ and Hg2+ have been selected in this study and the results are compared with previous studies on the effects of Zn2+ on the EIS of DNA films. All experimental results were evaluated with the help of equivalent circuits which allowed the extraction of resistive and capacitive components. For all metal ions studied here, addition of the metal ions causes a decrease in the charge transfer resistance. The difference of charge transfer resistance (DeltaR(ct)) of ds-DNA films in the presence and absence of the various metal ions is different and particular to any given metal ion. In addition, we studied the EIS of ds-DNA films containing a single A-C mismatch in the presence and absence of Ca2+, Zn2+, Cd2+ and Hg2+. DeltaR(ct) values for ds-DNA films with a single A-C mismatch is smaller than those of fully matched ds-DNA films.

Quasi-reversible electrochromic behavior of alkyl viologens dispersed mono-molecularly in double-stranded DNA chains

We study the electrochromic response of N,N′-diheptyl-4,4′-bipyridinium dibromide (heptyl viologen, HV) incorporated mono-molecularly into DNA minor grooves. DNA in which Na+ cations have been substituted by 1-dodecyl-3-methylimidazolium (C12MIDNA) was prepared and cast as a thin film on an ITO glass electrode. HV was then introduced into the DNA film by soaking. HV was introduced (ca. 20%) to the DNA base-pairs after soaking for 60 min. The resulting HV introduced DNA film was used to prepare electrochromic cells. The cell showed reversible colour change of monomeric HV, depending on the applied potential. For this HV introduced DNA cell, N,N,N′,N′-tetramethyl-p-phenylenediamine was introduced as an active material at the counter electrode to realise a reversible colour change at ±0.7 V.

LET dependence of the yield of DNA strand breaks and base lesions induced in fully hydrated plasmid DNA films by ion particles

LET dependence of the yield of DNA strand breaks and base lesions induced in fully hydrated plasmid DNA films by ion particles

Scanning Electrochemical Microscopy of DNA Monolayers Modified with Nile Blue

Scanning electrochemical microscopy (SECM) is used to probe long-range charge transport (CT) through DNA monolayers containing the redox-active Nile Blue (NB) intercalator covalently affixed at a specific location in the DNA film. At substrate potentials negative of the formal potential of covalently attached NB, the electrocatalytic reduction of Fe(CN)6(3-) generated at the SECM tip is observed only when NB is located at the DNA/solution interface; for DNA films containing NB in close proximity to the DNA/electrode interface, the electrocatalytic effect is absent. This behavior is consistent with both rapid DNA-mediated CT between the NB intercalator and the gold electrode as well as a rate-limiting electron transfer between NB and the solution phase Fe(CN)6(3-). The DNA-mediated nature of the catalytic cycle is confirmed through sequence-specific and localized detection of attomoles of TATA-binding protein, a transcription factor that severely distorts DNA upon binding. Importantly, the strategy outlined here is general and allows for the local investigation of the surface characteristics of DNA monolayers both in the absence and in the presence of DNA binding proteins. These experiments highlight the utility of DNA-modified electrodes as versatile platforms for SECM detection schemes that take advantage of CT mediated by the DNA base pair stack.

A Quartz Crystal Microbalance Study of Polycation-Supported Single and Double Stranded DNA Surfaces

A quartz crystal microbalance with dissipation monitoring (QCM-D) was used to investigate the properties and formation of a genomic mammalian DNA surface on a polycationic poly(ethylenimine) (PEI) film. We show that both single- and double-stranded DNA films can be deposited on the PEI surface by modulating the DNA adsorption time. The two distinct DNA surfaces can be confirmed by their interactions with urea, a common DNA denaturant, and ethidium bromide, a common DNA intercalator, both of which lead to characteristic changes in the QCM-D frequency and dissipation. The hybridization process between surface-bound single-stranded DNA to complementary strands in solution can be resolved in real-time. Moreover, we have also investigated the effects of incorporating NaCl in the various PEI-DNA assemblies and have shown that higher ionic strengths lead to greater DNA adsorption to the PEI surface. An increase in the QCM-D resonant frequency and a decrease in dissipation occur when these assemblies are rinsed with salt-free water. We interpret these changes as a loss of counterions from the film and an increase in intrinsic ion-pair complexation, leading to a more rigid PEI-DNA assembly. Varying the salt content in the DNA film can be used to control the film thickness and morphology.

Gene delivery in vitro and in vivo from bioreducible multilayered polyelectrolyte films of plasmid DNA

Layer-by-layer (LbL) films were assembled on flexible stainless steel substrate using plasmid DNA and reducible hyperbranched poly(amido amine) (RHB) polycation. The films were characterized by XPS and their disassembly in reducing conditions confirmed by ellipsometry. Fibroblast and smooth muscle cell attachment and proliferation on DNA/RHB films were indistinguishable from those on control DNA/poly(ethylenimine) (PEI) films. In vitro transfection activity was evaluated using reporter plasmids encoding for secreted alkaline phosphatase (SEAP) and green fluorescent protein (GFP). DNA/RHB films showed higher and longer lasting transfection activity than control DNA/PEI films using SEAP plasmid. It was revealed through the use of GFP plasmid that DNA/RHB films transfected almost the entire cell population growing on the films. In vivo transfection activity was evaluated by subcutaneously implanting a stainless steel substrate coated with the DNA/RHB films containing SEAP plasmid DNA and measuring the levels of SEAP secreted into the blood circulation of rats. It was found that the plasma levels of SEAP peaked at ∼160 ng SEAP/mL five days post-implantation.

