Determination Of Specific Antibodies Research Articles

Effects of IFN-\u03b3 coding plasmid supplementation in the immune response and protection elicited by Trypanosoma cruzi attenuated parasites

BackgroundPrevious studies showed that a naturally attenuated strain from Trypanosoma cruzi triggers an immune response mainly related to a Th2-type profile. Albeit this, a strong protection against virulent challenge was obtained after priming mice with this attenuated strain. However, this protection is not enough to completely clear parasites from the host. In T. cruzi infection, early Interferon-gamma (IFN-γ) is critical to lead type 1 responses able to control intracellular parasites. Therefore we evaluated whether the co-administration of a plasmid encoding murine IFN-γ could modify the immune response induced by infection with attenuated parasites and improve protection against further infections.MethodsC57BL/6J mice were infected intraperitoneally with three doses of live attenuated parasites in combination with plasmid pVXVR-mIFN-γ. Before each infection dose, sera samples were collected for parasite specific antibodies determination and cytokine quantification. To evaluate the recall response to T. cruzi, mice were challenged with virulent parasites 30 days after the last dose and parasite load in peripheral blood and heart was evaluated.ResultsAs determined by ELISA, significantly increase in T. cruzi specific antibodies response was detected in the group in which pVXVR-mIFN-γ was incorporated, with a higher predominance of IgG2a subtype in comparison to the group of mice only inoculated with attenuated parasites. At our limit of detection, serum levels of IFN-γ were not detected, however a slight decrease in IL-10 concentrations was observed in groups in which pVXVR-mIFN-γ was supplemented. To analyze if the administration of pVXVR-mIFN-γ has any beneficial effect in protection against subsequent infections, all experimental groups were submitted to a lethal challenge with virulent bloodstream trypomastigotes. Similar levels of challenge parasites were detected in peripheral blood and heart of mice primed with attenuated parasites alone or combined with plasmid DNA. Expansion of IgG antibodies was not significant in TCC+ pVXVR-mIFN-γ; however, the overall tendency to sustain a Th2 profile was maintained.ConclusionsOverall, these results suggest that administration of plasmid pVXVR-mIFN-γ could have beneficial effects on host specific antibody production in response to T. cruzi attenuated infection; however, this outcome is not reflected in an improved protection against further virulent infections.

Basic diagnostic tests of IgE dependent and contact allergy

Allergy is a hypersensitive immune response against non-pathogenic external factors that either enters the body or have a direct contact with the skin or mucosa. Diagnosis of allergy is a complex, multi-stage process in which the main role plays medical history analysis of the disease and its confirmation by additional tests, such as skin tests and allergen-specific IgE serum antibody assays. Skin tests can be used, with variable success, in diagnosis of all allergies. However, they have the greatest significance in diagnosing of contact and inhalation allergies. In the diagnosis of atopic, when skin tests are impossible or their results are not consistent with the interview, measurement of serum IgE levels may be very helpful. Determination of specific antibodies is very important in the diagnosis of allergy to insect venom and latex, it could bring supplementary information to food allergies diagnosis. The choice of method therefore depends on the allergy diagnosis and the current knowledge about the sensitivity, specificity and predictive value of the test used, as well as the data obtained in the medical examination, which remains are basis method in allergy diagnosis.

Immunity to endotoxin and Asp299Gly polymorphism of TLR-4 in adult patients with early and late onset of asthma

Aim. The gene polymorphism of Asp299Gly TLR-4 may be associated with the risk of asthma development.Methods and results. The gene polymorphism of TLR-4 (Asp299Gly) receptor has been researched in 262 early-onset and in 69 late-onset asthma patients. The state of anti-endotoxin immunity was assessed by determination of specific antibodies to the endotoxin of A, M, G classes and sCD14 by ELISA. The polymorphism was analyzed by the allele-specific polymerase chain reaction with electrophoretic detection. It was estimated that the risk of early-onset asthma in the population of Crimea is associated with genotypes AG and GG (Asp299Gly) of TLR-4. There were increased levels of anti-endotoxin IgM and decreased of sIgA in patients with late-onset asthma and AA genotype as compared to other genotypes.Conclusion. The gene polymorphism of Asp299Gly TLR-4 is associated with the risk of early-onset asthma development in Crimea population.

