Detection Of Proteins Research Articles

Molecular Imprinting-Based SERS Detection Strategy for the Large-Size Protein Quantitation and Curbing Non-Specific Recognition.

Molecular imprinting-based surface-enhanced Raman scattering (MI-SERS) sensors have shown remarkable potential from an academic standpoint. However, their practical applications, especially in the detection of large-size protein (≥10 nm), face challenges due to the lack of versatile sensing strategies and nonspecific fouling of matrix species. Herein, we propose a Raman reporter inspector mechanism (RRIM) implemented on a protein-imprinted polydopamine (PDA) layer coated on the SERS active substrate. In the RRIM, after large-size protein recognition, the permeability of the PDA imprinted cavities undergoes changes that are scrutinized by Raman reporter molecules. Target proteins can specifically bind and fully occupy the imprinted cavities, whereas matrix species cannot. Then, Raman reporter molecules with suitable size are introduced to serve as both inspectors of the recognition status and inducers of the SERS signal, which can only penetrate through the vacant and nonspecifically filled cavities. Consequently, changes in the SERS signal exclusively originate from the specific binding of target proteins, while the nonspecific recognition of matrix species is curbed. The RRIM enables reproducible quantitation of the large-size cyanobacteria-specific protein model (≥10 nm), phycocyanin, at the level down to 2.6 × 10-3 μg L-1. Finally, the practical applicability of the RRIM is confirmed by accurately analyzing crude urban waterway samples over 21 min without any pretreatment.

The polymorphism analysis for CD36 among platelet donors

CD36 may defect on platelets and/or monocytes in healthy individuals, which was defined as CD36 deficiency. However, we did not know the correlation between the molecular and protein levels completely. Here, we aim to determine the polymorphisms of the CD36 gene, RNA level, and CD36 on platelets and in plasma. The individuals were sequenced by Sanger sequencing. Bioinformational analysis was used by the HotMuSiC, CUPSAT, SAAFEC-SEQ, and FoldX. RNA analysis and CD36 protein detection were performed by qPCR, flow cytometry, and ELISA. In this study, we found c.1228_1239delATTGTGCCTATT (allele frequency = 0.0072) with the highest frequency among our cohort, and one mutation (c.1329_1354dupGATAGAAATGATCTTACTCAGTGTTG) was not present in the dbSNP database. 5 mutations located in the extracellular domain sequencing region with confirmation in deficient individuals, of which c.284T>C, c.512A>G, c.572C>T, and c.869T>C were found to have a deleterious impact on CD36 protein stability. Furthermore, the MFI of CD36 expression on platelets in the mutation-carry, deleterious-effect, and deficiency group was significantly lower than the no-mutation group (P < 0.0500). In addition, sCD36 levels in type II individuals were significantly lower compared with positive controls (P = 0.0060). Nevertheless, we found the presence of sCD36 in a type I individual. RNA analysis showed CD36 RNA levels in platelets of type II individuals were significantly lower than the positive individuals (P = 0.0065). However, no significant difference was observed in monocytes (P = 0.7500). We identified the most prevalent mutation (c.1228_1239delATTGTGCCTATT) among Kunming donors. Besides, our results suggested RNA level alterations could potentially underlie type II deficiency. Furthermore, sCD36 may hold promise for assessing immune reaction risk in CD36-deficient individuals, but more studies should be conducted to validate this hypothesis.

Highly Multiplexing, Throughput and Efficient Single-Cell Protein Analysis with Digital Microfluidics.

