Distinct Cell Types Research Articles

Conditioned medium of induced pluripotent stem cell derived neuromesodermal progenitors enhances cell migration in vitro.

Identification of novel cell-based therapy sources has been of great interest in recent years to provide alternative and available therapy options in clinics. Conditioned medium (CM) can be a valuable supply for growth factors, cytokines and chemokines as a source of stem cell secretome. Exploring the role of new CM sources for tissue regeneration might be a promising approach for therapeutic purposes. In the current study, neuromesodermal progenitors (NMPs) derived from induced pluripotent stem cells (iPSCs) were used to collect CM. Fibroblast derived iPSCs were successfully differentiated into NMPs and NMPs were characterized by double positive T/Bra and Sox2 staining. CM was collected from NMPs, and the content was characterized by membrane analysis. In vitro wound healing assay was used as a model system to observe potential activity of CM on cell migration. Fibroblasts, keratinocytes and endothelial cells were used to evaluate the effect of NMP-derived CM (NMP-CM) on cell migration in vitro. Several important proteins related to wound healing such as ANGPT 1, ANGPT 2, MCP-1, PDGF-AA, SDF-1α, TIMP-1 and TIMP-2 were increased in NMP-CM. NMP-CM increased cell proliferation and migration in vitro. In vitro data obtained from three distinct cell types suggest a promising role of NMP-CM on cell migration. NMP-CM can be used for wound management in the further future after detailed in vitro and in vivo research.

Abstract 3668: Plasma cell-free DNA profiling for deciphering cellular origins and immune competence in cancer patients

Abstract Plasma cell-free DNA (cfDNA) originates from apoptotic cells in the blood, providing a real-time insight into the biology of various cell types. The fragment coverage pattern of cfDNA across the genome is known to reflect the distinct chromatin status of originating cells. While extensive research has focused on fragments derived from cancer, known as circulating tumor DNA (ctDNA), for inference about cancer biology, cfDNA fragments from healthy cells have received little attention. Our study explores the potential of cfDNA to decipher the relative abundance of distinct blood cell types, particularly immune system cell types. We collected a cohort of 273 bladder (BC) and colorectal cancer (CRC) patients and 45 healthy controls for plasma whole genome sequencing and assessed the fragment coverage profile at transcription start sites (TSS) of protein coding genes. A significant negative correlation was observed between TSS coverage and whole blood gene expression (Spearman’s rho = -0.65). Furthermore, TSS coverage revealed a bimodal distribution, characterized by modes corresponding to high and low gene expression levels in blood cells. This may suggest the cfDNA coverage profile as a binary expression status classifier to distinguish between expressed and unexpressed genes in blood cells. We further evaluated TSS with differential coverage between age groups of healthy individuals and relapse status of cancer patients. Notably, out of the TSS that significantly differentiated middle-aged (aged 40-65) from older individuals (aged 65+), 31 were also able to distinguish relapse from non-relapse patients. Among these TSS were CD36, SLAMF7, TABBP and PDCD1, known to be involved in immune related pathways. Finally, we evaluated coverage at cell-type specific TSS and found dendritic cells (P-value: CRC = 8e-06, BC = 5.1e-3), monocytes (CRC = 1.6e-04, BC = 2.5e-3), and NK cells (CRC = 8.5e-04, BC = 0.026) to exhibit a significant increase in coverage in the cancer cohorts compared to healthy controls. Conversely, T-cells showed a decrease in coverage (CRC = 0.041, BC = 0.062). In conclusion, cfDNA coverage profile may identify TSS with differential coverage between patient groups and characterize a shift in blood cell type composition as a response to cancer. Future work may show if fragment coverage quantifies the relative contribution of cfDNA from distinct immune cell types. We anticipate our analysis to illuminate the utility of plasma cfDNA as a biomarker for cancer patient’s immune competency, enabling improved patient stratification for treatment, leveraging their distinct immune capabilities. Citation Format: Laura Andersen, Amanda Frydendahl, Tenna Vesterman Henriksen, Christina Demuth, Mads Heilskov Rasmussen, Iver Nordentoft, Karin Birkenkamp-Demtröder, Jakob Skou Pedersen, Søren Besenbacher, Lars Dyrskjøt, Claus L. Andersen, Nicolai J. Birkbak. Plasma cell-free DNA profiling for deciphering cellular origins and immune competence in cancer patients [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 3668.

Abstract 6405: Identification of molecular targets in bladder cancer variants using single-cell analysis

Abstract Introduction and objectives: Variant subtypes in bladder cancer, also known as histologic variants, are clinically aggressive tumors associated with poor prognosis. The rarity of these tumors has made molecular characterization elusive using bulk transcriptional profiling. The aim of this study was to use single cell RNA sequencing to identify molecular features associated with variant subtypes that could be potential targets for therapy. Methods: Fresh tissue from bladder cancer patients undergoing surgery at our institution was sequenced using a bead-based single-cell RNA sequencing platform (Seq-Well) to generate an atlas of 9 tumors containing variants (micropapillary, nested, squamous differentiation, pleomorphic giant-cell like, plasmacytoid, small cell) and 3 tumors with pure urothelial carcinoma (UC) histology. Pathologic diagnoses were independently confirmed. Analysis was performed using the Seurat package in R Studio. Immunostaining validation was performed on a separately banked cohort. Bulk RNA sequencing data and clinical data were extracted and analyzed from The Cancer Genome Atlas (TCGA) database. Chimeric Antigen Receptor (CAR) T cells targeting TM4SF1 were generated by lentiviral transduction of primary human T cells and tested against publicly available bladder cancer cell lines. Results: Variant tumors were enriched in TM4SF1, a surface molecule that we demonstrate to be susceptible to CAR T therapy in vitro. Variants also share a cell state characterized by highly specific expression of MUC16 (CA125), which is enriched in metastatic sites, harbors transcriptional hallmarks of epithelial-mesenchymal transition and luminal-basal plasticity, and is associated with poor survival and resistance to chemotherapy. Finally, we find evidence of transcriptional mimicry between variants and similar appearing non-urothelial cells (e.g. plasmacytoid:plasma cell), suggesting common pathways between distinct cell types that could be exploited. Conclusion: We have identified several targetable molecular features within variant bladder cancer subtypes. These findings set a critical starting point for future therapeutic investigation. Funding: California Urology Foundation (HY)Conflicts of interest: noneKeywords: Single cell analysis, bladder cancer, variants, genomics, biomarkers Citation Format: Heiko Yang, Hanbing Song, Paul Allegakoen, Kevin Lu, Elizabeth Yip, Keliana Hui, Kevin Chang, Corynn Kasap, Janae Gayle, Bradley Stohr, Arun Wiita, Chien-Kuang C. Ding, Maxwell V. Meng, Jonathan Chou, Sima P. Porten, Franklin W. Huang. Identification of molecular targets in bladder cancer variants using single-cell analysis [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 6405.