The prevalence of antinuclear antibodies in patients with schizophrenia spectrum disorders: results from a large cohort study.

Background:An increased prevalence of autoantibodies has been found in patients with schizophrenia, suggesting a role for autoimmunity in schizophrenia pathogenesis.Methods:We examined the presence of antinuclear antibodies (ANAs), with further determination of specific antibodies, in 368 patients with a schizophrenia spectrum disorder and 283 healthy controls.Results:No significant difference in prevalence of ANAs between patients (8%) and controls (11%) was found.Conclusion:We did not find an association between ANAs and schizophrenia spectrum disorders. We discuss potential reasons for the discrepancy with some previous studies, such as inclusion of patients using chlorpromazine, which can induce ANAs.

Evaluation of HNA-expressing cell line-based antigen capture systems and a solid-phase system for detecting HNA-1a antibodies.

Granulocyte immunofluorescence and granulocyte agglutination tests are standard methods for detecting human neutrophil antigen (HNA) antibodies (Abs); however, these require a typed panel of neutrophils, which can be time-consuming to develop, and it remains difficult to determine antibody specificity in some cases. We established and evaluated four detection systems for HNA-1a Abs based on an HNA-1a-expressing cell line (KY cells) and antigen capture. We additionally evaluated a commercial solid-phase system. Eleven HNA-1a antibody-positive samples, including the World Health Organization Reference Reagent, and 40 serum samples derived from male blood donors were used as positive and negative control samples, respectively. Although specificity was >0.90 in all systems evaluated, the sensitivity varied among the systems. The KY cell-based monoclonal antibody specific immobilisation of granulocyte antigens (KY-MAIGA) system using certain, but not all, monoclonal Abs, and the solid-phase system revealed higher sensitivity than other systems. In conclusion, the KY-MAIGA and commercial solid-phase systems were superior in terms of specific and sensitive detection of HNA-1a Abs.

SEROPREVALENCE OF SOME INFECTIOUS DISEASES IN STRAY DOGS IN THE WIDER TERRITORY OF LESKOVAC CITY

Since the last decade, stray dogs have been signifi cant ecological, economical and sociological problem in the world as well as in the Republic of Serbia. They occupy specifi c place in the ecology of big cities and their contact with human population represents danger since they are carriers of many zoonotic infectious diseases. The goal of this paper is to present epizootiological survey on some diseases of bacterial, viral and parasitic origin through serological investigation of blood sera and full blood. The prevalence of leptospirosis, Tularaemia, West Nile fever and dirofi lariosis has been determined in this research. The material included full blood and blood sera of stray dogs in the wider territory of Leskovac city. The research methods encompassed standard serological tests: microscopic agglutination test (MAT) for determination of specific antibodies against Leptospira spp.; slow and fast agglutination test for determination of antibodies against Tularaemia causative agent (Francisella tularensis); agar gel immunodiff usion (AGID) for detection of specific antibodies against West Nile virus–WNV; modifi ed Knot’s test for the detection of microfilaria. The results revealed seropositivity for causative agents of Leptospirosis, Tularaemia and dirofi lariosis, while there were no positive findings for WNV.

