Detection Of Viroid Research Articles

Elimination of chrysanthemum stunt viroid and chrysanthemum chlorotic mottle viroid from infected chrysanthemum by cryopreservation

Chrysanthemum morifolium 'Borami' and 'Secret Pink' showing symptoms of stunt disease caused by chrysanthemum stunt viroid (CSVd) and 'Yellow Cap' showing chlorotic mottle disease caused by chrysanthemum chlorotic mottle viroid (CChMVd) were confirmed to be infected by the respective viroids by using reverse transcription polymerase chain reaction (RT-PCR). Real-time PCR results showed that the viroid concentrations in the infected cultivars varied between the different regions of origin (Chilgok, Gumi, and Gyeongsan). We applied a cryopreservation protocol for elimination of CSVd from naturally infected 'Borami' collected from Gumi, showing the lowest concentration of CSVd, by varying several factors such as plant vitrification solutions (PVS2 and PVS3), duration of exposure to liquid nitrogen, shoot-tip size, and low-temperature treatment. The solution (PVS2) and low-temperature treatment were found to be critical factors determining the efficacy of viroid elimination. We optimized the protocol by combining of all resulted optimal factors and tested the applicability of the protocol in 'Borami' collected from Chilgok and Gyeongsan and in 'Secret Pink' from Chilgok, Gumi, and Gyeongsan, which displayed different viroid concentrations. We found that the elimination rates varied depending on the cultivar and region of origin. Similar results were observed when the protocol was applied to eliminate CChMVd from the 'Yellow Cap' collected from the same regions. Finally, we found that nested PCR is more reliable for viroid detection than RT-PCR. Overall, cryopreservation can be used to eliminate viroids from infected chrysanthemums; however, the efficacy depends on genotype and initial viroid concentration.

Simultaneous detection of Tomato spotted wilt virus, Dahlia mosaic virus and Chrysanthemum stunt viroid by multiplex RT-PCR in dahlias and their distribution in Japanese dahlias.

Tomato spotted wilt virus (TSWV), Dahlia mosaic virus (DMV) and Chrysanthemum stunt viroid (CSVd) are economically important viruses and viroid that infect cultivated dahlias. Prior to this investigation, no multiplex RT-PCR assay for the detection of dahlia virus and viroid infections existed. In this study, we report the development of a multiplex RT-PCR that simultaneously detects TSWV, DMV and CSVd infections in dahlias. In addition, a simple RT-PCR method that does not require RNA extraction, microtissue direct RT-PCR, could be used to prepare samples for analysis by this multiplex RT-PCR. A field survey validated our results, indicating that TSWV was the dominant virus found in the Kansai region, DMV in the Tohoku and Kyushu regions, and CSVd in the Hokkaido region. This method represents a rapid, sensitive and cost effective approach to diagnose viral infections in dahlias. The multiplex RT-PCR assay described in this study is the first report of simultaneous detection of virus and viroid in dahlia. This method represents a rapid, sensitive and cost effective approach to diagnose viral infections in dahlias. A field survey validated our results, indicating that TSWV was the dominant virus found in the Kansai region, DMV in the Tohoku and Kyushu regions and CSVd in the Hokkaido region.

Development of a duplex one-step RT-qPCR assay for the simultaneous detection of Apple scar skin viroid and plant RNA internal control

Apple scar skin viroid (ASSVd) is an important quarantine pathogen for international movement of pome germplasm as it can cause significant damage to pip fruit. A one-step real-time RT-PCR assay was developed for the rapid and sensitive detection of ASSVd. The assay was able to detect a wide range of ASSVd isolates and was highly specific compared to a published conventional RT-PCR. The detection limit of the new assay was estimated to be about 100 copies of the ASSVd target. The assay can be run as a duplex with the nad5 internal control primers and probe to simultaneously check the PCR competency of the samples therefore reducing the risk of false negatives. It is expected that this real-time RT-PCR assay will facilitate efficient testing for ASSVd by regulatory services, and will also have a wider use for the general detection of ASSVd in a range of pip fruit.

