Digoxigenin-labeled DNA Probe Research Articles

Advanced Multiplex Loop Mediated Isothermal Amplification (mLAMP) Combined with Lateral Flow Detection (LFD) for Rapid Detection of Two Prevalent Malaria Species in India and Melting Curve Analysis.

Isothermal techniques with lateral flow detection have emerged as a point of care (POC) technique for malaria, a major parasitic disease in tropical countries such as India. Plasmodium falciparum and Plasmodium vivax are the two most prevalent malaria species found in the country. An advanced multiplex loop-mediated isothermal amplification (mLAMP) combined with a lateral flow dipstick (LFD) technique was developed for the swift and accurate detection of P. falciparum and P. vivax, overcoming the challenges of the existing RDTs (rapid diagnostic tests). A single set of LAMP primers with a biotinylated backward inner primer (BIP primer) was used for DNA amplification of both malaria species in a single tube. The amplified DNA was hybridized with fluorescein isothiocyanate (FITC) and digoxigenin-labelled DNA probes, having a complemented sequence for the P. falciparum and P. vivax genomes, respectively. A colour band appeared on two separate LFDs for P. falciparum and P. vivax upon running the hybridized solution over them. In total, 39 clinical samples were collected from ICMR-NIMR, New Delhi. Melting curve analysis, with cross primers for both species, was used to ascertain specificity, and the sensitivity was equated with a polymerase chain reaction (PCR). The results were visualized on the LFD for both species within 60 min. We found 100% sensitivity and specificity, when compared with a traditional PCR. Melting curve analysis of mLAMP revealed the lowest detection limit of 0.15 pg/μL from sample genomic DNA. The mLAMP-LFD assays could be a potential point of care (POC) tool for early diagnosis in non-laboratory conditions, with the convenience of a reduced assay time and the simple interpretation of results.

Bovine Babesiosis Diagnosed in Formalin-Fixed, Paraffin-Embedded Tissues by Using In Situ Hybridization.

Bovine babesiosis, caused by Babesia divergens, is in general a rare disease in Europe. Nonetheless, local outbreaks can cause severe economic damage, and postmortem identification represents a diagnostic challenge. During a recent outbreak in May 2018 in northern Germany, 21 animals of a herd of 150 cattle died within 40 days having had clinical signs of fever and hemoglobinuria. Gross examination of 4 of the 21 deceased animals revealed a tick infestation, jaundice, and dark brown staining of urine and kidneys. Histologically, there were iron-positive deposits, hyperplasia of the red pulp of the spleen, and centrilobular necrosis of hepatocytes. In several locations, small basophilic granules suggestive of intraerythrocytic parasites were visible in hematoxylin-eosin- and Giemsa-stained sections. Peripheral blood smears from a living cow from the herd and polymerase chain reaction (PCR) of feeding ticks revealed B. divergens infection. In situ hybridization (ISH) was applied on formalin-fixed, paraffin-embedded (FFPE) tissue of the necropsied cattle to confirm babesiosis in these animals postmortem. Digoxigenin-labeled DNA probes were generated based on a specific nucleotide sequence for B. divergens, obtained by PCR and sequencing of DNA isolates from infected Ixodes ricinus ticks from deceased cattle. ISH using these probes allowed postmortem diagnosis of B. divergens infection in routinely fixed FFPE tissues.

A fast, sensitive and cost-effective method for nucleic acid detection using non-radioactive probes.

Nucleic acid detection and quantification using a labeled DNA probe is a very common molecular biology procedure. Here, we describe a new method, based on commonly used laboratory solutions, for nucleic acid hybridization and detection with digoxigenin-labeled DNA probes. The protocol described is faster, more sensitive and much cheaper than a standard protocol using commercial solutions. Comparison with a classical radioactive detection method shows that the latter exhibits less background and shows a greater linear response. Hence, the proposed protocol may be routinely performed for qualitative detection of nucleic acid, but when precise signal quantitation needs to be obtained, radioactive probe hybridization associated to phosphorimaging technology is more reliable.