High-resolution melting analysis as an alternative method for human neutrophil antigen genotyping

Abstract Human neutrophil antigen (HNA)-typed granulocyte panels are widely used to screen for the presence of HNA antibodies and to determine antibody specificity. Many laboratories screen donors for HNA genotypes using low-throughput methods such as allele-specific polymerase chain reaction (PCR), PCR–restriction fragment–length polymorphism, and multiplex PCR. In the present study, we used a high-resolution melting (HRM) analysis to determine HNA genotypes. For the HRM analysis, purified genomic DNA samples were amplified via PCR with HNA-specific primers. Nucleotide substitutions in genes encoding HNAs were differentiated on the basis of the HRM curves, and the results of HRM and DNA sequencing analyses were determined to be in complete agreement. The gene frequency of HNA-1a, -1b, -1c, -3a, -3b, -4a, -4b, -5a, and -5b in the Japanese population was consistent with the previous reports. Our results suggest that HRM analysis can be used for genotyping HNA antigens determined by single nucleotide substitutions. Immunohematology 2015;31:7–13.

Immunoglobulin heavy chain variable region and major histocompatibility region genes are linked to induced graves' disease in females from two very large families of recombinant inbred mice.

Graves' hyperthyroidism is caused by antibodies to the TSH receptor (TSHR) that mimic thyroid stimulation by TSH. Stimulating TSHR antibodies and hyperthyroidism can be induced by immunizing mice with adenovirus expressing the human TSHR A-subunit. Prior analysis of induced Graves' disease in small families of recombinant inbred (RI) female mice demonstrated strong genetic control but did not resolve trait loci for TSHR antibodies or elevated serum T4. We investigated the genetic basis for induced Graves' disease in female mice of two large RI families and combined data with earlier findings to provide phenotypes for 178 genotypes. TSHR antibodies measured by inhibition of TSH binding to its receptor were highly significantly linked in the BXD set to the major histocompatibility region (chromosome 17), consistent with observations in 3 other RI families. In the LXS family, we detected linkage between T4 levels after TSHR-adenovirus immunization and the Ig heavy chain variable region (Igvh, chromosome 12). This observation is a key finding because components of the antigen binding region of Igs determine antibody specificity and have been previously linked to induced thyroid-stimulating antibodies. Data from the LXS family provide the first evidence in mice of a direct link between induced hyperthyroidism and Igvh genes. A role for major histocompatibility genes has now been established for genetic susceptibility to Graves' disease in both humans and mice. Future studies using arrays incorporating variation in the complex human Ig gene locus will be necessary to determine whether Igvh genes are also linked to Graves' disease in humans.

Advances in granulocyte test methodologies

AbstractAlloantibodies to human neutrophil antigens (HNA) are involved in clinical conditions such as neonatal alloimmune neutropenia (NAN), autoimmune neutropenia (AIN) and transfusion‐related acute lung injury (TRALI). For the diagnosis of these conditions, the detection of the causative antibody is essential. Presently, the use of a combination of granulocyte agglutination assay (GAT) and granulocyte immunofluorescence test (GIFT) for the screening of granulocyte antibodies, followed by the determination of antibody specificity by the monoclonal antibody‐specific immobilization of granulocyte antigens (MAIGA) is recommended by the ISBT Working Party on Granulocyte Immunobiology. In Japan, the mixed‐passive hemagglutination (MPHA) assay, a method originally developed for the detection of anti‐platelet antibodies, was adapted for the testing of anti‐granulocyte antibodies. Although various technologies are available, presently, no one of the methods alone is able to detect all clinically relevant antibodies, thus their combination is important, and the development of new methodologies is desired. In this review, we describe the presently available classical methods for anti‐granulocyte antibody detection, including GIFT, GAT, MAIGA and MPHA, and also the new technologies, especially focusing on the advantages and problems of the different methods.

Native flagellin does not protect mice against an experimental Proteus mirabilis ascending urinary tract infection and neutralizes the protective effect of MrpA fimbrial protein.

