DNA Barcoding Tool Research Articles

Effects of macroalgal morphology on marine epifaunal diversity

AbstractMacroalgae play important ecological roles, including as hosts for a wide range of epifauna. However, the diversity relationships between macroalgae and epifauna are poorly understood for most tropical host species and algal morphologies. This study aims to characterize and analyse the diversity of invertebrates present amongst macroalgae with three distinct morphologies (three-dimensional, filamentous and foliose) across different tropical intertidal sites in Singapore. Morphological and DNA barcoding tools were employed for epifaunal species identification, and ordination statistics and multiple linear regression were used to test the effects of algal morphology, species and site on community structure and diversity of epiphytic invertebrates. Overall, epifaunal communities were distinct among sites and algal morphologies, and diversity was affected significantly by algal morphology. In particular, filamentous macroalgae hosted the highest abundance of epifauna dominated mainly by amphipods, which were able to take advantage of the high surface area to volume ratio in filamentous algal mats as a consequence of their thinner forms. Foliose species showed a significantly negative effect on invertebrate diversity. Our findings highlight the diverse associations between intertidal macroalgae and invertebrates with high turnover between algal morphology and sites that contribute to the high biodiversity of tropical shores. Future studies should consider the effects of the host habitat, seasonality and more algal species on epifaunal diversity.

DNA barcoding of commercially important snapper species (Lutjaniformes; Lutjanidae; Lutjanus) from Visakhapatnam, Central Eastern coast of India

Snappers are commercially important fishes in Indian waters, currently belonging to the order Lutjaniformes, family Lutjanidae. Generally, recognizing species of Lutjanus is a challenging task not only because of overlapping morphological characters, such as shapes, size groups, or colour patterns, but also based on the definition of the species concept or the definition of the threshold for speciation. In India there has not been any updated and accurate study of the genus so far. Besides, identification of the group based on ecological aspects and DNA barcoding tools were confined to limited laboratories. In the present study, ten species of snappers were identified from samples obtained from the major fish landing centres in the Visakhapatnam, Central Eastern coast of India. Snapper species were identified using COI (Cytochrome oxidase I) sequences for DNA barcoding. The validity of the conjecture species-level taxonomy based on COI is assisted with high equivalence search (98–100%) both in BOLD and BLAST, well-distributed genetic distance values.

The DNA Barcoding of Several Commercial Fish from Simeulue Islands Coast of Aceh Using Cytochrome Oxidase Sub Unit I (COI) Gene Marker

Simeulue is a cluster of islands that rich of commercial fisheries in Aceh waters. Management of the fisheries products is highly related to species identification in order to ascertain the appropriate steps to manage the resources sustainably. Identification using DNA barcoding tools is the right answer for the problem that have not been able to be resolved even by morphological approach. Some of 11 individual samples were taken from 6 sampling points based on lobster’s catchment and cultivation areas. All of the samples were identified using COI mitochodrial DNA resulting 6 species including Scomber scombus, Scomberomorus plurilineatus, Octopus cyanea, Taeniura Lymna, Sympterygia bonapartii and Panulirus versicolor. The DNA bases were aligned using MEGA application and Neigbour- Joining method, Kimura 2 parameters resulting a 690 base pairs nucleotides. Reconstruction of philogenetic tree shows that the species of Simeulue were conjoined into one clade with the sequences downloaded from genebank. It shows that those species were closely related genetically indicating by the bootstrap value of Scomber scombus (100), Scomberomorus plurilineatus (100), Octopus cyanea (100). The results of the study shows that the DNA barcoding tools can explicate not only the identification up to the species level but also the genetic relationship that can be seen from the interspecies bases composition.

Pet and turtle: DNA barcoding identified twelve Geoemydid species in northeast India

Geoemydid turtles are one of the most imperilled fauna on the planet, with nearly half of them are threatened with extinction due to bushmeat crisis, traditional medicine, and the illegal pet trade. Classical taxonomy often fails to identify the pet-kept turtle specimens due to amorphous form, unusual shell colouration owing to poor storage in captivity or intensely tinted for high demanding value. The DNA barcoding technique has evidenced as a supportive tool for accurate species identification in systematics research and discerned the nameless taxa in forensic sciences. We tested the effectiveness of DNA barcoding tools for identifying the pet-kept Geoemydid turtle in northeast India. The 36 generated sequences are readily delineated into 12 Geoemydid species using molecular data. The overall mean genetic distance of the studied Geoemydid turtles dataset is 15.3% and ranges from 3.4% to 22.6% between the species. The NJ, ML and Bayesian phylogeny also resulted monophyletic clustering and discriminated all the studied species. The present study contributes DNA barcode sequences of Geoemydid turtles in the global database and also affirms the on-going illegal pet trade of highly threatened species in northeast India.