Proteins as crucial components of cells are responsible for the majority of cellular processes. Sensitive and efficient protein detection enables a more accurate and comprehensive investigation of cellular phenotypes and life activities. Here, a protein sequencing method with high multiplexing, high throughput, high cell utilization, and integration based on digital microfluidics (DMF-Protein-seq) is proposed, which transforms protein information into DNA sequencing readout via DNA-tagged antibodies and labels single cells with unique cell barcodes. In a 184-electrode DMF-Protein-seq system, ≈1800 cells are simultaneously detected per experimental run. The digital microfluidics device harnessing low-adsorbed hydrophobic surface and contaminants-isolated reaction space supports high cell utilization (>90%) and high mapping reads (>90%) with the input cells ranging from 140 to 2000. This system leverages split&pool strategy on the DMF chip for the first time to overcome DMF platform restriction in cell analysis throughput and replace the traditionally tedious bench-top combinatorial barcoding. With the benefits of high efficiency and sensitivity in protein analysis, the system offers great potential for cell classification and drug monitoring based on protein expression at the single-cell level.

Next‐Generation Metabolic Glycosylation Reporters Enable Detection of Protein O−GlcNAcylation in Living Cells without S‐Glyco Modification

AbstractProtein O−GlcNAcylation is a ubiquitous posttranslational modification of cytosolic and nuclear proteins involved in numerous fundamental regulation processes. Investigation of O−GlcNAcylation by metabolic glycoengineering (MGE) has been carried out for two decades with peracetylated N‐acetylglucosamine (GlcNAc) and N‐acetylgalactosamine derivatives modified with varying reporter groups. Recently, it has been shown that these derivatives can result in non‐specific protein labeling termed S‐glyco modification. Here, we report norbornene‐modified GlcNAc derivatives with a protected phosphate at the anomeric position and their application in MGE. These derivatives overcome two limitations of previously used O−GlcNAc reporters. They do not lead to detectable S‐glyco modification, and they efficiently react in the inverse‐electron‐demand Diels–Alder (IEDDA) reaction, which can be carried out even within living cells. Using a derivative with an S‐acetyl‐2‐thioethyl‐protected phosphate, we demonstrate the protein‐specific detection of O−GlcNAcylation of several proteins and the protein‐specific imaging of O−GlcNAcylation inside living cells by Förster resonance energy transfer (FRET) visualized by confocal fluorescence lifetime imaging microscopy (FLIM).

Improved Detection of Tryptic Peptides from Tissue Sections Using Desorption Electrospray Ionization Mass Spectrometry Imaging.

DESI-MSI is an ambient ionization technique used frequently for the detection of lipids, small molecules, and drug targets. Until recently, DESI had only limited use for the detection of proteins and peptides due to the setup and needs around deconvolution of data resulting in a small number of species being detected at lower spatial resolution. There are known differences in the ion species detected using DESI and MALDI for nonpeptide molecules, and here, we identify that this extends to proteomic species. DESI MS images were obtained for tissue sections of mouse and rat brain using a precommercial heated inlet (approximately 450 °C) to the mass spectrometer. Ion mobility separation resolved spectral overlap of peptide ions and significantly improved the detection of multiply charged species. The images acquired were of pixel size 100 μm (rat brain) and 50 μm (mouse brain), respectively. Observed tryptic peptides were filtered against proteomic target lists, generated by LC-MS, enabling tentative protein assignment for each peptide ion image. Precise localizations of peptide ions identified by DESI and MALDI were found to be comparable. Some spatially localized peptides ions were observed in DESI that were not found in the MALDI replicates, typically, multiply charged species with a low mass to charge ratio. This method demonstrates the potential of DESI-MSI to detect large numbers of tryptic peptides from tissue sections with enhanced spatial resolution when compared to previous DESI-MSI studies.

Analysis of the value of potential biomarker S100-A8 protein in the diagnosis and pathogenesis of spinal tuberculosis.