Graded FGF activity patterns distinct cell types within the apical sensory organ of the sea anemone Nematostella vectensis

Bilaterian animals have evolved complex sensory organs comprised of distinct cell types that function coordinately to sense the environment. Each sensory unit has a defined architecture built from component cell types, including sensory cells, non-sensory support cells, and dedicated sensory neurons. Whether this characteristic cellular composition is present in the sensory organs of non-bilaterian animals is unknown. Here, we interrogate the cell type composition and gene regulatory networks controlling development of the larval apical sensory organ in the sea anemone Nematostella vectensis. Using single cell RNA sequencing and imaging approaches, we reveal two unique cell types in the Nematostella apical sensory organ, GABAergic sensory cells and a putative non-sensory support cell population. Further, we identify the paired-like (PRD) homeodomain gene prd146 as a specific sensory cell marker and show that Prd146+ sensory cells become post-mitotic after gastrulation. Genetic loss of function approaches show that Prd146 is essential for apical sensory organ development. Using a candidate gene knockdown approach, we place prd146 downstream of FGF signaling in the apical sensory organ gene regulatory network. Further, we demonstrate that an aboral FGF activity gradient coordinately regulates the specification of both sensory and support cells. Collectively, these experiments define the genetic basis for apical sensory organ development in a non-bilaterian animal and reveal an unanticipated degree of complexity in a prototypic sensory structure.

Abstract 2476: Electroporation-mediated novel albumin-fused Flt3L DNA delivery promotes cDC1-associated anticancer immunity

Abstract Introduction: Dendritic cells (DCs) constitute a distinct type of immune cell found within tumors, serving a central role in mediating tumor antigen-specific immunity against cancer cells. Frequently, DC functions are dysregulated by the immunosuppressive signals present within the tumor microenvironment (TME). Consequently, DC manipulation holds great potential to enhance the cytotoxic T cell response against cancer diseases. The Fms-like tyrosine kinase receptor 3 ligand (Flt3L) is a pluripotent growth factor that regulates the maturation and differentiation of DCs in hematopoiesis. The in vivo administration of Flt3L itself is limited by its short serum half-life. To overcome this major drawback, our group developed a novel fusion protein albumin-Flt3L (alb-Flt3L), which is the conjugation of albumin to Flt3L. Our hypothesis is that the Flt3L, which has extended bioavailability, is a feasible therapeutic strategy to overcome these treatment limitations. Method: A novel alb-Flt3L DNA, a plasmid encoding the alb-Flt3L protein, was administrated for its anti-tumor effect on TC-1 tumor-bearing C57BL/6 mice. For the generation of pcDNA3-albFlt3L, mouse Flt3 ligand was amplified by PCR using cDNA template of pcDNA3-Flt3L1 and a set of primers, 5′- TTTGAATTCGGGACACCTGACTGTTACTTC-3′ and 5′- AAACTTAAGCTACTGCCTGGGCCGAGGCTCTGG -3′. alb-Flt3L DNA (10ug), Flt3L DNA (10ug) or vehicle control was injected intratumorally followed by electroporation for a total of three times in 5-day intervals. Peripheral blood mononuclear cells and tumor-infiltrated immune cells were isolated after treatment. Flow cytometry was performed for immune cell analysis. Results: In this current study, the electroporation-mediated delivery of alb-Flt3L DNA demonstrated the ability to induce an anti-tumor immune response. This albumin fusion construct possesses more persistent bioactivity in targeted organs. Furthermore, mice receiving alb-Flt3L DNA treatment presented better tumor control and superior survival. Cellular analysis revealed that alb-Flt3L DNA administration displayed greater systemic DC population. In addition, robust cDC1 expansion, which is associated with superior antigen cross-presentation and cellular immunity against tumors, developed extensively in the tumor, lymph node, and blood. In addition, increased levels of IFN-γ-secreting CD8+ lymphocytes and tumor-infiltrated immune cells were found in correlation to greater cDC1 population. Conclusion: Our data showcases a novel DC-based immunotherapy using electroporation to administer alb-Flt3L DNA. The treatment effect is revealed by a controlled tumor response, characterized by enhanced DC mobilization and accumulation in both the lymph nodes and TME, coupled with an increase in the expansion of cDC1 subsets and a heightened level of CD8+ T cell activation. Citation Format: Ming-Hung Hu, Tzyy-Choou Wu, Chien-Fu Hung. Electroporation-mediated novel albumin-fused Flt3L DNA delivery promotes cDC1-associated anticancer immunity [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 2476.