First Report on Association of Okra yellow vein mosaic virus With Yellow Vein Mosaic Disease of Okra (Abelmoschus esculentus) in Sri Lanka

HomePlant DiseaseVol. 101, No. 7First Report on Association of Okra yellow vein mosaic virus With Yellow Vein Mosaic Disease of Okra (Abelmoschus esculentus) in Sri Lanka PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report on Association of Okra yellow vein mosaic virus With Yellow Vein Mosaic Disease of Okra (Abelmoschus esculentus) in Sri LankaC. J. Tharmila, E. C. Jeyaseelan, U. Ihsan, A. C. Wetten, D. M. De Costa, and M. W. ShawC. J. TharmilaSearch for more papers by this author, E. C. JeyaseelanSearch for more papers by this author, U. IhsanSearch for more papers by this author, A. C. WettenSearch for more papers by this author, D. M. De CostaSearch for more papers by this author, and M. W. ShawSearch for more papers by this authorAffiliationsAuthors and Affiliations C. J. Tharmila E. C. Jeyaseelan , Department of Botany, University of Jaffna, Sri Lanka U. Ihsan A. C. Wetten , School of Agriculture, Policy and Development, University of Reading, U.K. D. M. De Costa , Department of Agricultural Biology, Faculty of Agriculture, University of Peradeniya, Sri Lanka M. W. Shaw , School of Agriculture, Policy and Development, University of Reading, U.K. Published Online:14 Apr 2017https://doi.org/10.1094/PDIS-10-16-1492-PDNAboutSections ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Yellow vein mosaic disease (YVMD) is a major biotic constraint on okra (Abelmoschus esculentus) cultivation in Sri Lanka. Diseased plants show characteristic symptoms of mosaic and vein yellowing on leaves and small and yellowish green fruits. Disease incidence was 55 to 70% in three districts (Jaffna, Trincomalee, and Vavuniya) of northern Sri Lanka in 2015. To confirm the identity of the pathogen, symptomatic leaf samples were collected from the above three districts in May and June 2015. In each district, three diseased plant samples were collected from three different farms. DNA of the samples was amplified by PCR using begomovirus specific primers to detect DNA-A (Deng et al. 1994), DNA-B (Rojas et al. 1993), and β-satellite DNA (Briddon et al. 2002). For all samples (27 DNA samples of infected plants), the presence of DNA-A and β-satellite DNA of a monopartite begomovirus was confirmed; however, DNA-B was not detected. A full-length PCR amplified product of the β-satellite DNA of each district was cloned and sequenced. The resulting sequences (GenBank KX174318, KX174319, and KX174322) have several features of begomovirus DNA-β, namely, a conserved nonanucleotide TAATATTAC, which is found in all geminiviruses, a coding sequence for the protein beta-C1, an adenine rich region, and a highly conserved stretch of ∼100 nucleotides upstream of the predicted stem-loop structure. The sequences showed great similarity with several isolates of Bhendi yellow vein mosaic betasatellite (BYVB) in GenBank and were distantly related to begomoviruses previously identified in Sri Lanka: Tomato leaf curl virus associated DNA beta (AJ542493) and Ageratum yellow vein virus associated DNA beta (AJ542498). The complete nucleotide sequences of DNA-A were amplified with three sets of degenerate overlapping primers (Venkataravanappa et al. 2012). The DNA-A sequences assembled from the cloned segments (KX698087, KX698088, and KX698090) have the genome organization characteristic of begomoviruses, encoding six ORFs with two ORFs (AV1 and AV2) in the virion sense strand and four ORFs (AC1-AC4) in the complementary strand, separated by an intergenic region (IR). The IR contains a stem loop structure with the expected conserved nonanucleotide sequence, TAATATTAC. The nucleotide sequence comparisons showed that the genome of DNA-A of the isolates shared 97 to 98% sequence identity with Okra enation leaf curl virus isolates (KT390458, KX553923) and also 97% identity with Mesta yellow vein mosaic virus (KJ462074), and 91% with Indian isolates of Bhendi yellow vein mosaic virus, while it showed ≤80% similarity with other identified Sri Lankan begomoviruses, such as Ageratum yellow vein virus (NC_002981), Chilli leaf curl virus (JN555600), and Cassava mosaic virus (AJ314737). Hence, the virus associated with YVMD of okra has been identified as an isolate of Okra yellow vein mosaic virus. Furthermore, leaf samples collected from infected plants showed positive results to dot blot hybridization using a digoxigenin labeled DNA probe (DIG DNA labeling and detection kits, Sigma Aldrich, U.S.A.), which had been prepared specifically to beta-satellite DNA using the primer pair (BetaF: GGTTCGTTTACATCCATTCCCA, BetaR: TCCATTCGACTTCAACGGT). To our knowledge, this is the first report of Okra yellow vein mosaic virus (OYVMV) associated with yellow vein mosaic disease of okra in Sri Lanka. Identification of OYVMV association with okra will provide the platform for further study, prevention, and control of the disease.