Proteus mirabilis expresses several virulence factors including MR/P fimbriae and flagella. Bacterial flagellin has frequently shown interesting adjuvant and protective properties in vaccine formulations. However, native P. mirabilis flagellin has not been analyzed so far. Native P. mirabilis flagellin was evaluated as a protective antigen and as an adjuvant in co-immunizations with MrpA (structural subunit of MR/P fimbriae) using an ascending UTI model in the mouse. Four groups of mice were intranasally treated with either MrpA, native flagellin, both proteins and PBS. Urine and blood samples were collected before and after immunization for specific antibodies determination. Cytokine production was assessed in immunized mice splenocytes cultures. Mice were challenged with P. mirabilis, and bacteria quantified in kidneys and bladders. MrpA immunization induced serum and urine specific anti-MrpA antibodies while MrpA coadministered with native flagellin did not. None of the animals developed significant anti-flagellin antibodies. Only MrpA-immunized mice showed a significant decrease of P. mirabilis in bladders and kidneys. Instead, infection levels in MrpA-flagellin or flagellin-treated mice showed no significant differences with the control group. IL-10 was significantly induced in splenocytes of mice that received native flagellin or MrpA-flagellin. Native P. mirabilis flagellin did not protect mice against an ascending UTI. Moreover, it showed an immunomodulatory effect, neutralizing the protective role of MrpA. P. mirabilis flagellin exhibits particular immunological properties compared to other bacterial flagellins.

Probing Antibody-Antigen Interactions

Antibodies are biological molecules generated by the host immune system in response to the invasion of foreign bodies or antigens. Therefore, antibodies must possess high specificity toward target antigens in order for the antigen to be recognized and subsequently destroyed. Because of this specificity, antibodies or antibody fragments that maintain binding specificity are heavily used in diagnostic assays and are becoming increasingly important in many therapeutic applications. Classical immunoassays such as radioimmunoassay and enzyme-linked immunosorbent assay are effective analytical techniques that have been widely used to screen and determine antibody specificity. Because of increased demands for antibodies with well-defined specificities, other techniques have been developed that facilitate generation and characterization of antibody-binding specificities under different conditions, such as when the protein is expressed on a cell surface or the target antigen is hard to isolate. Here, we describe three alternate techniques that provide unique abilities to characterize antibody-antigen binding events: (i) surface plasmon resonance, (ii) fluorescence activated cell sorting, and (iii) atomic force microscopy. These different techniques take advantage of various changes in physical and/or chemical properties of the analytes that occur upon binding, such as refractive index, surface charge, and changes in structure. These techniques provide unique powerful advantages over traditional immunoassays including real-time and label-free detection, low sample volume and concentration requirements, and molecular-level detection sensitivity. This article provides an overview of how these alternate approaches to studying antibody-antigen interactions can be used to facilitate rapid development of new antibody-based reagents for diagnostic and therapeutic applications.

Correction: The miR-30 MicroRNA Family Targets smoothened to Regulate Hedgehog Signalling in Zebrafish Early Muscle Development

There is an incorrect sequence listed in the Microinjections section of the Materials and Methods. The corrected section is: Fertilized one-cell zebrafish embryos were injected with 6 ng miR-30 morpholino in 1 nl (TGCACCAGCTTCCAGTCAAGGATGTTTACAG), 50 pg of miR-30 duplex RNA and 50 pg in vitro-transcribed capped GFP mRNAs. Zebrafish smoothened 3′UTR sequence was amplified by RT-PCR and subcloned downstream of the GFP ORF that was inserted into vector pCS2+. A morpholino designed against smoothened was used to determine antibody specificity, (GAGGACATCTTGGAGACGCAACAAA) and injected at 2.5 ng per embryo (Fig. S3). The smoothened target protector sequence was GTGTATGTAAACACCATAAACTGAC and was injected at 9 ng/embryo.