Abstract 730: Leveraging microdissection for proteogenomic analysis of histological sections to advance drug development

Abstract Background: Combining proteogenomics with laser capture microdissection (LCM) in cancer research offers a targeted way to explore the intricate interactions between tumor cells and the tumor microenvironment. This is especially important for immuno-oncology (IO) research where improvements in the predictability of patient response to IO-based drugs is sorely needed. An improved understanding of the spatial relationships involving tumor cells proper, stromal cells, blood supply and immune cell interactions may help to inform drug development and improve the indicators of success for IO-based drug regimens. Methods: LCM is used to isolate and obtain distinct histological cell types from fresh frozen tissue. Once cells have been captured, nucleic acids and proteins are extracted for in-depth multi-modality molecular profiling assays involving multiple genomic modalities and a customized solution-based mass spectrometry proteomics approach for samples or specimens with a limited amount of tissue. Results: Optimizing analysis of minute tissue quantities from LCM captured cells is challenging. Following the isolation of nucleic acids, RNA-seq may be performed for gene expression and DNA sequencing performed for the discovery and analysis of actionable mutations, copy number variation, and methylation profiles. Regarding genomic-based studies, commercial kits are often utilized for these steps due to their general availability, rapid innovation, and the robust performance of these products. However, this kit-based adaptive approach is not true for proteomics. There remains a need for highly sensitive proteomic methods targeting small-sized samples. A significant part of our proteogenomics approach is focused around an enhanced liquid chromatography mass spectrometry (LC-MS) analysis of micro-scale and/or nano-scale tissue sections. This is achieved with a silver-stained one-dimensional sodium dodecyl sulfate polyacrylamide gel electrophoresis (1D-SDS-PAGE) approach developed for LC-MS analysis of fresh-frozen tissue specimens obtained via LCM. This includes an in-gel digestion method adjusted and specifically designed to maximize the proteome coverage from amount-limited LCM samples to better facilitate in-depth molecular profiling. Conclusions: Reported here is a proteogenomic approach that is leveraging from microdissected fresh frozen tissue. The methodology may also be applicable to other types of specimens having limited nucleic acids, protein quantity, and/or sample volume. Citation Format: Ik Jae Shin, Michael Tangrea, Michael R. Emmert-Buck, Donald J. Johann. Leveraging microdissection for proteogenomic analysis of histological sections to advance drug development [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 730.

Abstract 1881: Screening of Rac1 and Cdc42 inhibitors as anti-metastatic compounds

Abstract Metastasis is responsible for >90% of cancer-related deaths and is a key cause of failure of cancer therapy. The development of effective targeted therapy to prevent and treat metastasis has been challenging. Homologous Rho GTPases Rac and Cdc42 are viable metastasis targets because they have a crucial role in the signaling pathways that regulate cell survival, proliferation, and migration, so dysregulation of these proteins leads to cancer progression and metastasis of diverse cancer types. Therefore, targeting these regulatory proteins results in anticancer and antimetastatic activity, as observed with our dual Rac/Cdc42 inhibitor, MBQ-167, in triple-negative breast cancer. MBQ-167 has an IC50 of ~100nM for Rac and Cdc42 activation inhibition and a GI50 of 130nM. MBQ-167 inhibits the binding of guanine nucleotides to Rac and Cdc42 with similar efficacy. The purpose of this study was to identify MBQ-167 derivatives with similar or greater efficacy and specificity, with a range of inhibitory mechanisms, that may be specific to the different guanine nucleotide exchange factors expressed in distinct cancer cell types. Currently, over 30 different compounds with potential Rac1 and Cdc42 inhibitory activity are being evaluated. So far, some of the evaluated compounds have shown comparable GI50 values to MBQ-167 in metastatic breast cancer cell lines. From this screening, CPV-337 was selected as a compound with a GI50 of ~55nM and ~70% Rac activation inhibition at 50nM, therefore being 2X more effective than our leading compound MBQ-167. However, evaluation of CPV-337 in the viability of the MCF-10 non-tumorigenic epithelial cell line demonstrated a GI50 of ~63nM, which is similar to that of breast cancer cells. Therefore, CPV-337 may have cytotoxic effects on breast cancer. We are continuing to screen the library of MBQ-167 derivatives in breast, pancreatic, lung, and prostate cancer cell lines. Citation Format: Jessica Colón González, María C. Santa María Fuentes, Cornelis Vlaar, Suranganie Dharmawardhane. Screening of Rac1 and Cdc42 inhibitors as anti-metastatic compounds [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 1881.

Abstract 3877: Multi-modal analysis of paracrine signaling in group 3/4 medulloblastoma

Abstract Medulloblastoma (MB) is the most common primary brain malignancy in kids, with the group 3 and 4 subtypes (G3/4) being the most aggressive. Recent single-cell genomics studies have identified the G3/4 MB cell of origin and point to disrupted stem-cell differentiation as a key factor in MB pathogenesis. However, surprisingly little is known about the contribution of tumor-supportive paracrine signaling to the ontogeny of this disease. The spatial organization of MB cellular hierarchies is not completely understood. We profiled N=24 G3/4 MBs from UCSF patients via single-nucleus RNA sequencing (snRNA-seq). Of these cases, N=10 were profiled via single-cell assay for transposase-accessible chromatin by sequencing (scATAC-seq). To capture the spatial context, we profiled an additional 20 samples via spatial transcriptomics using the Visium and Xenium platforms. We found that the standard Xenium brain capture set was inadequate, and we developed a highly specific capture set for G3/4 MBs. In particular, our panel resolves cell-type differences in the stage of MB lineage commitment, from rhombic-lip progenitors to more differentiated unipolar brush-like cells. Altogether, over 110,000 nuclear-sequencing libraries and over 1,898,000 spatially-resolved single-cell libraries were generated. We inferred cell-cell communication signals from our snRNA-seq data by identifying co-expressed receptors and their cognate ligands. We then performed an integrated analysis of our snRNA-seq and scATAC-seq data to infer the cis-regulatory enhancers of those signaling genes, as well as the transcription factors that bind them. We employed our spatial transcriptomics data to confirm paracrine signaling networks inferred from nuclear-sequencing data. We found that distinct MB cell types corresponding to different stages of differentiation occupied specific spatial domains. The results of our ongoing analysis of this spatially-resolved single-cell atlas will be presented. This study paves the way for innovative therapeutic strategies targeting paracrine signaling in G3/4 MB. Citation Format: Bohyeon Yu, Jangham Jung, Aaron Diaz. Multi-modal analysis of paracrine signaling in group 3/4 medulloblastoma [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 3877.