Signature-tagged mutagenesis of Vibrio vulnificus.

Vibrio vulnificus is the causative agent of primary septicemia, wound infection and gastroenteritis in immunocompromised people. In this study, signature-tagged mutagenesis (STM) was applied to identify the virulence genes of V. vulnificus. Using STM, 6,480 mutants in total were constructed and divided into 81 sets (INPUT pools); each mutant in a set was assigned a different tag. Each INPUT pool was intraperitoneally injected into iron-overloaded mice, and in vivo surviving mutants were collected from blood samples from the heart (OUTPUT pools). From the genomic DNA of mixed INPUT or OUTPUT pools, digoxigenin-labeled DNA probes against the tagged region were prepared and used for dot hybridization. Thirty tentatively attenuated mutants, which were hybridized clearly with INPUT probes but barely with OUTPUT probes, were negatively selected. Lethal doses of 11 of the 30 mutants were reduced to more than 1/100; of these, the lethal doses of 2 were reduced to as low as 1/100,000. Transposon-inserted genes in the 11 attenuated mutants were those for IMP dehydrogenase, UDP-N-acetylglucosamine-2-epimerase, aspartokinase, phosphoribosylformylglycinamidine cyclo-ligase, malate Na (+) symporter and hypothetical protein. When mice were immunized with an attenuated mutant strain into which IMP dehydrogenase had been inserted with a transposon, they were protected against V. vulnificus infection. In this study, we demonstrated that the STM method can be used to search for the virulence genes of V. vulnificus.

First Report of Rose rosette virus Associated with Rose Rosette Disease Infecting Knockout Roses in Florida.