Reference ranges and cutoff levels of pneumococcal antibody global serum assays (IgG and IgG2) and specific antibodies in healthy children and adults

Pneumococcal antibodies represent the acquisition of natural immunity. Determination of pneumococcal antibodies is an important screening tool for immunodeficiencies. Our study generated reference ranges and cutoff levels for pneumococcal antibody global serum assays correlated to a specific pneumococcal antibody ELISA. Specific pneumococcal antibody levels were measured from 457 children undergoing elective surgery and 46 healthy adult volunteers (88 with previous pneumococcal immunization from both groups), 22 severe immunodeficient subjects with ataxia telangiectasia (A-T, negative controls), and age-matched 36 healthy allergic asthmatics. We determined a representative panel of serotype-specific pneumococcal antibodies (serotype 4, 5, 6B, 7F, 14, 18C, 19F, 23F) by ELISA and global pneumococcal IgG and IgG2 antibodies by EIA. In vaccine-naïve healthy subjects, initial pneumococcal IgG geometric mean concentrations of 13.1 μg/ml were low in the first year of life and increased over the time, reaching adult levels (70.5 μg/ml) at age 8-12 years. In parallel, IgG2 antibodies increased from 20.7 % (0.5-1 year old) to adult proportions (>30 %) in preschoolers. Correlation between the pneumococcal IgG screening assay and specific pneumococcal antibody levels was acceptable (Pearson's coefficient r = 0.4455; p = 0.001). Cutoff levels showed high sensitivity, whereas specificity was high to moderate calculated from correlations with the specific ELISA. We provide reference ranges and cutoff levels for the interpretation of specific antibody determinations in the clinical setting. The global pneumococcal IgG/IgG2 assay is a suitable screening tool and correlates with the ELISA serotype-specific pneumococcal antibodies. However, results below our cutoff values should be re-evaluated by serotype-specific ELISA testing.

RNA Targets and Specificity of Staufen, a Double-stranded RNA-binding Protein in Caenorhabditis elegans

The Staufen family consists of proteins that possess double-stranded RNA-binding domains (dsRBDs). Staufen proteins of Drosophila and mammals regulate mRNA localization, translation, and decay. We report analysis of Staufen in Caenorhabditis elegans, which we have designated STAU-1. We focus on its biochemical properties, mRNA targets, and possible role in RNAi. We show that STAU-1 is expressed as mRNA and protein at all stages of C. elegans development. The wild-type, full-length protein, purified from bacteria, binds duplex RNA with high affinity in vitro. Purified, mutant proteins lacking single dsRBDs still bind RNA efficiently, demonstrating that no single domain is required for binding to duplex RNA (although dsRBD2 could not be tested). STAU-1 mRNA targets were identified via immunoprecipitation with specific anti-STAU-1 antibodies, followed by microarray analysis (RIP-Chip). These studies define a set of 418 likely STAU-1 mRNA targets. Finally, we demonstrate that stau-1 mutants enhance exogenous RNAi and that stau-1;eri-1 double mutants exhibit sterility and synthetic germ line defects.

Degradation of an Old Human Protein

Long-lived proteins exist in a number of tissues in the human body; however, little is known about the reactions involved in their degradation over time. Lens proteins, which do not turn over, provide a useful system to examine such processes. Using a combination of Western blotting and proteomic methodology, age-related changes to a major protein, γS-crystallin, were studied. By teenage years, insoluble intact γS-crystallin was detected, indicative of protein denaturation. This was not the only change, however, because blots revealed evidence of significant cross-linking as well as cleavage of γS-crystallin in all adult lenses. Cleavage at a serine residue near the C terminus was a major reaction that caused the release of a 12-residue peptide, SPAVQSFRRIVE, which bound tightly to lens cell membranes. Several other crystallin-derived peptides with double basic residues also lodged in the cell membrane fraction. Model studies showed that once cleaved from γS-crystallin, SPAVQSFRRIVE adopts a markedly different shape from that in the intact protein. Further, the acquired helical conformation may explain why the peptide seems to affect water permeability. This observation may help explain the changes to cell membranes known to be associated with aging in human lenses. Age-related cleavage of long-lived proteins may therefore yield peptides with untoward biological activity.