Abstract 6654: Oncolytic virotherapy targeting high-grade glioma tumor antigens

Abstract Glioblastoma, the most common primary brain malignancy in adults, is an aggressive cancer with five-year median survival of ~6.8%. New treatment options are urgently needed for glioblastoma and other high-grade gliomas (HGGs). Oncolytic viruses (OVs) are an emerging class of cancer therapy currently being evaluated as treatments for a variety of malignancies, including glioblastoma. Our labs developed OV C134, now under evaluation in a phase I clinical trial of recurrent glioblastoma (NCT03657576). In addition to directly infecting and lysing tumor cells, OVs are capable of stimulating anti-tumor immune responses. We previously showed in the CT2A syngeneic mouse model of HGG that treatment with a version of C134 engineered to express the shared tumor antigen Ephrin-A2 (EPHA2; commonly upregulated in glioblastoma) significantly increased survival and produced EPHA2-specific T cell responses. This finding led us to hypothesize that C134 could be further engineered to stimulate antigen-specific immune responses against tumor-specific neoantigens. We first assessed the impact of C134 treatment on immune cell dynamics in HGGs, by performing single cell RNA sequencing of CD45+ immune cell infiltrate from CT2A HGGs treated with C134 or saline (control). Clustering of these data identified 17 distinct immune cell types, and differential expression analyses revealed several C134-induced changes. These included increased expression of genes involved in antigen presentation and STAT signaling in microglia and macrophage subsets, the proliferation marker Mki67 in germinal center B cells, the chemokine Ccl12 from microglia, and tissue-resident memory marker genes Fos and Jun in T cells. These data suggest C134 treatment poises the tumor immune microenvironment for antigen presentation and antigen-specific immune responses. Next, we evaluated CT2A to identify candidate tumor neoantigens by isolating DNA and RNA from orthotopic tumors and DNA from tail snips of mice treated with saline or C134. We carried out RNA sequencing (tumors) and whole exome sequencing (tumor and normal), and employed the Personalized Variant Antigens by Cancer Sequencing (pVAC-Seq) computational pipeline. This pipeline takes somatic variant calls from the exome comparison of tumor to normal DNA, validates RNA expression of called variants, and feeds corresponding peptide sequences into algorithms that predict the binding of variant-containing peptides to major histocompatibility complex (MHC), thereby assessing for potential neoantigens. Our pVAC-Seq analysis revealed a conserved set of 1,264 tumor-exclusive variants expressed at the RNA level with high (ic50<500nm) predicted binding to mouse MHC. I will present details of C134-induced immune remodeling in syngeneic HGG models, and describe a plan to engineer C134 to express a prioritized set of neoantigens to evaluate how efficacy from OV therapy may be further enhanced in a patient-specific manner. Citation Format: Jack Hedberg, Alexia Martin, Doyeon Kim, Jason Navarro, Adithe Rivaldi, Yeaseul Kim, Ilse Hernandez-Aguirre, Elizabeth Garfinkle, Katherine Miller, Kevin Cassady, Elaine Mardis. Oncolytic virotherapy targeting high-grade glioma tumor antigens [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 6654.

Abstract 3911: A FGFR-p53 developmental signaling axis drives progression of salivary cancer

Abstract Mucoepidermoid carcinoma (MEC) is the most frequently occurring salivary gland (SG) malignancy. Treatments for high grade (HG) MEC are lacking due to a limited understanding of its diverse histological and clinical features. Consequently, patients with non-resectable HG MEC are often treated with adjuvant radiotherapy and suffer from increased rates of recurrence and metastasis with poor 5-year survival rates (30-50%) as compared to low grade (LG) MEC (76-95%). We previously demonstrated a role for IGF-1 signaling, an important mediator for SG development and branching morphogenesis, in MEC pathogenesis (Musicant et al, 2021). Here, we analyzed transcriptome profiles shared between fetal and adult normal parotid (PAR) tissues with MEC tumors to investigate programs involved in MEC progression. Using this information, we developed the first genetically engineered mouse model (GEMM) of advanced HG MEC via targeted oncogene expression in SG ductal cells. MEC samples from 21 PAR tumors (8 LG/13 HG), 8 age-matched normal, and 3 fetal PAR glands aged between 22-24 weeks of gestation (Saitou et al, 2020) were retrospectively collected from UCSF or UNC Surgical Pathology. RNAseq was performed on FFPE samples using Illumina HiSeq. Differential gene expression, gene set enrichment analyses (GSEA), and alternative splicing analyses were compared between fetal/normal/MEC according to tumor grade and CRTC1 (CREB-regulated transcription coactivator 1)/MAML2 (Mastermind-like 2) (C1/M2) status. Based on these analyses, we developed a GEMM combining C1/M2 expression with TP53 loss. GEMM tumors were subjected to RNAseq and reviewed by two independent pathologists for diagnostic confirmation of HG MEC.GSEA revealed significant overlap between MEC tumors and fetal SG for genes governing proliferation and developmental pathways associated with branching morphogenesis. Interestingly, upregulation of the negatively regulated p53 target FOXM1 along with a mutant-p53 gene signature (Troester et al, 2006) revealed that p53 dysregulation in HG tumors phenocopies that seen in fetal SG. Cre-inducible expression of C1/M2 alone was insufficient to induce MEC-like lesions when targeted to distinct salivary cell types (ductal Krt14-CreER, acinar Mist1-CreER, serous demilune Dcpp1-CreER). However, p53 alteration (Tp53KO) with ductal C1/M2 expression drove MEC formation with histological and molecular features of human HG-MEC. Notably, transcriptome profiles implicate an FGFR-p53 developmental signaling axis in MEC progression. Our autochthonous GEMM recapitulates advanced HG-MEC in vivo providing the field with a powerful platform for identifying pathways for developing targeted therapies. Taken together, the integrated bioinformatics and mouse modeling of this study provide a critical step toward elucidating salivary MEC progression and suggest a role for FGFR targeted therapies in the treatment of non-resectable HG MEC. Citation Format: Julia M. Billington, Adele M. Musicant, Jessica L. Cote, Jennifer Modliszewski, Yi-Hsuan Tsai, Luane J. Landuau, John Powers, Renee Betancourt, Radhika Sekhri, Ricardo J. Padilla, Juan C. Hernandez-Prera, David N. Hayes, Trevor G. Hackman, Omer Gokcumen, Sarah M. Knox, Jimena Guidice, Antonio L. Amelio. A FGFR-p53 developmental signaling axis drives progression of salivary cancer [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 3911.