Direct write electron beam patterning of DNA complex thin films

The authors report on the first use of direct write electron beam lithography (DW-EBL) patterning of DNA-based materials. Water insoluble and organic solvent soluble DNA:CTMA complexes were formed by reaction of DNA polymers with cationic surfactants and other molecular species. Thin films with thicknesses ranging from 85 to 300 nm were prepared by spin coating. DW-EBL was conducted using a Raith 150 system. The resulting exposed areas demonstrated either positive or negative resist properties depending on development solution. The characteristics of the DNA:CTMA material as a patternable electron sensitive resist medium are presented for different exposure conditions (10–30 kV), development conditions, structure sizes (100 nm to 20 μm), and structure complexities. Contrast values of ∼2 have been obtained in both positive and negative resist modes. Both simple (20 μm diameter circle and square) and complex (Fresnel lens) patterns with nanometer scale features (<100 nm) in DNA films are possible using this method.

DNA−Cyclodextrin Composite Material for Environmental Applications

Recently, we prepared water-insoluble and nuclease-resistant DNA films by UV irradiation. The DNA films accumulated the harmful DNA-intercalating compounds, such as ethidium bromide and acridine orange. Additionally, the water-insoluble DNA films bound endocrine disruptors that had planar structures, such as dioxin derivatives, polychlorobiphenyl (PCB) derivatives, and benzo[a]pyrene. However, other harmful endocrine disruptors that lack a planar structure, such as bisphenol A and diethylstilbestrol, did not bind the water-insoluble DNA films. Therefore, we prepared the DNA-cyclodextrin composite material by mixing the DNA and the cyclodextrin-immobilized poly(allylamine) (PCD). As a result, these composite materials had properties of both the double-stranded DNA, such as intercalation, and the cyclodextrin, such as encapsulation of an organic molecule into the intramolecular cavity. Therefore, these materials could accumulate not only the harmful compounds with planar structures but also the nonplanar molecules, such as bisphenol A, diethylstilbestrol, and nonylphenol. These DNA-PCD composite materials may have the potential to be novel environmental materials that absorb harmful compounds.

Manipulating the Salt and Thermal Stability of DNA Multilayer Films via Oligonucleotide Length

DNA films are promising materials for diverse applications, including sensing, diagnostics, and drug/gene delivery. However, the ability to tune the stability of DNA films remains a crucial aspect for such applications. Herein, we examine the role of oligonucleotide length on the formation, and salt and thermal stability, of DNA multilayer films using oligonucleotides of homopolymeric diblocks (polyAG and polyTC), with each block (A, G, T, or C) ranging from 5 to 30 bases (10-, 20-, 30-, 40-, and 60-mer). Using a combination of quartz crystal microgravimetry, dual polarization interferometry, and flow cytometry, we demonstrate that at least 10 bases per hybridizing block in the DNA diblocks (that is, 20-mer) are required for successful hybridization and, hence, DNA multilayer film formation. Films assembled using longer oligonucleotide blocks were more stable in low salt conditions, with the DNA multilayer films assembled from the 60-mer oligonucleotides remaining intact in solutions of about 25 mM NaCl. A systematic increase in film melting temperature ( T m) was observed for the DNA multilayer films (assembled on colloids) with increasing oligonucleotide length, ranging from 38.5 degrees C for the 20-mer films to 53 degrees C for the 60-mer films. Further, an alternating trend in T m of the DNA multilayer films was observed with layer number (AG or TC); DNA multilayer films terminated with an AG layer exhibited a higher T m (44-49 degrees C) than films with an outermost TC layer (ca. 38 degrees C), suggesting a rearrangement of the film structure upon hybridization of the outermost layer. This work shows that the stability of DNA multilayer films can be tuned by varying the length of the oligonucleotide building blocks, thus providing a versatile means to tailor the salt and thermal stability of DNA films, which is necessary for the application of such films.

Sum-frequency-generation spectroscopy of DNA films in air and aqueous environments

Understanding the organization and orientation of surface-immobilized single stranded DNA (ssDNA) in aqueous environments is essential for optimizing and further developing the technology based on oligonucleotide binding. Here the authors demonstrate how sum-frequency-generation (SFG) spectroscopy can be used to compare the structure and orientation of model monolayers of ssDNA on gold in air, D(2)O, and phosphate buffered saline (PBS) solution. Films of adenine and thymine homo-oligonucleotides showed significant conformational changes in air versus aqueous environments in the CH stretching region. The thymine films showed changes between D(2)O and PBS solution, whereas the SFG spectra of adenine films under these conditions were largely similar, suggesting that the thymine films undergo greater conformational changes than the adenine films. Examination of thymine films in the amide I vibrational region revealed that molecules in films of nonthiolated DNA were lying down on the gold surface whereas molecules in films of thiol-linked DNA were arranged in a brushlike structure. Comparison of SFG spectra in the amide I region for thiol-linked DNA films in air and D(2)O also revealed substantial conformational changes.