Development and applications of simultaneous immunochemical staining and serial detection of overlapping proteins in blotting procedures

Immunoblotting techniques are widely used for specific protein identifications and characterizations. The specific bindings of antibodies to epitopes in a protein sequence permits determination of antigens and gives detailed information about protein compositions and expression levels in complex suspensions. However the techniques are mostly restricted to one specific antibody determination. Overlaying proteins are detected using numerous repeated gel runs. For multiple but specific protein determinations on one immunoblot, here we describe the detection of several antigens by simultaneous incubation of antibodies originated from different species followed by sequential addition of secondary antibodies labelled with horseradish peroxidase (HRP) and binding to analogous primary antibodies. Particular signals were visualized step by step using a HRP chemiluminescence substrate while enzymatic HRP reactions were meanwhile inactivated irreversibly by hydrogen peroxide incubation. We demonstrate flexible applications of multiple antigen detections using the Western blotting technique with determination of the CNS protein markers neuron specific enolase, glial fibrillary acid protein and the physiological prion protein (PrPC) in brains and in meats as food contaminations and with glycotyping of PrPC using antibodies binding to different epitopes. We showed the use of the dot blotting technique with serial determination of different antigens in complex protein suspensions. The method is easy to handle and is flexible and applicable in the fields of diagnostics and public health for detection of overlaying proteins on one immunoblot.

10-P

Many sensitized transplant patients have HLA-specific antibodies due to previous graft failures, blood transfusions, and pregnancies. These humoral responses are typically polyclonal in nature, antibody composition is distinct to each individual, and it is difficult to precisely determine antibody specificity. Distinct antibodies cannot be readily isolated for individual characterization. In this study we isolate distinct anti-HLA antibodies to evaluate their phenotypic and functional traits. After characterizing sera from highly sensitized patients with a single antigen assay, sera were passed over HLA-specific separation devices made by coupling purified soluble HLA to a sepharose matrix. A scheme of multiple separation rounds involving loading and elution cycles with different HLA allele combinations was applied. This process resulted in mono-specific patterns of HLA reactivity measured by a Luminex-based bead assay. Our results show that complex patterns of sera reactivity can be reduced to more simplified outputs allowing better interpretation of individual antibody populations. Separation of IgG, IgA, and IgM further assisted in the interpretation of these responses. Furthermore, this technique was also of use in evaluating false positive/negative assay signals, strengthening otherwise weak antibody reactivity, and eliminating background interference. Antibody concentration, isotype, epitope specificity, cross-reactivity, and the ability to fix complement have all been implicated as factors that contribute to the pathogenicity of anti-HLA antibodies following organ transplantation. The deconvolution of antibody reactivity patterns can assist in the assessment of risk factors for immunologic rejection as well as provide new insights into anti-HLA antibody profiling and epitope structure analysis.

Mycoplasma pneumoniae: IgG and IgM antibody response in presence of different antigens. Evaluation of commercial tests

Background. P1 adhesin protein (170-kDa) is responsible for the interaction between M. pneumoniae and the host. Such protein is the target of specific antibodies produced by the host in response to M. pneumoniae infection. Objectives. The aim of this study was to evaluate the performance of serological tests for Mycoplasma pneumoniae IgG and IgM on chemiluminescence analyzer LIAISON® and to demonstrate how the determination of specific antibodies is the main tool for accurate diagnosis of Mycoplasma infection. Study Design. Eighty-one unselected samples were assayed by ELISA kits Vircell IgG and IgM (bacterial lysate) and LIAISON® Mycoplasma IgG and IgM (recombinant protein P1). The discordant samples were tested with ELISA Savyon Serorecombinant IgG and IgM (recombinant protein P1) and reclassified according to the consensus rule. Results. Fifty-one samples were concordant between ELISA Vircell IgG and LIAISON® Mycoplasma IgG. After resolution of the 30 discordant: twenty-eight samples were classified concordant negative and one positive. Seventy-seven samples were concordant between ELISA Vircell IgM and LIAISON® Mycoplasma IgM. After resolution of 4 discordant samples: three samples were classified as negative. Conclusions. The higher correlation between LIAISON® and Savyon Serorecombinant is determined by the use of recombinant protein P1 in the solid phase and the type of cut-off calculation allows high specificity and sensitivity. The Mycoplasma pneumoniae IgG and IgM kits, performed in full automation on LIAISON® analyzer, show characteristics comparable to other kits and an easy handling of the sample.