Abstract 1151: Reconstruction of the spatial ecosystem of glioblastoma reveals relationships between tumor cell states and microenvironment

Abstract Glioblastoma multiforme (GBM) is the most aggressive form of primary brain tumor, with no curative treatment options. Multiple studies have characterized at single cell resolution the GBM as being composed of transcriptional cell states interconnected with components in the tumor immune microenvironment (TME). Our group proposed and validated the first single cell guided functional classification of GBM in four tumor-intrinsic cell states which informed clinical outcome and delivered therapeutic options. However, single cell technologies are unable to unravel the spatial relationships among the cell states of GBM and between GBM cell states and TME. Spatially resolved transcriptomic technologies are emerging as powerful tools to reconstruct the spatial architecture of a tissue. We performed spatial transcriptomics of multicellular regions of interest (ROI) in 6 primary IDH wild-type GBM and 2 recurrent GBM with both CosMx Spatial Molecular Imager, which analyzes 1,000 RNA probes and 64 proteins at single cell resolution, and GeoMx Digital Spatial Profiler which profiles the whole transcriptome (~18,000 genes) at ROI resolution. The development of computational tools aimed to integrate spatial proximity and CosMx derived single-cell transcriptomics revealed spatial segregation of the tumor cell clones and cellular states and highlighted recurrent patterns of cell states, distinct TME cell types associated with coherent histopathological features across multiple samples. The development of a spatial informed intercellular communication algorithm and the reconstruction of ligand-receptor-target networks will allow the discovery of tumor cell states-TME cross-talks and the biological signaling regulated by these interactions that are driving the heterogeneity of GBM and therefore potentially therapeutically targetable. Analysis of matched regions of interest profiled by GeoMx and spatial proteomics with CosMx further cross-validated the spatial ecosystem of glioblastoma as reconstructed at single-cell resolution. Our studies established a scalable approach to resolve the transcriptional heterogeneity of GBM and reconstruct the architecture of GBM cell states and tumor microenvironment. Citation Format: Bruno Adabbo, Simona Migliozzi, Luciano Garofano, Fulvio D'Angelo, Pedro Davila, Sakir H. Gultekin, Daniel Bilbao Cortes, Benjamin Currall, Sion L. Williams, Marc Sanson, Franck Bielle, Anna Luisa Di Stefano, Michele Ceccarelli, Anna Lasorella, Antonio Iavarone. Reconstruction of the spatial ecosystem of glioblastoma reveals relationships between tumor cell states and microenvironment [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 1151.

Abstract 6022: Investigating the mechanisms behind salivary gland tissue sparing in response to ultra-high dose-rate FLASH proton radiotherapy

Abstract Background: Radiotherapy (RT) is a primary treatment for cancers of the head and neck. However, although highly efficacious in eliminating tumors, incidental damage to underlying tissue remains a major limitation of RT. In the case of head and neck cancer, damage to the otherwise healthy salivary glands is often unavoidable even at low dosages, leaving patients with lifelong xerostomia and other comorbidities. FLASH Proton RT (F-PRT) is a form of ultra-high dose RT and has been reported to spare healthy tissues while retaining its tumor-controlling efficacy. The first system to deliver dosimetrically identical FLASH Proton RT (F-PRT; 60- 110 Gy/sec) or Standard Proton RT (S-PRT; 0.5-1 Gy/sec) using double-scattered protons was designed by our group. Aim: In this study, we aimed to investigate the effect of F-PRT on radiation-induced salivary gland dysfunction and the potential mechanism of this sparing effect by analyzing the effects of FLASH on two distinct salivary gland cell types: acinar and ductal cells. Methods: The head and neck area of C57BL/6 mice were irradiated with a single dose of 16 Gy of F-PRT (128Gy/s) or S-PRT (0.95 Gy/s). Radiation-induced xerostomia was studied by measuring the saliva flow rate of mice at 5, 10, 14, and 28 days post-PRT. Expression of AQP5, SOX9, and Keratin- 18, 19 was studied at 2, 5, 10, 14, and 28 days post irradiation by both immunofluorescence and protein immunoblotting. Results: Following irradiation with a single dose of 16 Gy, saliva flow was reduced by both treatments. However, the F-PRT-treated mice showed a significant improvement in salivary flow at 14 and 28 days post-irradiation, compared to those treated with S-PRT. Expression of AQP5 was significantly downregulated at 2, 5, 10 and 14 days post irradiation with S-PRT while F-PRT-treated mice showed a significant restoration of the AQP5 expression during the same time points. Expression of SOX9 showed no significant differences between S-PRT and F-PRT treated mice at earlier time points (2, 14 days), however, there was a significant difference in expression of SOX9 between the irradiated and unirradiated group. The difference in expression of SOX9 was visible from day 28 post-irradiation, where the F-PRT treated group showed increased expression compared to S-PRT. Conclusion: Our findings demonstrate that F-PRT reduces radiation-induced hyposalivation and reinstates the expression of AQP5 in the acinar cells of the submandibular gland of mice. Furthermore, it demonstrates that on day 28 post-irradiation, F-PRT-treated mice displayed more SOX9-expressing progenitor cells in the submandibular salivary glands compared to S-PRT. Acknowledgements: This work was supported by a Sponsored Research Agreement from IBA to Drs. C. Koumenis and L. Dong. Citation Format: George S. Morcos, Priyanka Chowdhury, Michele M. Kim, Khayrullo Shoniyozov, James Metz, Lei Dong, Constantinos Koumenis. Investigating the mechanisms behind salivary gland tissue sparing in response to ultra-high dose-rate FLASH proton radiotherapy [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 6022.