Rapid assessment of non-indigenous species in the era of the eDNA barcoding: A Mediterranean case study

With only a narrow opening through the Gibraltar and Suez Canals, the Mediterranean Sea is one of the largest semi-enclosed seas. The marine flora and fauna are some of the richest in the world, relative to its size, particularly in the coastal habitats, which are also characterized by numerous endemic species although the introduction of non-indigenous species threatens its rich and unique biodiversity. Following the opening of the Suez Canal, and in combination with shipping and aquaculture activities, non-indigenous species (NIS) introduction has had measurable impacts on the Mediterranean. Lagoon ecosystems along the French coastline, with approx. 100 NIS identified, are considered hot-spot areas for these species. Rapid assessment sampling for sessile benthic species together with DNA barcoding is a rapid, easy and cheap method to detect non-indigenous species. Two nearby and different ecosystems were sampled for invertebrate species: Saint-Nazaire lagoon, a Special Protection Area within the Natura 2000 Network and Canet port, a marina in a small village. The DNA barcoding tool for species identification was used for confirming the taxonomy. This showed that, despite the Saint-Nazaire Lagoon classification within the Natura 2000 network, it is already contaminated with a single NIS that was found in high densities and is clearly beginning to dominate the system. It is proposed that a rapid assessment of the sampled environment and the DNA barcode approach are efficient and can provide sufficient information on the new target species to be used in conservation planning and ongoing management efforts.

Identification and genetic diversity analysis of Memecylon species using ISSR, RAPD and Gene-based DNA barcoding tools

Background : Memecylon species are commonly used in Indian ethnomedical practices. The accurate identification is vital to enhance the drug's efficacy and biosafety. In the present study, PCR based techniques like RAPD, ISSR and DNA barcoding regions, such as 5s, psb A -trn H, rpo C1, ndh and atp F -atp H, were used to authenticate and analyze the diversity of five Memecylon species collected from Western Ghats of India. Results: Phylogenetic analysis clearly distinguished Memecylon malabaricum from Memecylon wightii and Memecylon umbellatum from Memecylon edule and clades formed are in accordance with morphological keys. In the RAPD and ISSR analyses, 27 accessions representing five Memecylon species were distinctly separated into three different clades. M. malabaricum and M. wightii grouped together and M. umbellatum , M. edule and Memecylon talbotianum grouped in the same clade with high Jaccard dissimilarity coefficient and bootstrap support between each node, indicating that these grouped species are phylogenetically similar. Conclusion: Data from the present study reveals that chloroplast psb A -trn H region could be used as a potential candidate region for identifying Memecylon species, and ISSR marker system could be used for estimating genetic diversity since it has high percent polymorphism compared to RAPD marker. Normal 0 21 false false false EN-IN X-NONE X-NONE st1\:*{behavior:url(#ieooui) } /* Style Definitions */ table.MsoNormalTable {mso-style-name:Tabla normal; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-parent:; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin-top:0cm; mso-para-margin-right:0cm; mso-para-margin-bottom:10.0pt; mso-para-margin-left:0cm; line-height:115%; mso-pagination:widow-orphan; font-size:11.0pt; font-family:Calibri,sans-serif; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-ansi-language:EN-IN; mso-fareast-language:EN-US;}

Species differentiation of the rock lizard Darevskia (caucasica) complex (by DNA-barcoding data, cytochrome oxydase subunit I sequences)

The results of molecular genetic analysis of phylogenetic relationships in Darevskia (caucasica) on the basis of COI sequences variability is presented. Two main lineages are detected: the Central and Eastern Caucasian (clades A–B — D. caucasica-D. daghestanica), and Central and Western Caucasian (clades C–D — D. alpina). A DNA-barcoding tool can be successfully used for species identification of D. alpina, D. caucasica and D. daghestanica. Refs 19. Figs 2. Tables 2.

International Society of Human and Animal Mycology (ISHAM)-ITS reference DNA barcoding database--the quality controlled standard tool for routine identification of human and animal pathogenic fungi.