Roses are one of the most popular flowering shrubs in the United States, with a total wholesale value of US$194 million. Among the major states, Florida is the fourth largest producer of roses with a total value exceeding US$20 million (4). In Florida, the roses have become especially popular in recent years with the introduction of Knock Out and other shrub roses. Virus-like symptoms including witches'-broom, excessive thorns, abnormal red discoloration of shoots and foliages, distorted leaves, and deformed buds and flowers were initially observed on Knock Out roses in a commercial nursery in Quincy, FL, in November 2013. Fifteen plants out of ~250,000 plants showed these characteristic symptoms. Total RNA extracts (RNeasy Plant Mini Kit, Qiagen, Valencia, CA) from eight symptomatic and two non-symptomatic rose samples were subjected to reverse-transcription (RT) assays using SuperScript III Reverse transcriptase (Invitrogen, Life Technologies, NY) and random hexamer primers. The cDNA synthesized was then subjected to PCR assay using Platinum Taq DNA polymerase (Invitrogen, Life Technologies) and using Rose rosette virus (RRV) specific primers RRV-F and RRV-R (1), targeting the core region of the RNA1 genome of the virus. The RT-PCR assays using the specific primers produced amplicons of 375 bp, only in the symptomatic leaf samples. The obtained amplicons were PCR purified and sequenced directly (GenBank Accession Nos. KF990370 to KF990377). BLAST analysis of these sequences revealed a higher identity of 99% with the RRV (HQ871942) in the NCBI database. Pairwise comparison of the eight RRV sequences exhibited 99 to 100% identity among themselves. These results revealed the association of RRV with the symptomatic rose plants. Eight symptomatic and two non-symptomatic rose plant samples were tested for RRV using blot hybridization assay, utilizing a digoxigenin-labeled DNA probe of 511 bp, targeting the RNA1 genome of the RRV. All eight symptomatic rose plants showed a positive reaction to the RRV-specific probes, confirming the presence of RRV in the samples, while the non-symptomatic and the buffer control did not produce any reactions. Even though the virus is reported to spread by an eriophyid mite Phyllocoptes fructiphilus, thorough examination of the infected samples showed absence of the vector. The samples were also tested using RT-PCR for the presence of Rose cryptic virus (RCV) and Blackberry chlorotic ringspot virus (BCRV) using specific primers (2,3). The samples tested negative for the RCV and BCRV. This is the first report of occurrence of RRV on rose in Florida. Considering the economic importance of the rose plants and the highly destructive nature of RRV, this report underscores the need for immediate effective quarantine and management of the virus for protecting the economically important rose industry in Florida.

Can white spot syndrome virus be transmitted through the phytoplankton→rotifer →artemia→shrimp pathway?

The transmission of white spot syndrome virus (WSSV) in the aquatic environment by the pathway of phytoplankton through rotifer to artemia and shrimp was investigated. The phytoplankton Alexandrium tamarense and Alexandrium minutum were co-cultured with adult Fenneropenaeus chinensis infected with WSSV and were assayed by whole cell fluorescence in situ hybridization (WFISH) with probe specific for WSSV labeled with 5-carboxyfluoroscein at 5’-end to study whether they could carry WSSV. Then, the WSSV positive phytoplankton was exposed to the rotifer Brachionus urceu and was assayed by dot blot hybridization with digoxigenin labeled DNA probe. Further experiments were conducted to feed artemia Artemia franciscana with the WSSV positive rotifers and feed juvenile shrimps F. chinensis with the artemia. Our results showed that the pytoplankton were WSSV-positive after 24 h incubation. The dot-blot diagnosis revealed WSSV-positive results in the rotifers exposed to WSSV positive phytoplankton. The cumulative mortality of shrimp and dot blot diagnosis showed that the shrimp can be infected by the food chain of phytoplankton →rotifer →artemia →shrimp.

Transcriptional analysis of human papillomavirus type 16 in histological sections of cervical dysplasia by in situ hybridisation

BackgroundThe HPV-16 virus is well described as a causative agent in cervical cancer.AimsTo individually analyse the transcription profile of the HPV-16 viral genes in patient biopsies of varying grades of...

A duplex-PCR method for species- and pathovar-level identification and detection of the quarantine plant pathogen Xanthomonas arboricola pv. pruni

A PCR-based method was developed for the stone fruit quarantine pathogen Xanthomonas arboricola pv. pruni (Xap), which provides rapid, sensitive and specific in planta detection and isolate identification. Primers specific for Xap were identified using random amplified polymorphic DNA (RAPD). Simplex PCR with these primers had a limit of detection per PCR reaction of approximately 10CFU for isolate cultures and 50CFU for plant material when used on tenfold dilutions of isolate culture or genomic DNA extracted from spiked samples, respectively. The primers were adapted as a high-throughput single-step screening based on a digoxigenin-labeled DNA probe assay with a detection limit of 4×102CFU from isolate cultures. A duplex-PCR method was designed that includes the pathovar-level with species-level primers based on species-specific regions of the quinate metabolic gene qumA, increasing diagnostic confidence and offering the first molecular test for all X. arboricola pathovars.