Abstract 3523: Self-supervised foundation model captures high-dimensional morphology data from single cell brightfield images

Abstract Our knowledge of cancer biology has advanced with the characterization of distinct cell types and cell states within heterogeneous tumor environments. Many methods for imaging and sorting tumor cells require biomarker labels that alter cell characteristics and create a selection bias. The use of label-free single-cell methods should further improve cancer studies involving viable, unperturbed cells for downstream assays such as RNA-Seq, cell culture expansion, and functional assays. To eliminate biomarkers and enable broader assessment of cells, we developed REM-I, a platform that characterizes and sorts unlabeled single cells based on high-dimensional morphology. Cells are captured with brightfield imaging and processed in real-time by self-supervised deep learning models to generate quantitative AI embeddings representative of cell morphology. A significant technical challenge in building REM-I was developing an AI model based on extracted features from cell images without prior knowledge of cell types, cell preparation, or other application-specific knowledge. Accordingly, we developed the Human Foundation Model (HFM), a hybrid architecture that combines self-supervised learning (SSL) and morphometrics (computer vision) to extract 115 dimensional embeddings representing cell morphology from high-resolution REM-I cell images. SSL produces a foundation model with high generalization capacity that enables hypothesis-free sample exploration and efficient generation of application-specific models. Meanwhile, computer vision extracts features that represent measurable and interpretable concepts (e.g., cell size, shape, texture, intensity). The training process for the HFM self-supervised backbone model utilizes the discriminatory power of supervised tasks. Using synthetic cells and three cancer cell lines, we trained and then validated the reproducibility and generalization capabilities of the resulting model. Results show combining deep learning and morphometrics improve interpretability of data and enable rapid characterization and classification of tumor cells with high accuracy. We also report on the Deepcell® Axon data suite, a tool to analyze data and customize reusable workflows. This includes the ability to store and manage data, visualize high dimensional data as low-dimensional projections, and train classifiers to identify and sort cell populations. To enable compatibility with user-preferred downstream analysis pipelines, Axon provides data export options for images, plots, and embeddings. Our approach allows users of all skill levels to access and interpret AI-enabled morphological profiling. Applications of REM-I include hypothesis-free evaluation of heterogeneous tumor samples, label-free cancer cell enrichment, characterization of distinct cell states, and multi-omic integration. Citation Format: Kiran Saini, Senzeyu Zhang, Ryan Carelli, Kevin B. Jacobs, Amy Wong-Thai, Cris Luengo, Vivian Lu, Anastasia Mavropoulos, Andreja Jovic, Jeanette Mei, Thomas Vollbrecht, Stephane C. Boutet, Mahyar Salek, Maddison Masaeli. Self-supervised foundation model captures high-dimensional morphology data from single cell brightfield images [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 3523.

Abstract 109: Identification of tumor-intrinsic and extrinsic mechanisms of T cell exclusion in estrogen receptor-positive (ER+) breast cancer through integration of bulk and single-cell transcriptome and spatial analysis

Abstract T cells are generally present in low numbers in estrogen receptor-positive (ER+) breast cancer (BC) potentially due to limited antigens or impaired antigen presentation, however defined mechanisms are not fully understood. This study explores the interplay between estrogen receptor signaling (ERS), antigen presentation machinery (APM), and T cell signaling (TC) using diverse datasets, including BC cell lines, TCGA, METABRIC, and clinical trial bulk transcriptomes, single-cell RNA-sequencing of ER+ primary BC, and single-cell spatial multi-plex cyclic immunofluorescence (CyCIF) of primary BC patients. Co-expression analysis of both computationally and manually curated genes in TCGA and METABRIC data unveiled distinct 29-gene ERS and 225-gene combined APM/TC modules with strong inverse correlations in ER+ BC. This inverse correlation was confirmed in independent cohorts. ERS and APM/TC modules were down- and up-regulated, respectively, in response to aromatase inhibitor therapy in ER+ BC patients from the ACOSOG Z1301B trial who demonstrated clinical benefit. Analysis of published single-cell RNA-sequencing data of 20 primary ER+ BC was performed to elucidate cell types that express individual genes in the modules. It confirmed that high ERS activity is associated with reduced T cells, and identified distinct cell types contributing to each module, showing higher ERS activity in tumor cells and higher APM/TC activity in stromal and immune cells. At the cell type level, we found distinct contributions and precise insights of individual genes. The prevalence of ERS activity in tumor cells prompted investigation to determine if the ERS and APM/TC modules were preserved as tumor-intrinsic signaling. Analysis of 54 BC cell lines indicated partially preserved module correlations in cancer cell lines and revealed that the APM/TC module is a contribution of both tumor-intrinsic (e.g., complement and type-I IFN-response), and tumor-extrinsic (e.g., lymphocyte activation) factors. CyCIF analysis of 29 ER+ BC samples was performed to bridge gene signatures with spatial biology and validated that higher ERS activity correlates with lower T cell infiltration. The spatial pattern of T cells varied from immune desert to stromally bound to fully inflamed tumors. Neighborhood analysis revealed increased frequency of CD8 T cells around a tumor cell is associated with elevated MHC I and II in broad immune cells and macrophage subsets, respectively. pTBK1+ macrophages inversely correlated with CD8 T cell frequency and MHC expression in neighboring cells, suggesting an immunosuppressive role. This study uncovers robust and tightly regulated ERS and APM/TC signaling in ER+ patients, unraveling molecular intricacies and offering potential insights for targeted therapeutic interventions. Citation Format: Kenichi Shimada, Yvonne X. Cui, Daniel Michaud, Kelly F. Zheng, Jonathan Goldberg, Ricardo Pastorello, Lukas Kania, Sandra S. McAllister, Sara M. Tolaney, Adrienne Waks, Rinath Jeselsohn, Peter K. Sorger, Judith Agudo, Jennifer L. Guerriero, Elizabeth A. Mittendorf. Identification of tumor-intrinsic and extrinsic mechanisms of T cell exclusion in estrogen receptor-positive (ER+) breast cancer through integration of bulk and single-cell transcriptome and spatial analysis [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 109.