The objective of this study is to evaluate the value of S100-A8 protein as a diagnostic marker for spinal tuberculosis and to explore its role in the potential pathogenesis of spinal tuberculosis (STB). The peripheral blood of 100 spinal tuberculosis patients admitted to the General Hospital of Ningxia Medical University from September 2018 to June 2021 were collected as the observation group, and the peripheral blood of 30 healthy medical examiners were collected as the control group. Three samples from the observation group and three samples from the control group were selected for proteomics detection and screening of differential proteins. Kyoto Encyclopedia of Genes (KEGG) was used to enrich and analyze related signaling pathways to confirm the target protein. The serum expression levels of the target proteins were determined and compared between the two groups using enzyme-linked immunosorbent assay (ELISA). Statistical methods were used to evaluate the value of target protein as a diagnostic marker for STB. A macrophage model of Mycobacterium tuberculosis infection was constructed and S100-A8 small interfering RNA was used to investigate the molecular mechanism of the target protein. S100-A8 protein has the value of diagnosing spinal tuberculosis (AUC = 0.931, p < 0.001), and the expression level in the peripheral blood of the observation group (59.04 ± 19.37 ng/mL) was significantly higher than that of the control group (43.16 ± 10.07 ng/mL) (p < 0.05). S100-A8 protein expression showed a significant positive correlation with both CRP and ESR values (p < 0.01). Its AUCs for combined bacteriological detection, T-SPOT results, diagnostic imaging, antacid staining results, and pathological results were 0.705 (p < 0.05), 0.754 (p < 0.01), 0.716 (p < 0.01), 0.656 (p < 0.05), and 0.681 (p < 0.01), respectively. Lack of S100-A8 leads to a significant decrease in the expression levels of TLR4 and IL-17A in infected macrophages. S100-A8 protein is differentially expressed in the peripheral blood of patients with spinal tuberculosis and healthy individuals and may be a novel candidate biomarker for the diagnosis of spinal tuberculosis. The feedback loop on the S100-A8-TLR4-IL-17A axis may play an important role in the inflammatory mechanism of spinal tuberculosis.

Screening and Application of DNA Aptamers for Heparin-Binding Protein.

Rapid detection of heparin-binding protein (HBP) is essential for timely intervention in sepsis cases. Current detection techniques are usually antibody-based immunological methods, which have certain problems, such as complexity and slow detection, and fall short in meeting the urgency of clinical needs. The application of an aptamer can address these concerns well. In this study, HBP-specific DNA aptamers were screened first. Among which, Apt-01, Apt-02, and Apt-13 had a high affinity for HBP, exhibiting impressive KD values of 3.42, 1.44, and 1.04 nmol/L, respectively. Then, the aptamer of HBP and its partially complementary primer probe were combined to form double-stranded DNA (dsDNA) and synthesize a circular DNA template. The template is complementary to the primer probe, but due to the presence of dsDNA, ExoIII cleaves C2-13 as an RCA primer probe, rendering the template unable to recognize the primer probe and preventing the RCA reaction from proceeding. When the target is present, it competes with the adapter for recognition and releases C2-13, exposing its 3' end. After initiating the RCA at room temperature and reacting with SYBR GreenII at 37 °C for 20 min, fluorescence changes can be observed and quantitatively analyzed at a 530 nm wavelength, achieving quantitative biological analysis. Apt-01 was used to develop a fluorescent biosensor for HBP detection, which exhibited a good linear range (0.01 nmol/L to 10 nmol/L) and detection limit (0.0056 nmol/L). This advancement holds the potential to lay a solid groundwork for pioneering sensitive and specific methods for HBP detection and to significantly enhance the diagnostic processes for sepsis.

Feline leishmaniasis in an animal shelter in northeastern Brazil: Clinical aspects, coinfections, molecular detection, and serological study of a new recombinant protein