Determining the origin of cells in tissue engineered skin substitutes: a pilot study employing in situ hybridization

Definitive and high-quality coverage of large and, in particular, massive skin defects remains a significant challenge in burn as well as plastic and reconstructive surgery because of donor site shortage. A novel and promising approach to overcome these problems is tissue engineering of skin. Clearly, before eventual clinical application, engineered skin substitutes of human origin must be grafted and then evaluated in animal models. For the various tests to be conducted it is indispensable to be able to identify human cells as such in culture and also to distinguish between graft and recipient tissue after transplantation. Here we describe a tool to identify human cells in vitro and in vivo. In situ hybridization allows for the detection and localization of specific DNA or RNA sequences in morphologically preserved cells in culture or tissue sections, respectively. We used digoxigenin-labeled DNA probes corresponding to human-specific Alu repeats in order to identify human keratinocytes grown in culture together with rat cells, and also to label split and full thickness skin grafts of human origin after transplantation on immuno-incompetent rats. Digoxigenin-labeled DNA probing resulted in an intensive nuclear staining of human cells, both in culture and after transplantation onto recipient animals, while recipient animal cells (rat cells) did not stain. In situ hybridization using primate-specific Alu probes reliably allows distinguishing between cells of human and non-human origin both in culture as well as in histological sections. This method is an essential tool for those preclinical experiments (performed on non-primate animals) that must be conducted before novel tissue engineered skin substitutes might be introduced into clinical practice.

In Situ Hybridization for the Detection of Mycoplasma Bovis in Paraffin-Embedded Lung Tissue from Experimentally Infected Calves

Mycoplasma bovis DNA was detected in lung tissue of experimentally infected calves by in situ hybridization (ISH) with a nonradioactive, digoxigenin-labeled DNA probe. The 171-base pair DNA probe targeting part of the gene of the major immunodominant variable surface protein A, which is conserved among all vsp genes, was generated by polymerase chain reaction. Four calves between 57 and 63 days old were inoculated intratracheally with 30 ml of a suspension of M. bovis strain 1067 containing 7 x 10(4) colony forming units per milliliter. Two calves inoculated with 30 ml of sterile medium served as control animals. The calves were euthanized and then examined 21 days after inoculation. The ISH method developed in the current study was suitable for the detection of M. bovis DNA in formalin-fixed, paraffin-embedded lung tissue and may be a valuable tool for diagnostic purposes and for further investigating the pathogenesis of M. bovis infection.

Large T Antigen Promotes JC Virus Replication in G2-arrested Cells by Inducing ATM- and ATR-mediated G2 Checkpoint Signaling

Large T antigen (TAg) of the human polyomavirus JC virus (JCV) possesses DNA binding and helicase activities, which, together with various cellular proteins, are required for replication of the viral genome. We now show that JCV-infected cells expressing TAg accumulate in the G(2) phase of the cell cycle as a result of the activation of ATM- and ATR-mediated G(2) checkpoint pathways. Transient transfection of cells with a TAg expression vector also induced G(2) checkpoint signaling and G(2) arrest. Analysis of TAg mutants with different subnuclear localizations suggested that the association of TAg with cellular DNA contributes to the induction of G(2) arrest. Abrogation of G(2) arrest by inhibition of ATM and ATR, Chk1, and Wee1 suppressed JCV genome replication. In addition, abrogation of the G(2)-M transition by Cdc2 depletion disabled Wee1 depletion-induced suppression of JCV genome replication, suggesting that JCV replication is facilitated by G(2) arrest resulting from G(2) checkpoint signaling. Moreover, inhibition of ATM and ATR by caffeine suppressed JCV production. The observation that oligodendrocytes productively infected with JCV in vivo also undergo G(2) arrest suggests that G(2) checkpoint inhibitors such as caffeine are potential therapeutic agents for JCV infection.