Abstract 5498: Multi-modal examination of spatial heterogeneity in the astrocytoma microenvironment

Abstract Astrocytoma is a diffuse tumor that infiltrates the brain. Despite post-operative therapy including radiation and chemotherapy, 52% of patients’ tumors recur within five-years of surgery. These tumors are characterized by mutations in the IDH1 or IDH2 gene that confer metabolic alterations, most notably the production of the onco-metabolite 2-hydroxyglutarate. To reveal the metabolic alterations and their upstream regulation across the tumor microenvironment, we applied spatial metabolomics and spatial transcriptomics to sequential sections from resected tumor samples of patients with low grade astrocytoma. This necessitated extensive optimization of atmospheric-pressure MALDI-TOF, including the establishment of a custom automated computational pipeline with abilities to identify metabolic niches. Additionally, using sequential sections of the same tumor, we also compared all commercially available imaging-based spatial transcriptomic technologies (10x Genomics Xenium, Nanostring CosMx, Vizgen MERSCOPE) to evaluate their suitability with regards to building a multi-modal model of metabolic activity and regulation across the tumor microenvironment. We found that 10x Genomics Xenium was most suited for this task as image registration across sequential sections was comparatively straight-forward. Combining spatial transcriptomics generated with 10x Genomics Xenium and spatial metabolomics across 8 matched sequential slices of the same tumor, we identified metabolic niches associated with distinct cell type composition and transcriptional regulation. Citation Format: Joel Moffet, Jurgen Kriel, Tianyao Lu, Lutz Freytag, James Whittle, Sarah Best, Saskia Freytag. Multi-modal examination of spatial heterogeneity in the astrocytoma microenvironment [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 5498.

Abstract 1596: Disrupting local immunosuppression by combined myCAF/myeloid targeting in pancreatic cancer

Abstract Immunotherapy has revolutionized clinical care for many patients, but some cancers, such as pancreatic ductal adenocarcinoma (PDAC) remain stubbornly resistant. Local immunosuppression (LIS) is one of the striking hallmarks of PDAC due to the combined effects of multiple different immunosuppressive cell types in the tumor microenvironment (TME). There is great need for an increased understanding of the cellular crosstalk within tumors to understand how stromal cells coordinate in their suppression of immune responses. Oncogenic KRAS activation in tumor cells promotes the invasion and proliferation of tumor-supporting stromal cells, while excluding cancer-targeted cytotoxic T cells. Prior attempts to reverse LIS in PDAC by targeting individual stromal cell populations have been unsuccessful, alluding to the contributions of multiple distinct cell types. Here we examine the interactions of cancer-associated fibroblasts (CAFs) and myeloid-derived suppressor cells (MDSCs) and how they coordinate to suppress immune responses in the PDAC TME. We interrogate PDAC stromal cell biology by using targeted therapies to perturb various cell populations both in vivo using genetically engineered mouse models, and ex vivo using PDAC tumor explants. Explants are short-term slice cultures that enable experimental study of intact tumor sections with a full complement of cell types. Importantly, PDAC explants maintain their histopathological architecture and cellular diversity over time. This medium-throughput platform allows for testing of multiple drugs and mechanistic hypotheses in the native PDAC TME. We show in preliminary data that Smoothened inhibition (SMOi) decreases the proliferation and activity of myCAFs, but provokes the expansion of CD11b-positive myeloid cells in vivo. Thus, we hypothesize that LIS in PDAC is maintained by a balance between myCAFs and myeloid cells, preventing effective T cell invasion. Single cell RNA-seq data comparing ctrl vs. SMOi-treated murine PDAC elucidates stromal subpopulations involved in the LIS phenotype and guides the identification of myeloid subtypes emerging after SMOi. Strikingly, we demonstrated that simultaneous SMOi and targeting myeloid cells via anti-Gr1 or CCR1 inhibition significantly elevates cytotoxic T cell numbers within the TME. We are currently investigating whether the activity of these T cells may be further potentiated through combination with immunomodulatory agents. By testing various treatment combination in the same TME, we will identify the best synergistic effects for future immunotherapy approaches in human PDAC. In summary, we are elucidating the complex mechanism behind LIS in PDAC by employing our novel explant culture system alongside in vivo studies. We aim to develop a translatable regimen to neutralize LIS, reactivating the cytotoxic T cells in the tumor periphery to invade, proliferate, and attack cancer cells. Citation Format: Marie C. Hasselluhn, Dafydd Thomas, Lukas Vlahos, Alvaro Curiel-Garcia, Amanda R. Decker-Farrell, Tanner C. Dalton, Stephen A. Sastra, Carmine F. Palermo, Andrea Califano, Kenneth P. Olive. Disrupting local immunosuppression by combined myCAF/myeloid targeting in pancreatic cancer [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 1596.