Infection and clinical cases of leishmaniasis caused by Leishmania infantum in cats have been increasingly reported in several countries, including Brazil. In this study, we used an enzyme-linked immunosorbent assay (ELISA) and an immunochromatographic test (ICT) based on a recombinant antigen (rKDDR-plus) to detect anti-Leishmania antibodies in cats from an animal shelter in northeastern Brazil. We compared the results with an ELISA using L. infantum crude antigen (ELISA-CA). We also investigated the presence of Leishmania DNA in blood or ocular conjunctival samples as well as the association between Leishmania PCR positivity and serological positivity to feline immunodeficiency virus (FIV), feline leukemia virus (FeLV) and Toxoplasma gondii. Concerning serological assays, a higher positivity was detected using the ICT-rKDDR-plus (7.5%; 7/93) as compared to ELISA-rKDDR-plus (5.4%; 5/93) and ELISA-CA (4.3%; 4/93). Upon PCR testing, 52.7% (49/93) of the ocular conjunctival swabs and 48.3% (44/91) of the blood samples were positive. Together, PCR and serological testing revealed overall positivities of 73.1% (68/93) and 12.9% (12/93), respectively. Among PCR-positive samples, 45.5% (31/68) showed co-infection with FIV, 17.6% (12/68) with FeLV, and 82.3% (56/68) with T. gondii. More than half of the PCR-positive cats showed at least one clinical sign suggestive of leishmaniasis (58.8%; 40/68) and dermatological signs were the most frequent ones (45.5%; 31/68). Both tests employing the recombinant antigen rKDDR-plus (i.e., ICT-rKDDR-plus and ELISA-rKDDR-plus) detected more positive cats than the ELISA-CA but presented low overall accuracy. PCR testing using either blood or ocular conjunctival samples detected much more positive cats than serological tests.

Diagnostic, monitoring, and prognostic value of combined detection of cerebrospinal fluid heparin-binding protein, interleukin-6, interleukin-10, and procalcitonin for post-neurosurgical intracranial infection

ObjectiveIntracranial infection is a common complication after neurosurgery and can increase the length of hospital stay, affect patient prognosis, and increase mortality. We aimed to investigate the value of the combined detection of cerebrospinal fluid (CSF) heparin-binding protein (HBP), interleukin-6 (IL-6), interleukin-10 (IL-10), and procalcitonin (PCT) for post-neurosurgical intracranial infection. MethodsThis study assessed the diagnostic values of CSF HBP, IL-6, IL-10, PCT levels, and combined assays for post-neurosurgical intracranial infection with the area under the receiver operating characteristic (ROC) curve by retrospectively analysing biomarkers of post-neurosurgical patients. ResultsThe CSF HBP, IL-6, IL-10, and PCT levels were significantly higher in the infected group than the uninfected group and the control group (P < 0.001). The indicators in the groups with severe intracranial infections were significantly higher than those in the groups with mild intracranial infections (P < 0.001), and the groups with poor prognoses had significantly higher indexes than the groups with good prognoses. According to the ROC curve display, the AUC values of CSF HBP, IL-6, IL-10, and PCT were 0.977 (95 % CI 0.952–1.000), 0.973 (95 % CI 0.949–0.998), 0.884 (95 % CI 0.823–0.946), and 0.819 (95 % CI 0.733–0.904), respectively. The AUC of the combined test was 0.996 (95 % CI 0.989–1.000), which was higher than those of the four indicators alone. ConclusionThe combined detection can be an important indicator for the diagnosis and disease monitoring of post-neurosurgical intracranial infection.

A high-throughput differential scanning fluorimetry method for rapid detection of thermal stability and iron saturation in lactoferrin

Thermal stability and iron saturation of lactoferrin (LF) are of great significance not only for the evaluation of the biological activities of LF but also for the optimization of the isolation and drying process parameters. Differential scanning calorimetry (DSC) is a well-established and efficient method for thermal stability and iron saturation detection in LF. However, multiple DSC measurements are typically performed sequentially, thus time-consuming and low throughput. Herein, we introduced the differential scanning fluorimetry (DSF) approach to overcome such limitations. The DSF can monitor LF thermal unfolding with a commonly available real-time PCR instrument and a fluorescent dye (SYPRO orange or Glomelt), and the measured melting temperature of LF is consistent with that determined by DSC. On the basis of that, a new quantification method was established for determination of iron saturation levels using the linear correlation of the degree of ion saturation of LF with DSF measurements. Such DSF method is simple, inexpensive, rapid (<15 min), and high throughput (>96 samples per experiment), and provides a valuable alternative tool for thermal stability detection of LF and other whey proteins.