English

    PCR was employed to detect Brucella spp. from broth cultures of clinical samples using a group specific primer based on IS6501 sequence. The sensitivity and specificity of this assay was confirmed by Southern hybridization analysis using a digoxigenin-labeled DNA probe while reproducibility of the analysis was confirmed by repetition of the test. Also, ERI1 and ERI2 primers were used to differentiateBrucella abortus strain 19 from other strains and the relevance in quality control ofBrucella vaccine production highlighted.   Key words: PCR, Southern hybridization, Brucella, vaccine, quality control.

Molecular detection of Brucella spp. from broth culture of clinical samples in Nigeria: Its role in vaccine quality control

PCR was employed to detect Brucella spp. from broth cultures of clinical samples using a group specific primer based on IS6501 sequence. The sensitivity and specificity of this assay was confirmed by Southern hybridization analysis using a digoxigenin-labeled DNA probe while reproducibility of the analysis was confirmed by repetition of the test. Also, ERI1 and ERI2 primers were used to differentiate Brucella abortus strain 19 from other strains and the relevance in quality control of Brucella vaccine production highlighted.

A new strategy for constructing in vitro replication-competent 1.3 copies of hepatitis B virus genome

In the absence of a robust infectable cell culture system, assays related to replication of clinical HBV isolates are based on the transfection of replication-competent HBV DNA into hepatoma cell lines that are able to replicate and secrete HBV virions. Current methods for constructing HBV 1.1 genomes work well for drug susceptibility assays, but are not very suitable for research on HBV replication capacity or regulation since a heterogeneous promoter is required to drive pgRNA transcription. A new strategy for constructing HBV 1.3 genomes that contain HBV intrinsic promoter necessary for pgRNA transcription is reported in this paper. Using this strategy, three HBV 1.3 genomes from isolates of three patients were constructed. When the three HBV 1.3 genomes were transfected into the HepG2 cell line, replicative intermediates were detectable by Southern blotting with digoxigenin-labeled DNA probe in two of the three constructs. Using overlap extension PCR and avoiding as much as possible the digestion-and-ligation process, this strategy could be applied to constructing longer-than-genome units for most genotypes of HBV strains.

Genome-wide Analysis Identifies Interleukin-10 mRNA as Target of Tristetraprolin

Tristetraprolin (TTP) is an RNA-binding protein required for the rapid degradation of mRNAs containing AU-rich elements. Targets regulated by TTP include the mRNAs encoding tumor necrosis factor-alpha, granulocyte-macrophage colony-stimulating factor, interleukin-2 (IL-2), and immediate early response 3. To identify novel target mRNAs of TTP in macrophages, we used a genome-wide approach that combines RNA immunoprecipitation and microarray analysis. A list was compiled of 137 mRNAs that are associated with TTP with an estimated accuracy on the order of 90%. Sequence analysis revealed a highly significant enrichment of AU-rich element motifs, with AUUUA pentamers present in 96% and UUAUUUAUU nonamers present in 44% of TTP-associated mRNAs. We further show that IL-10 is a novel target regulated by TTP. IL-10 mRNA levels were found to be elevated because of a reduced decay rate in primary macrophages from TTP(-/-) mice. Our study demonstrates the importance of experimental approaches for identifying targets of RNA-binding proteins.