Detection of PSTVd and TCDVd in seeds of tomato using real‐time RT‐PCR

Worldwide outbreaks of pospiviroids in potato and tomato have increased the need for a reliable test for the detection of pospiviroids in seeds. This study describes the development and validation of a sensitive and fast test for the detection of Potato spindle tuber viroid (PSTVd) and Tomato chlorotic dwarf viroid (TCDVd) in tomato seeds. The test is based on RNA isolation using a commercial kit and is suitable for routine application. The test is able to detect one PSTVd or TCDVd contaminated seed in sub samples of 1000 seeds and results were both repeatable and reproducible.

Evaluation of viroid extraction methods and application of a one-step reverse transcription real-time polymerase chain reaction assay (RT-qPCR) for the rapid detection of Chrysanthemum stunt viroid (CSVd) infection

Early viroid detection in chrysanthemum cultivars depends on both an efficient RNA extraction method as well as a sensitive detection assay. In this study, we evaluated RNA purification methods and optimized a one-step RT-qPCR assay for the detection of Chrysanthemum stunt viroid (CSVd). Three commercially available RNA extraction technologies (silica and silicon carbide spin column as well as the phenol/chloroform extraction) were compared for efficacy in CSVd detection sensitivity. We found a 10- to 50-fold improvement in CSVd detection sensitivity when using silicon carbide (SiC) spin columns to purify RNA compared with the silica-based column or the traditional phenol/chloroform extraction method. To optimize detection sensitivity and reduce detection time, a commercial CSVd end-point PCR primer set was adapted to a SYBR Green based one-step RT-qPCR assay. Standard curve analysis estimated that the limit of detection was about 54 CSVd copies and the specificity test against six related viroids showed no cross-reactivity. As a part of the validation, the one-step RT-qPCR detection system was compared with RT-PCR to detect CSVd in both randomly selected greenhouse plants and mechanically inoculated chrysanthemum varieties. Cultivars selected from a commercial greenhouse with >50% infection levels were tested for CSVd presence. Cultivars ‘Pelee’, ‘Puma’ and ‘Shamrock’ tested positive by both the one step RT-qPCR and RT-PCR but CSVd was not detected in ‘Icecap’ and ‘Snowball’. In mechanical inoculation studies, CSVd was detected in 5 of 6 chrysanthemum cultivars – ‘Chesapeake’, ‘Durango’, ‘Juneau’, ‘Pelee’ and ‘Viron’ but not in ‘Pueblo’. No differences in detection were evident between the RT-qPCR and RT-PCR methods.

Multiplex detection, distribution, and genetic diversity of Hop stunt viroid and Citrus exocortis viroid infecting citrus in Taiwan

BackgroundTwo citrus viroids, Citrus exocortis viroid (CEVd) and Hop stunt viroid (HSVd), have been reported and become potential threats to the citrus industry in Taiwan. The distributions and infection rates of two viroids have not been investigated since the two diseases were presented decades ago. The genetic diversities and evolutionary relationships of two viroids also remain unclear in the mix citrus planted region.MethodsMultiplex RT-PCR was used to detect the two viroids for the first time in seven main cultivars of citrus. Multiplex real-time RT-PCR quantified the distributions of two viroids in four citrus tissues. Sequence alignment and phylogenetic analysis were performed using the ClustalW and MEGA6 (neighbor-joining with p-distance model), respectively.ResultsHSVd was found more prevalent than CEVd (32.2% vs. 30.4%). Both CEVd and HSVd were commonly found simultaneously in the different citrus cultivars (up to 55%). Results of the multiplex quantitative analysis suggested that uneven distributions of both viroids with twig bark as the most appropriate material for studies involving viroid sampling such as quarantine inspection.Sequence alignment against Taiwanese isolates, along with analysis of secondary structure, revealed the existence of 10 and 5 major mutation sites in CEVd and HSVd, respectively. The mutation sites in CEVd were located at both ends of terminal and variability domains, whereas those in HSVd were situated in left terminal and pathogenicity domains. A phylogenetic analysis incorporating worldwide viroid isolates indicated three and two clusters for the Taiwanese isolates of CEVd and HSVd, respectively.ConclusionsModerately high infection and co-infection rates of two viroids in certain citrus cultivars suggest that different citrus cultivars may play important roles in viroid infection and evolution. These data also demonstrate that two multiplex molecular detection methods developed in the present study provide powerful tools to understand the genetic diversities among viroid isolates and quantify viroids in citrus host. Our field survey can help clarify citrus-viroid relationships as well as develop proper prevention strategies.