Human and animal fungal pathogens are a growing threat worldwide leading to emerging infections and creating new risks for established ones. There is a growing need for a rapid and accurate identification of pathogens to enable early diagnosis and targeted antifungal therapy. Morphological and biochemical identification methods are time-consuming and require trained experts. Alternatively, molecular methods, such as DNA barcoding, a powerful and easy tool for rapid monophasic identification, offer a practical approach for species identification and less demanding in terms of taxonomical expertise. However, its wide-spread use is still limited by a lack of quality-controlled reference databases and the evolving recognition and definition of new fungal species/complexes. An international consortium of medical mycology laboratories was formed aiming to establish a quality controlled ITS database under the umbrella of the ISHAM working group on "DNA barcoding of human and animal pathogenic fungi." A new database, containing 2800 ITS sequences representing 421 fungal species, providing the medical community with a freely accessible tool at http://www.isham.org/ and http://its.mycologylab.org/ to rapidly and reliably identify most agents of mycoses, was established. The generated sequences included in the new database were used to evaluate the variation and overall utility of the ITS region for the identification of pathogenic fungi at intra-and interspecies level. The average intraspecies variation ranged from 0 to 2.25%. This highlighted selected pathogenic fungal species, such as the dermatophytes and emerging yeast, for which additional molecular methods/genetic markers are required for their reliable identification from clinical and veterinary specimens.

Q-bank phytoplasma: a DNA barcoding tool for phytoplasma identification.

DNA barcoding is an identification method based on comparison of a short DNA sequence with known sequences from a database. A DNA barcoding tool has been developed for phytoplasma identification. This phytoplasma DNA barcoding protocol based on the tuf gene has been shown to identify phytoplasmas belonging to the following groups: 16SrI, 16SrII, 16SrIII, 16SrIV, 16SrV, 16SrVI, 16SrVII, 16SrIX, 16SrX, 16SrXI, 16SrXII, 16SrXIV, 16SrXX, and 16SrXXI.

A tiered barcode authentication tool to differentiate medicinal Cassia species in India.

DNA barcoding is a desirable tool for medicinal product authentication. DNA barcoding is a method for species identification using short DNA sequences that are conserved within species, but variable between species. Unlike animals, there is no single universal DNA barcode locus for plants. Coding markers, matK and rbcL, and noncoding markers, trnH-psbA (chloroplast) and ITS2 (nuclear), have been reported to be suitable for the DNA barcoding of plants with varying degree of success. Sixty-four accessions from 20 species of the medicinal plant Cassia were collected, and analyzed for these 4 DNA barcoding markers. PCR amplification was 100% successful for all 4 markers, while intra-species divergence was 0 for all 4 Cassia species in which multiple accessions were studied. Assuming 1.0% divergence as the minimum requirement for discriminating 2 species, the 4 markers could only differentiate 15 to 65% of the species studied when used separately. Adding indels to the divergence increased the percentage of species discrimination by trnH-psbA to 90%. In 2-locus barcoding, while matK+rbcL (which is recommended by Consortium for the Barcoding of Life) discriminated 90% of the species, the other combinations of matK+ITS and rbcL+trnH-psbA showed 100% species discrimination. However, matK is plagued with primer issues. The combination of rbcL+trnH-psbA provided the most accurate (100% species ID) and efficient tiered DNA barcoding tool for the authentication of Cassia medicinal products.

A comparative study of different DNA barcoding markers for the identification of some members of Lamiacaea

The objective of the present work is to evaluate the efficacy of a DNA barcoding approach as a tool for the recognition of commercial kitchen spices belonging to the Lamiaceae family that are usually sold as enhancers of food flavor. A total of 64 spices samples, encompassing six different genera (i.e. Mentha, Ocimum, Origanum, Salvia, Thymus and Rosmarinus) were processed with a classical DNA barcoding approach by amplifying and sequencing four candidate barcode regions (rpoB, rbcL, matK and trnH-psbA) with universal primers. Results suggest that the non-coding trnH-psbA intergenic spacer is the most suitable marker for molecular spices identification followed by matK, with interspecific genetic distance values ranging between about 0% to 7% and 0% to 5%, respectively. Both markers were almost invariably able to distinguish spices species from closest taxa with the exclusion of samples belonging to the genus Oregano. Moreover, in a context of food traceability the two markers are useful to identify commercial processed spice species (sold as dried plant material). We also evaluated the potential benefits of a multilocus barcode approach over a single-marker and although the most suitable combination was the matK + trhH-psbA, the observed genetic distances values were very similar to the discriminatory performance of the trnH-psbA. Finally, this preliminary work provide clear evidences that the efficacy of a DNA barcoding approach to the recognition of commercial spices is biased by the occurrence of taxonomic criticisms as well as traces of hybridization events within the family Lamiaceae. For this reason, to better define a more practical and standardized DNA barcoding tool for spices traceability, the building of a dedicated aromatic plants database in which all species and cultivars are described (both morphologically and molecularly) is strongly required.