Evaluación de la técnica PCR anidada para el diagnóstico de la esporotricosis experimental

BackgroundSporotrichosis caused by the dimorphic fungus Sporothrix schenckii can presents in a variety of clinical forms. Routine diagnosis is made by mycology and serology studies. Few investigations have been focused on the evaluation of the molecular diagnosis. AimTo determine the value of the nested PCR technique for the diagnosis of experimental sporotrichosis in organs of mice, and to compare the results with the established laboratory diagnostic procedures. MethodsBALB/c mice were inoculated with growing concentrations of the 2 morphological phases of the fungus. The infected animals were sacrificed one month later and specimens from liver, spleen, lung and testicle were obtained to perform wet mount, culture and molecular diagnosis by the nested PCR technique. Blood samples were obtained for determination of specific antibodies against S. schenckii by the double immunodiffusion procedure. ResultsThe pathogenicity observed with the different concentrations of the fungus inoculated and its isolation by culture, showed scarce differences in the study of specimens from organs infected with the 2 morphological phases of S. schenckii. Specimens from organs of mice inoculated with the mycelial phase when studied by wet mount and culture, showed a higher positivity (100 and 37.5%) than those from mice inoculated with the yeast phase (73 and 2%). However, diagnosis by the nested PCR molecular technique applied to the latter specimens showed a higher percentage of positivity (75%) and 43% of positive results coming from animals infected with the mycelial phase. Specific antibody detection was positive in 100% all groups of infected mice. ConclusionsIn the study of experimental sporotrichosis in mice, the culture, as well as the antibody detection, was an effective diagnostic procedure, while the nested PCR and microscopic studies had a lower diagnostic value.

Modifiers of complement activation for prevention of antibody-mediated injury to allografts

Improvements in prevention and management of cellular rejection of solid organ transplants, coupled with increasing numbers of sensitized patients, have focused attention on antibody-mediated rejection (AbMR). Complement is a critical component of AbMR, in addition to interfacing between innate and adaptive immunity and the coagulation cascade. This article reviews complement biology and strategies to overcome complement in AbMR, cognisant that antibody can act independently of complement. The past decade has witnessed an improvement in the prevention and treatment of AbMR as a result of solid-phase assays to determine antibody specificity, definition of histopathological criteria, and use of plasmapheresis and/or intravenous immunoglobulin (IVIG). Nonetheless, AbMR continues to impact adversely on short- and long-term graft survival. Use of B and/or T-lymphocyte-depleting therapies has not shown measurable benefit, and the need remains for therapies that deplete antibody, or provide better protection from complement-mediated damage. Disordered complement activity in human diseases such as paroxysmal nocturnal haemoglobinuria, has provided additional impetus to pursuing therapeutic complement inhibition. Preliminary data from C5 inhibition with eculizumab in the treatment and prevention of AbMR have shown promise. Trials with recombinant human inhibitors of C1 (effective in angioedema) to prevent or treat AbMR are beginning. Despite current limitations, 'protection' of the transplant through plasmapheresis and/or IVIG enables many allografts to survive in sensitized recipients. Elucidating the pathways mediating graft acceptance, by constitutive antibody deletion, or 'accommodation' (wherein donor organ remains uninjured despite antibody binding), or other local protective mechanism(s), is an equally important challenge in the quest to overcome AbMR.