Duplex realtime RT-PCR assay for the detection of Potato spindle tuber viroid (PSTVd) along with ef 1-α gene of potato

SYBR green based realtime RT-PCR assay coupled with melt curve analysis was developed for the detection of Potato spindle tuber viroid (PSTVd) along with and without internal control from potato. The amplification of the specific targets was identified by their melting points viz., 85.93±0.22, 85.62±0.34 and 82.07±0.23 for primer pairs PSTVd-1F/PSTVd-1R, PSTVd-NFP/PSTVd-NRP and PSTVd-QFP1/PSTVd-QRP1, respectively. The realtime RT-PCR assay was 1×104 times more sensitive than RT-PCR assay and the assay could detect up to 20 copies of the target using serially diluted plasmid and up to 0.025 fg of total RNA from infected tissues diluted in healthy plant RNA. Duplex realtime RT-PCR assay was also standardized to detect PSTVd along with elongation factor 1- α (ef-1α) gene, a stable housekeeping gene of potato. Duplex realtime RT-PCR assay showed two melt peaks indicating the successful amplification both the PSTVd RNA and internal control RNA. The developed assays could consistently detect PSTVd and proved to be highly sensitive and rapid for the detection of PSTVd in post entry quarantine testing.

Detection of Potato spindle tuber viroid and Other Related Viroids by a DIG Labelled RNA Probe.

Viroids can cause diseases of considerable economic importance; in Europe the main concern is with pospiviroids that may affect the tomato and potato industries. Methods for detection are required that are both sensitive and robust. The detection method described here is a probe hybridization method with a commercially available digoxigenin (DIG) labelled full-length Potato spindle tuber viroid (PSTVd) RNA probe. This method detects PSTVd and all other known pospiviroids.

One-step multiplex quantitative RT-PCR for the simultaneous detection of viroids and phytoplasmas of pome fruit trees

A one-step multiplex real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR) based on TaqMan chemistry was developed for the simultaneous detection of Pear blister canker viroid and Apple scar skin viroid along with universal detection of phytoplasmas, in pome trees. Total nucleic acids (TNAs) extraction was performed according to a modified CTAB protocol. Primers and TaqMan MGB probes for specific detection of the two viroids were designed in this study, whereas for phytoplasma detection published universal primers and probe were used, with the difference that the later was modified to carry a MGB quencher. The pathogens were detected simultaneously in 10-fold serial dilutions of TNAs from infected plant material into TNAs of healthy plant up to dilutions 10−5 for viroids and 10−4 for phytoplasmas. The multiplex real-time assay was at least 10 times more sensitive than conventional protocols for viroid and phytoplasma detection. Simultaneous detection of the three targets was achieved in composite samples at least up to a ratio of 1:100 triple-infected to healthy tissue, demonstrating that the developed assay has the potential to be used for rapid and massive screening of viroids and phytoplasmas of pome fruit trees in the frame of certification schemes and surveys.

Detection, distribution, and genetic diversity of Australian grapevine viroid in grapevines in India.

Australian grapevine viroid (AGVd) is a viroid specific to grapevine with the least records in the world till date. Here, we report for the first time the presence of AGVd in grapevines in Indian sub-continent. The overall infection rate of AGVd in major grapevine producing areas in India was 9.3%, which is conspicuously higher than the other regions of the world except for Tunisia and Iran. To understand the AGVd diversity in India, the genetic divergence was examined based on the disparity in the cultivars and the locations. Nucleotide sequence analysis revealed the existence of five major AGVd variants in India besides other 44 minor variants implying the "quasi-species" nature. Further, sequence alignment of all the Indian AGVd variants along with Australian type species underscored the presence of eleven mutation points which are archetypal for Indian AGVd, irrespective of the region, and cultivar of grapevines. Plotting of Indian AGVd sequence variants against Australian type species unveiled that all these eleven mutations are distributed on upper and lower left terminal and pathogenicity regions of the molecule. Phylogenetic analysis divulged all the major Indian AGVd variants formed two distinct clusters, suggesting the two separate evolutionary lineages of AGVd in Indian viticulture.