Comprehensive Prostate Fluid-Based Spectral Libraries for Enhanced Protein Detection in Urine.

Biofluids contain molecules in circulation and from nearby organs that can be indicative of disease states. Characterizing the proteome of biofluids with DIA-MS is an emerging area of interest for biomarker discovery; yet, there is limited consensus on DIA-MS data analysis approaches for analyzing large numbers of biofluids. To evaluate various DIA-MS workflows, we collected urine from a clinically heterogeneous cohort of prostate cancer patients and acquired data in DDA and DIA scan modes. We then searched the DIA data against urine spectral libraries generated using common library generation approaches or a library-free method. We show that DIA-MS doubles the sample throughput compared to standard DDA-MS with minimal losses to peptide detection. We further demonstrate that using a sample-specific spectral library generated from individual urines maximizes peptide detection compared to a library-free approach, a pan-human library, or libraries generated from pooled, fractionated urines. Adding urine subproteomes, such as the urinary extracellular vesicular proteome, to the urine spectral library further improves the detection of prostate proteins in unfractionated urine. Altogether, we present an optimized DIA-MS workflow and provide several high-quality, comprehensive prostate cancer urine spectral libraries that can streamline future biomarker discovery studies of prostate cancer using DIA-MS.

FAST, a method based on split-GFP for the detection in solution of proteins synthesized in cell-free expression systems

Cell-free protein synthesis (CFPS) systems offer a versatile platform for a wide range of applications. However, the traditional methods for detecting proteins synthesized in CFPS, such as radioactive labeling, fluorescent tagging, or electrophoretic separation, may be impractical, due to environmental hazards, high costs, technical complexity, and time consuming procedures. These limitations underscore the need for new approaches that streamline the detection process, facilitating broader application of CFPS. By harnessing the reassembly capabilities of two GFP fragments—specifically, the GFP1-10 and GFP11 fragments—we have crafted a method that simplifies the detection of in vitro synthesized proteins called FAST (Fluorescent Assembly of Split-GFP for Translation Tests). FAST relies on the fusion of the small tag GFP11 to virtually any gene to be expressed in CFPS. The in vitro synthesized protein:GFP11 can be rapidly detected in solution upon interaction with an enhanced GFP1-10 fused to the Maltose Binding Protein (MBP:GFP1-10). This interaction produces a fluorescent signal detectable with standard fluorescence readers, thereby indicating successful protein synthesis. Furthermore, if required, detection can be coupled with the purification of the fluorescent complex using standardized MBP affinity chromatography. The method's versatility was demonstrated by fusing GFP11 to four distinct E. coli genes and analyzing the resulting protein synthesis in both a homemade and a commercial E. coli CFPS system. Our experiments confirmed that the FAST method offers a direct correlation between the fluorescent signal and the amount of synthesized protein:GFP11 fusion, achieving a sensitivity threshold of 8 ± 2 pmol of polypeptide, with fluorescence plateauing after 4 h. Additionally, FAST enables the investigation of translation inhibition by antibiotics in a dose-dependent manner. In conclusion, FAST is a new method that permits the rapid, efficient, and non-hazardous detection of protein synthesized within CFPS systems and, at the same time, the purification of the target protein.