Abstract 1385: Crosstalk between hepatocyte and myeloid-specific IL17 signaling in colorectal cancer metastasis

Abstract Advanced colorectal cancer (CRC) is resistant to current immunotherapies and prone to metastasis. Chronic inflammation mediated by cytokines such as interleukin (IL)17 activates the oncogenic pathways in cancer cells, promoting sporadic and inflammation-associated CRC. Increased levels of IL17A in early stages of CRC portends poor prognosis indicating its potential involvement into metastasis. We and others previously showed that IL17A signaling is required for early CRC tumorigenicity in a variety of models and that in early CRC, its ability to signal to epithelial cells is essential. What remains unknown is whether IL17 signaling to other cell types within the tumor microenvironment (TME) is essential to control tumor progression and metastasis. Using a model of colitis-associated cancer (CAC) we found that “late” IL17A neutralization decreases tumor burden, possibly acting through regulation of myeloid cells and chemokine network essential for the control of immunosuppressive TME. Next, using models of colorectal cancer liver metastasis (CRLM) including intraportal cell injection and cecum transplantation of organoids with distinct set of oncogenic mutation we found that IL17 neutralization reduces metastasis. FACS analysis revealed that IL17A promotes the recruitment of tumor-associated macrophages and other key myeloid subsets into the metastatic liver environment. Interestingly, ablation of IL17RC (receptor) in myeloid cells only (using Il17rcf/f -LysMCre mice) led to reduction in metastasis and reshaping of metastatic myeloid cell compartments. Meanwhile, IL17 signaling in hepatocytes was required for early metastasis and pre-metastatic niche formation, as the ablation of IL17RC in hepatocytes (using Il17rcf/f -AlbCre mice) led to a reduction of metastatic numbers but not growth. This coincided with reduced neutrophil recruitment and enhanced activation of cytotoxic innate lymphoid cells and CD8 T lymphocytes, indicating the role of hepatocyte specific IL17 signaling in blunting anti-tumor immunity. Our findings illuminate the role of inflammatory cytokine IL17 into CRC progression and metastasis and imply its distinct cell type specific role within the metastatic liver TME. Citation Format: Katarzyna Chojnacka, Dan Kamen, Katrina M. Reyes, Hana Tomizawa, Sergei I. Grivennikov. Crosstalk between hepatocyte and myeloid-specific IL17 signaling in colorectal cancer metastasis [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 1385.

Distinctive whole-brain cell types predict tissue damage patterns in thirteen neurodegenerative conditions

For over a century, brain research narrative has mainly centered on neuron cells. Accordingly, most neurodegenerative studies focus on neuronal dysfunction and their selective vulnerability, while we lack comprehensive analyses of other major cell types’ contribution. By unifying spatial gene expression, structural MRI, and cell deconvolution, here we describe how the human brain distribution of canonical cell types extensively predicts tissue damage in 13 neurodegenerative conditions, including early- and late-onset Alzheimer’s disease, Parkinson’s disease, dementia with Lewy bodies, amyotrophic lateral sclerosis, mutations in presenilin-1, and 3 clinical variants of frontotemporal lobar degeneration (behavioral variant, semantic and non-fluent primary progressive aphasia) along with associated three-repeat and four-repeat tauopathies and TDP43 proteinopathies types A and C. We reconstructed comprehensive whole-brain reference maps of cellular abundance for six major cell types and identified characteristic axes of spatial overlapping with atrophy. Our results support the strong mediating role of non-neuronal cells, primarily microglia and astrocytes, in spatial vulnerability to tissue loss in neurodegeneration, with distinct and shared across-disorder pathomechanisms. These observations provide critical insights into the multicellular pathophysiology underlying spatiotemporal advance in neurodegeneration. Notably, they also emphasize the need to exceed the current neuro-centric view of brain diseases, supporting the imperative for cell-specific therapeutic targets in neurodegeneration.

The significance of single-cell transcriptome analysis in epididymis research.

As a crucial component of the male reproductive system, the epididymis plays multiple roles, including sperm storage and secretion of nutritive fluids for sperm development and maturation. The acquisition of fertilization capacity by sperm occurs during their transport through the epididymis. Compared with the testis, little has been realized about the importance of the epididymis. However, with the development of molecular biology and single-cell sequencing technology, the importance of the epididymis for male fertility should be reconsidered. Recent studies have revealed that different regions of the epididymis exhibit distinct functions and cell type compositions, which are likely determined by variations in gene expression patterns. In this research, we primarily focused on elucidating the cellular composition and region-specific gene expression patterns within different segments of the epididymis and provided detailed insights into epididymal function in male fertility.

Distinctive whole-brain cell types predict tissue damage patterns in thirteen neurodegenerative conditions.

For over a century, brain research narrative has mainly centered on neuron cells. Accordingly, most neurodegenerative studies focus on neuronal dysfunction and their selective vulnerability, while we lack comprehensive analyses of other major cell types' contribution. By unifying spatial gene expression, structural MRI, and cell deconvolution, here we describe how the human brain distribution of canonical cell types extensively predicts tissue damage in 13 neurodegenerative conditions, including early- and late-onset Alzheimer's disease, Parkinson's disease, dementia with Lewy bodies, amyotrophic lateral sclerosis, mutations in presenilin-1, and 3 clinical variants of frontotemporal lobar degeneration (behavioral variant, semantic and non-fluent primary progressive aphasia) along with associated three-repeat and four-repeat tauopathies and TDP43 proteinopathies types A and C. We reconstructed comprehensive whole-brain reference maps of cellular abundance for six major cell types and identified characteristic axes of spatial overlapping with atrophy. Our results support the strong mediating role of non-neuronal cells, primarily microglia and astrocytes, in spatial vulnerability to tissue loss in neurodegeneration, with distinct and shared across-disorder pathomechanisms. These observations provide critical insights into the multicellular pathophysiology underlying spatiotemporal advance in neurodegeneration. Notably, they also emphasize the need to exceed the current neuro-centric view of brain diseases, supporting the imperative for cell-specific therapeutic targets in neurodegeneration.