Application of Next-Generation Sequencing Technology for Plant Virus Identification

Next-generation sequencing technology (NGS) has been used as a powerful tool for studies on plant pathogens, especially for plant virus identification. NGS is sequence-independent and culture-independent approach, which can be used for detection of RNA viruses, DNA viruses and viroid simultaneously in a plant sample which contains very low titers. Diagnostic for plant viruses is easy by using this revolutionary technology. In the past few years, NGS has been successfully used for survey and identification of viruses in numerous plant species. In this review, we discuss the application and future perspective of NGS in plant virus identification.

Detection of Coconut cadang-cadang viroid (CCCVd) in oil palm by reverse transcription loop-mediated isothermal amplification (RT-LAMP)

A reverse transcription loop-mediated isothermal amplification (RT-LAMP) detected Coconut cadang-cadang viroid (CCCVd) within 60min at 60°C in total nucleic acid extracted from oil palm leaves infected with CCCVd. Positive reactions showed colour change from orange to green in the reaction mix after the addition of fluorescent reagent, and a laddering pattern band on 2% agarose gel electrophoresis. Conventional RT-PCR with LAMP primers produced amplicons with a sequence identical to the 297-nt CCCVd oil palm variant with the primers being specific for CCCVd and not for other viroids such as PSTVd and CEVd. RT-LAMP was found to be rapid and specific for detecting oil palm CCCVd.

Application of a modified EDTA-mediated exudation technique and guttation fluid analysis for Potato spindle tuber viroid RNA detection in tomato plants (Solanum lycopersicum)

Potato spindle tuber viroid (PSTVd) is a small plant pathogenic circular RNA that does not encode proteins, replicates autonomously, and traffics systemically in infected plants. Long-distance transport occurs by way of the phloem; however, one report in the literature describes the presence of viroid RNA in the xylem ring of potato tubers. In this study, a modified method based on an EDTA-mediated phloem exudation technique was applied for detection of PSTVd in the phloem of infected tomato plants. RT-PCR, nucleic acid sequencing, and Southern blot analyses of RT-PCR products verified the presence of viroid RNA in phloem exudates. In addition, the guttation fluid collected from the leaves of PSTVd-infected tomato plants was analyzed revealing the absence of viroid RNA in the xylem sap. To our knowledge, this is the first report of PSTVd RNA detection in phloem exudates obtained by the EDTA-mediated exudation technique.

First Reports of Potato spindle tuber viroid on Solanum jasminoides and of Tomato apical stunt viroid on Solanum rantonnetti in Poland.