The 3D in vitro Adrenoid cell model recapitulates the complexity of the adrenal gland

The crosstalk between the chromaffin and adrenocortical cells is essential for the endocrine activity of the adrenal glands. This interaction is also likely important for tumorigenesis and progression of adrenocortical cancer and pheochromocytoma. We developed a unique in vitro 3D model of the whole adrenal gland called Adrenoid consisting in adrenocortical carcinoma H295R and pheochromocytoma MTT cell lines. Adrenoids showed a round compact morphology with a growth rate significantly higher compared to MTT-spheroids. Confocal analysis of differential fluorescence staining of H295R and MTT cells demonstrated that H295R organized into small clusters inside Adrenoids dispersed in a core of MTT cells. Transmission electron microscopy confirmed the strict cell–cell interaction occurring between H295R and MTT cells in Adrenoids, which displayed ultrastructural features of more functional cells compared to the single cell type monolayer cultures. Adrenoid maintenance of the dual endocrine activity was demonstrated by the expression not only of cortical and chromaffin markers (steroidogenic factor 1, and chromogranin) but also by protein detection of the main enzymes involved in steroidogenesis (steroidogenic acute regulatory protein, and CYP11B1) and in catecholamine production (tyrosine hydroxylase and phenylethanolamine N-methyltransferase). Mass spectrometry detection of steroid hormones and liquid chromatography measurement of catecholamines confirmed Adrenoid functional activity. In conclusion, Adrenoids represent an innovative in vitro 3D-model that mimics the spatial and functional complexity of the adrenal gland, thus being a useful tool to investigate the crosstalk between the two endocrine components in the pathophysiology of this endocrine organ.

Abstract LB291: High-plexy intracellular and surface CITE-Seq offers multiomic insights into cell function

Abstract CITE-Seq allows researchers to combine high-plex protein information with whole transcriptome sequencing to gain insights about individual cell states. Due to the harsh fixation and permeabilization required for intracellular (IC) antibody staining, only a few studies have recovered mRNA expression profiles alongside IC protein detection. This experiment utilized a novel IC CITE-Seq assay that enables robust profiling of multiple IC protein targets in combination with mRNA and high-plex surface proteins. In this study, we stimulated human peripheral blood mononuclear cells (PBMCs) alongside a resting control. After stimulation, we stained the surface proteins with a 40-plex BD® AbSeq Panel, including the Immune Discovery Panel and human Single-Cell Multiplexing Kit (SMK). Resting and stimulated cells were pooled, and a portion of the sample pool immediately underwent cell capture as a live control using a BD Rhapsody™ single-cell microwell system. The other portion of the pool was stored in BD® OMICS-Guard Sample Preservation Buffer for either 5 minutes or 24 hours followed by permeabilization, IC staining with a 10-plex IC AbSeq Panel (50-plex total, surface and IC), and cells captured on the the same system. We show IC protein detection for the expected positive targets, including pH2AX, actCaspase-3, and cPARP in the stimulated population, as well as T-Bet, Granzyme B and Helios in the resting lymphocytes. Analysis shows excellent correspondence between IC CITE-Seq protein and transcriptome for T-Bet, Granzyme B and Helios. The gene expression correlation for surface antigen and mRNA between the IC and live control each had R2 values &amp;gt; 0.9. The mRNA sensitivity for the IC sample compared to live control was within whole transcriptome analysis (WTA) assay variation at 86–89% and 95–97% median molecules and genes per cell. Our data showed that the new IC CITE-Seq assay can provide rich single-cell multiomics information including mRNA and surface and intracellular proteins. For Research Use Only. Not for use in diagnostic or therapeutic procedures.BD, the BD Logo and BD Rhapsody are trademarks of Becton, Dickinson and Company or itsaffiliates. © 2023 BD. All rights reserved. NPM-2532 (v1.0) 1023 Citation Format: Tracy L. Campbell, Adam Wright, Ying Wah Lee, Anne Tran, Yan Chen, Joe Olives, Hye-Won Song, Larry Wang. High-plexy intracellular and surface CITE-Seq offers multiomic insights into cell function [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 2 (Late-Breaking, Clinical Trial, and Invited Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(7_Suppl):Abstract nr LB291.