Assessing species admixtures in raw drug trade of Phyllanthus, a hepato-protective plant using molecular tools

Ethnopharmacological relevance Phyllanthus (Euphorbiaceae) species are well known for their hepato-protective activity and are used in several ethno-medicines in indigenous health care systems in India. Aim of the study To assess species admixtures in raw drug trade of Phyllanthus using morphological and DNA barcoding tools. Materials and methods Samples of Phyllanthus used in raw drug trade were obtained from 25 shops in southern India. Species admixtures in the samples were assessed by identifying species using morpho-taxonomic keys. These identities were further validated by developing species specific DNA barcode signatures using the chloroplast DNA region, psbA-trnH. DNA from the market samples were extracted and amplified using the forward ( psbAF – GTTATGCATGAACGTAATGCTC) and reverse primer ( trnHR – CGCGCATGGTGGATTCACAAATC). The amplified products were sequenced at Chromous Biotech India, Bangalore. The sequences were manually edited using Chromas Lite. Species identities were established by constructing a neighbor-joining tree using MEGA V 4.0. Results Morphological analysis of market samples revealed six different species of Phyllanthus in the trade samples. Seventy-six percent of the market samples contained Phyllanthus amarus as the predominant species (>95%) and thus were devoid of admixtures. The remaining 24% of the shops had five different species of Phyllanthus namely Phyllanthus debilis, Phyllanthus fraternus, Phyllanthus urinaria, Phyllanthus maderaspatensis, and Phyllanthus kozhikodianus. All identities, except those for Phyllanthus fraternus, were further confirmed by the species specific DNA barcode using chloroplast region psbA-trnH. Conclusion Our results show that market samples of Phyllanthus sold in southern India contain at least six different species, though among them, Phyllanthus amarus is predominant. DNA barcode, psbA-trnH region of the chloroplast can effectively discriminate Phyllanthus species and hence can be used to resolve species admixtures in the raw drug trade of Phyllanthus.

Disentangling Vector-Borne Transmission Networks: A Universal DNA Barcoding Method to Identify Vertebrate Hosts from Arthropod Bloodmeals

Emerging infectious diseases represent a challenge for global economies and public health. About one fourth of the last pandemics have been originated by the spread of vector-borne pathogens. In this sense, the advent of modern molecular techniques has enhanced our capabilities to understand vector-host interactions and disease ecology. However, host identification protocols have poorly profited of international DNA barcoding initiatives and/or have focused exclusively on a limited array of vector species. Therefore, ascertaining the potential afforded by DNA barcoding tools in other vector-host systems of human and veterinary importance would represent a major advance in tracking pathogen life cycles and hosts. Here, we show the applicability of a novel and efficient molecular method for the identification of the vertebrate host's DNA contained in the midgut of blood-feeding arthropods. To this end, we designed a eukaryote-universal forward primer and a vertebrate-specific reverse primer to selectively amplify 758 base pairs (bp) of the vertebrate mitochondrial Cytochrome c Oxidase Subunit I (COI) gene. Our method was validated using both extensive sequence surveys from the public domain and Polymerase Chain Reaction (PCR) experiments carried out over specimens from different Classes of vertebrates (Mammalia, Aves, Reptilia and Amphibia) and invertebrate ectoparasites (Arachnida and Insecta). The analysis of mosquito, culicoid, phlebotomie, sucking bugs, and tick bloodmeals revealed up to 40 vertebrate hosts, including 23 avian, 16 mammalian and one reptilian species. Importantly, the inspection and analysis of direct sequencing electropherograms also assisted the resolving of mixed bloodmeals. We therefore provide a universal and high-throughput diagnostic tool for the study of the ecology of haematophagous invertebrates in relation to their vertebrate hosts. Such information is crucial to support the efficient management of initiatives aimed at reducing epidemiologic risks of arthropod vector-borne pathogens, a priority for public health.