Potato spindle tuber viroid (PSTVd) has a quarantine status in the EU whereas Tomato apical stunt viroid (TASVd) is listed in the EPPO Alert list. During 2007 to 2012 surveys for the presence of PSTVd in 299 ornamental plants of the family Solanaceae (including Solanum jasminoides, S. rantonnetti, Brugmansia sp. and Petunia sp.) were carried out in Poland. The availability of a Pospiviroid genus-specific primer pair (1), which allows for the detection of the most prevalent viroids in ornamental plants by RT-PCR, has facilitated surveys of ornamental plants for pospiviroids. Fifteen S. rantonnetti and twenty-one S. jasminoides plants were sampled randomly and tested. Samples originated from seven different Polish provinces. Total RNA extraction was performed from plant leaves using Master Pure RNA Purification Kit (Epicentre). The obtained RNAs were further used for RT-PCR amplification using SuperScript One-Step RT-PCR System with PlatinumTaq DNA Polymerase (Invitrogen) kit according to the manufacturer's instructions. The Pospiviroid genus-specific primer set Vir1 5'CTTCAGTTGTTTCCACCGGGTAG 3' /Vir2 5'TTCCTGTGGTGCACTCCTGACC 3' (1), was used to amplify a 262-bp RT-PCR product. In addition, three positive samples were tested using PSTVd specific primers 3H1 5' ATCCCCGGGGAAACCTGGAGCGAAC3' /2H1 5'CCCTGAAGCGCTCCTCCGAG 3' (2,4) that amplified the 360-bp product. The presence of RT-PCR products of the expected size was confirmed in two S. jasminoides samples using both primer pairs. One positive sample of S. jasminoides in the testing season 2007/2008 was collected in Zachodniopomorskie Province. The second sample was collected in 2009 in the Lubuskie region. The obtained products were cloned into pGEM-Teasy vector and sequenced using M13F and M13R primers. The sequence comparison using MEGA5 software (3) revealed that both isolates were identical to each other and shared 98 to 100% sequence identity with other PSTVd isolates described to date. The obtained sequence was deposited in the GenBank database (Accession No. KC707563). In addition, in 20 samples of Solanaceae spp. collected in 2012, the presence of an RT-PCR product of 262 bp, typical for Pospiviroids, was shown in one sample of S. rantonnetti collected in Lubuskie Province. Sequencing of the PCR product identified TASVd, and the sequence has been deposited in GenBank (KC707564). Sap derived from PSTVd- and TASVd-positive samples was used to mechanically inoculate tomato plants (variety Moneymaker). In total, 25 plants were inoculated with PSTVd and 25 with TASVd. After 3 weeks, most of the tomato plants displayed growth reduction and distortion. Inoculated tomato plants were sampled and tested by RT-PCR for the presence of viroids and all obtained products were subjected to sequencing. The obtained sequences were identical with original ones. The viroids detected in the two Solanum sp. appeared to be efficiently transmitted to tomato, as 80% of the inoculated plants tested positive by RT-PCR. These results suggest that ornamental plants might act as a source of inocula for tomato or potato crops even if they do not display any visible symptoms. TASVd-infected S. rantonnetti was introduced to Poland from the Netherlands, while the origin of the PSTVd positive S. jasminoides is uncertain. Official eradication measures were imposed due to the detection of viroids in ornamental plants in Poland.

Diagnostic real-time RT-PCR for the simultaneous detection of Citrus exocortis viroid and Hop stunt viroid

Citrus exocortis viroid (CEVd) and Hop stunt viroid (HSVd) are two important viroids known to infect several plant species worldwide. In this study, a real-time reverse transcription (RT) TaqMan polymerase chain reaction (PCR) assay was developed and optimized for the simultaneous detection of CEVd and HSVd. The assay's analytical and diagnostic sensitivity and specificity were evaluated using reference isolates. Two different RNA extraction methods and one rapid crude template preparation procedure were compared in terms of extraction purity and efficiency for PCR applications. Extraction method Q included a commercially available kit, whereas method C was a modified chloroform-phase extraction in house protocol. Procedure S involved blotting the sap extract on a positively charged nylon membrane and elution. The multiplex RT-TaqMan PCR assay successfully discriminated the two viroid species from all reference samples and its recorded diagnostic sensitivity (Dse) and specificity (Dsp) was 100%. On the contrary, in conventional RT-PCR tests, the overall Dse and Dsp were lower and estimated at 94 and 95% for CEVd, and 97 and 98% for HSVd, respectively. In a direct comparison, the developed assay presented 1000-fold more analytical sensitivity. Spectrophotometric results showed that RNA extraction methods Q and C, yielded the purest RNA, and gave the lowest mean Ct values. Alternative template preparation method S resulted in Ct values statistically similar to those obtained with methods Q to C when tested by RT-TaqMan PCR. The developed assay, using crude template preparation S, allows the simple, accurate and cost-effective testing of a large number of plant samples, and can be applied in surveys and certification schemes.

Correction: A Universal Oligonucleotide Microarray with a Minimal Number of Probes for the Detection and Identification of Viroids at the Genus Level

Correction: A Universal Oligonucleotide Microarray with a Minimal Number of Probes for the Detection and Identification of Viroids at the Genus Level

Development of a quantitative real-time RT-PCR (qRT-PCR) for the detection of hop stunt viroid