SERS biosensor with plastic antibodies for detection of a cancer biomarker protein

Surface-enhanced Raman scattering (SERS) is a powerful method for detecting breast cancer-specific biomarkers due to its extraordinary enhancement effects obtained by localized surface plasmon resonance (LSPR) in metallic nanostructures at hotspots. In this research, gold nanostars (AuNSs) were used as SERS probes to detect a cancer biomarker at very low concentrations. To this end, we combined molecularly imprinted polymers (MIPs) as a detection layer with SERS for the detection of the biomarker CA 15–3 in point-of-care (PoC) analysis. This required two main steps: (i) the deposition of MIPs on a gold electrode, followed by a second step (ii) antibody binding with AuNSs containing a suitable Raman reporter to enhance Raman signaling (SERS). The MPan sensor was prepared by electropolymerization of the monomer aniline in the presence of CA 15–3. The template molecule was then extracted from the polymer using sodium dodecyl sulfate (SDS). In parallel, a control material was prepared in the absence of the protein (NPan). Surface modification for the control was performed using electrochemical techniques such as cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The performance of the sensor was evaluated using the SERS technique, in which the MPan sensor is first incubated with the protein and then exposed to the SERS probe. Under optimized conditions, the device showed a linear response to CA 15–3 concentrations from 0.016 to 248.51 U mL−1 in a PBS buffer at pH 7.4 in 1000-fold diluted serum. Overall, this approach demonstrates the potential of SERS as an optical reader and opens a new avenue for biosensing applications.Graphical

Characterization of the plasma proteome from healthy adult dogs.

Bloodwork is a widely used diagnostic tool in veterinary medicine, as diagnosis and therapeutic interventions often rely on blood biomarkers. However, biomarkers available in veterinary medicine often lack sensitivity or specificity. Mass spectrometry-based proteomics technology has been extensively used in the analysis of biological fluids. It offers excellent potential for a more comprehensive characterization of the plasma proteome in veterinary medicine. In this study, we aimed to identify and quantify plasma proteins in a cohort of healthy dogs and compare two techniques for depleting high-abundance plasma proteins to enable the detection of lower-abundance proteins via label-free quantification liquid chromatography-mass spectrometry. We utilized surplus lithium-heparin plasma from 30 healthy dogs, subdivided into five groups of pooled plasma from 6 randomly selected individuals each. Firstly, we used a commercial kit to deplete high-abundance plasma proteins. Secondly, we employed an in-house method to remove albumin using Blue-Sepharose. Among all the samples, some of the most abundant proteins identified were apolipoprotein A and B, albumin, alpha-2-macroglobulin, fibrinogen beta chain, fibronectin, complement C3, serotransferrin, and coagulation factor V. However, neither of the depletion techniques achieved significant depletion of highly abundant proteins. Despite this limitation, we could detect and quantify many clinically relevant proteins. Determining the healthy canine proteome is a crucial first step in establishing a reference proteome for canine plasma. After enrichment, this reference proteome can later be utilized to identify protein markers associated with different diseases, thereby contributing to the diagnosis and prognosis of various pathologies.

Protein-to-DNA Converter with High Signal Gain.

DNA isothermal amplification techniques have been applied extensively for evaluating nucleic acid inputs but cannot be implemented directly on other types of biomolecules. In this work, we designed a proximity activation mechanism that converts protein input into DNA barcodes for the DNA exponential amplification reaction, which we termed PEAR. Several design parameters were identified and experimentally verified, which included the choice of enzymes, sequences of proximity probes and template strand via the NUPACK design tool, and the implementation of a hairpin lock on the proximity probe structure. Our PEAR system was surprisingly more robust against nonspecific DNA amplification, which is a major challenge faced in existing formats of the DNA-based exponential amplification reaction. The as-designed PEAR exhibited good target responsiveness for three protein models with a dynamic range of 4-5 orders of magnitude down to femtomolar input concentration. Overall, our proposed protein-to-DNA converter module led to the development of a stable and robust configuration of the DNA exponential amplification reaction to achieve high signal gain. We foresee this enabling the use of protein inputs for more complex molecular evaluation as well as ultrasensitive protein detection.