In situ hybridization to detect bandicoot papillomatosis carcinomatosis virus type 1 in biopsies from endangered western barred bandicoots (Perameles bougainville)

The western barred bandicoot (Perameles bougainville) is an endangered Australian marsupial species in which a papillomatosis and carcinomatosis syndrome occurs. Bandicoot papillomatosis carcinomatosis virus type 1 (BPCV1) is associated with the lesions of this progressively debilitating syndrome. Five digoxigenin-labelled DNA probes were generated for in situ hybridization (ISH) and the technique was optimized and performed on formalin-fixed paraffin-embedded (FFPE) biopsies. Staining of keratinocyte and sebocyte nuclei within lesions was achieved with all five probes. The sensitivity of ISH (76.9%) surpassed that of PCR (30.8%) for FFPE samples. The sensitivity of ISH varied from 81% (papillomas) and 70% (carcinoma in situ) to 29% (squamous cell carcinomas). The specificity of the test was confirmed using an irrelevant probe and papillomas from other species. These results strengthen the association between BPCV1 and the western barred bandicoot papillomatosis and carcinomatosis syndrome and give insight into the biology of the virus-host interaction.

Resistance of the Manila clam ( Venerupis philippinarum) to infection with Mikrocytos mackini

Manila clams ( Venerupis philippinarum) challenged in laboratory trials via bath exposure proved to be resistant to infections with Mikrocytos mackini (protistan parasite of unknown taxonomic affiliation), while Pacific oysters ( Crassostrea gigas) challenged simultaneously using identical conditions developed infections. Although M. mackini was detected by a nucleic acid pathogen specific (PCR) assay in 10–30% of the challenged V. philippinarum that were sampled soon after exposure (0–48 h, n = 40), all of the subsequent V. philippinarum ( n = 62) sampled 9–17 weeks post-exposure tested negative for M. mackini by PCR assay. Prevalence of infection for the exposed C. gigas ( n = 100) during this same period ranged from 50% to 100% by PCR assay. Infection was confirmed in the oysters (58%, n = 60) by a digoxigenin-labelled DNA probe designed to detect M. mackini by in situ hybridization, but M. mackini was not found in any of the exposed Manila clams ( n = 63) using this technique.

Regulation of Secreted Frizzled-related Protein-1 by Heparin

Secreted Frizzled-related protein-1 (sFRP-1) belongs to a class of extracellular antagonists that modulate Wnt signaling pathways by preventing ligand-receptor interactions among Wnts and Frizzled membrane receptor complexes. sFRP-1 and Wnts are heparin-binding proteins, and their interaction can be stabilized by heparin in vitro. Here we report that heparin can specifically enhance recombinant sFRP-1 accumulation in a cell type-specific manner. The effect requires O-sulfation in heparin, and involves fibroblast growth factor-2 as well as fibroblast growth factor receptor-1. Interestingly, further investigation uncovers that heparin can also affect the post-translational modification of sFRP-1. We demonstrate that sFRP-1 is post-translationally modified by tyrosine sulfation at tyrosines 34 and 36, which is inhibited by the treatment of heparin. The results suggest that accumulation of sFRP-1 induced by heparin is in part due to the relative stabilization of unsulfated sFRP-1 and the direct stabilization by heparin. The study has revealed a multifaceted regulation on sFRP-1 protein by heparin.

The use of fluorescein for labeling genomic probes in the checkerboard DNA–DNA hybridization method

Molecular methods that permit the simultaneous detection and quantification of a large number of microbial species are currently employed in the evaluation of complex ecosystems. The checkerboard DNA-DNA hybridization technique enables the simultaneous identification of distinct bacterial species in a large number of dental samples. The original technique employed digoxigenin-labeled whole genomic DNA probes which were detected by chemiluminescence. In this study, we present an alternative protocol for labeling and detecting whole genomic DNA probes in the Checkerboard DNA-DNA hybridization method. Whole genomic DNA was extracted from five bacterial species and labeled with fluorescein. The fluorescein labeled whole genomic DNA probes were hybridized against whole genomic DNA or subgingival plaque samples in a checkerboard hybridization format, followed by chemiluminescent detection. Our results reveal that fluorescein is a viable and adequate alternative labeling reagent to be employed in the checkerboard DNA-DNA hybridization technique.