Hop stunt viroid (HSVd) is a worldwide plant pathogen that infects a wide range of hosts. In some cases different molecular variants are associated with particular disease symptoms, e.g. the cachexia isolate on citrus. A new method for HSVd detection has been developed by designing a new primer pair and a probe for quantitative real-time RT-PCR (qRT-PCR) assay that is based on TaqMan™ chemistry. The primers and the probe were manually designed in order to detect different HSVd isolates from different hosts, including citrus cachexia variant. The protocol was then tested for its sensitivity and specificity. Specifically, sensitivity was evaluated with dilution series of in vitro transcripts from cloned whole HSVd genome. Dilutions were used as a standard for quantification of viroidal template in infected samples. Sensitivity was also tested by comparing the amplification results in quantitative and qualitative (end point) RT-PCR, obtained with serially diluted total RNA, extracted with two different methods. The qRT-PCR was evaluated for its specificity using healthy and infected samples from peach, apricot, plum, pear, citrus (infected with cachexia and non-cachexia variants), almond and grapevine and non-target controls (Apple scar skin viroid, Apple dimple fruit viroid, Peach latent mosaic viroid, Pear blister canker viroid and Potato spindle tuber viroid). The assay showed very high sensitivity and specificity. When the developed assay was applied to detect HSVd variants in different hosts that were previously tested, it was in complete agreement with previous test which confirmed its efficiency and accuracy. Moreover, the developed assay has the advantages of increased sensitivity of viroid detection as well as its quantification.

Loop-mediated isothermal amplification for the rapid detection of Chrysanthemum chlorotic mottle viroid (CChMVd)

Loop-mediated isothermal amplification (LAMP) is an established nucleic acid amplification method offering rapid, sensitive, and convenient diagnosis of infectious diseases. Chrysanthemum chlorotic mottle viroid (CChMVd) causes one of the most serious viral diseases in chrysanthemum in Korea. A sensitive LAMP assay was developed for rapidly detecting CChMVd infection. The assay was based on a set of four primers matching the specific region of the CChMVd genome. The CChMVd LAMP primer sets were designed using the sequences from nonsymptomatic and symptomatic CChMVd isolates in Korea. The efficiency and specificity of this method were optimized using Bst DNA polymerase, which allowed for increased viroid detection sensitivity. The reaction was carried out at 65°C for 90min, and was improved by adding SYBR Green I dye to the inside of the reaction tube lid prior to amplification. The results indicate that this LAMP method will be useful for chrysanthemum viroid disease monitoring and detecting CChMVd infectious disease.

A universal oligonucleotide microarray with a minimal number of probes for the detection and identification of viroids at the genus level.

A major challenge in the agricultural industry is the development of techniques that can screen plant samples for viroid infection. Microarrays are promising in this regard, as their high throughput nature can potentially allow for the detection of a range of viroids in a single test. In this paper we present a microarray that can detect a wide spectrum of all 8 reported viroid genera including 37 known plant viroid species. The array was constructed using an automated probe design protocol which generated a minimal number of probes to detect viroids at the genus level. The designed microarray showed a high specificity and sensitivity when tested with a set of standard virus samples. Finally, the microarray was applied to screen infected field samples, with Hop stunt viroid infection identified as the major disease causing pathogen for an infected citrus sample.

Relationship of viruses and viroids with apricot “viruela” disease

In this study, 34 apricot orchards in south-eastern Spain planted with the Spanish cultivar ‘Bulida’ and showing “viruela” symptoms were studied for 2 years. Leaf and fruit samples from four trees in each orchard, either with or without “viruela” symptoms, were collected and analysed by multiplex RT-PCR for the detection of American plum line pattern virus (APLPV), Apple chlorotic leaf spot virus (ACLSV), Apple mosaic virus (ApMV), Apricot latent virus (ApLV), Plum bark necrosis and stem pitting-associated virus (PBNSPaV), Plum pox virus (PPV), Prune dwarf virus (PDV), and Prunus necrotic ring spot virus (PNRSV). In addition, molecular hybridization assays were performed for the detection of Hop stunt viroid (HSVd) and Peach latent mosaic viroid (PLMVd). All fruits showing “viruela” symptoms were infected with ACLSV and HSVd, suggesting that these pathogens may be responsible for “viruela” disease. Other viruses including PNRSV, PBNSPaV, ApLV, PDV, ApMV and PPV, were detected to a lesser degree. Detection of ACLSV and HSVd in samples without symptoms could be explained by the influence of environmental conditions and/or the physiological stage of fruits on the expression of symptoms.