Levels of the HtrA1 Protein in Serum and Vitreous Humor Are Independent of Genetic Risk for Age-Related Macular Degeneration at the 10q26 Locus.

The purpose of this study was to determine if levels of the HtrA1 protein in serum or vitreous humor are influenced by genetic risk for age-related macular degeneration (AMD) at the 10q26 locus, age, sex, AMD status, and/or AMD disease severity, and, therefore, to determine the contribution of systemic and ocular HtrA1 to the AMD disease process. A custom-made sandwich ELISA assay (SCTM ELISA) for detection of the HtrA1 protein was designed and compared with three commercial assays (R&D Systems, MyBiosource 1 and MyBiosource 2) using 65 serum samples. Concentrations of HtrA1 were thereafter determined in serum and vitreous samples collected from 248 individuals and 145 human donor eyes, respectively. The SCTM ELISA demonstrated high specificity, good recovery, and parallelism within its linear detection range and performed comparably to the R&D Systems assay. In contrast, we were unable to demonstrate the specificity of the two assays from MyBioSource using either recombinant or native HtrA1. Analyses of concentrations obtained using the validated SCTM assay revealed that genetic risk at the 10q26 locus, age, sex, or AMD status are not significantly associated with altered levels of the HtrA1 protein in serum or in vitreous humor (P > 0.05). HtrA1 levels in serum and vitreous do not reflect the risk for AMD associated with the 10q26 locus or disease status. Localized alteration in HTRA1 expression in the retinal pigment epithelium, rather than systemic changes in HtrA1, is the most likely driver of elevated risk for developing AMD among individuals with risk variants at the 10q26 locus.

Microfluidic Immunosensing Platform Based on a Rolling Circle Amplification-Assisted DNA Dendrimer Probe for Portable and Sensitive Detection of Allergen-Specific IgE.

The robust point-of-care platform for sensitive, multiplexed, and affordable detection of allergen-specific IgE (sIgE) is an urgent demand in component-resolved diagnostics. Here, we developed a microfluidic immunosensing platform based on a rolling circle amplification-assisted DNA dendrimer probe for sensitive detection of multiple sIgEs. The versatile multichannel microfluidic whole blood analytical device integrates cell filtration, recombinant antigen-modified magnetic enrichment, and DNA dendrimer probe-amplified signal transduction for portable on-chip analysis. Three sIgEs against common oyster allergens were simultaneously detected in blood samples by simple smartphone-based imaging without any pretreatment. The quantitative detection of multiple allergen-specific antibodies on the platform was achieved with limits of detection of less than 50 pg/mL, exhibiting superior sensitivity compared to most point-of-care testing. The detection results of 55 serum samples and 4 whole blood samples were 100% consistent with the ELISA results, confirming the accuracy and stability of our platform. Additionally, the reversible combination of hexahistidine6-tag and Ni-IMAC magbead was elegantly utilized on the immunosensing platform for desired reversibility. With the advantages of general applicability, high sensitivity, and reversibility, the DNA dendrimer-based microfluidic immunosensing platform provides great potential for the portable detection of immune proteins as a point-of-care platform in disease diagnostics and biological analysis.

Magnetic Graphene Oxide Nanocomposites Boosts Craniomaxillofacial Bone Regeneration by Modulating circAars/miR-128-3p/SMAD5 Signaling Axis.

The ability of nanomaterials to induce osteogenic differentiation is limited, which seriously imped the repair of craniomaxillofacial bone defect. Magnetic graphene oxide (MGO) nanocomposites with the excellent physicochemical properties have great potential in bone tissue engineering. In this study, we aim to explore the craniomaxillofacial bone defect repairment effect of MGO nanocomposites and its underlying mechanism. The biocompatibility of MGO nanocomposites was verified by CCK8, live/dead staining and cytoskeleton staining. The function of MGO nanocomposites induced osteogenic differentiation of BMSCs was investigated by ALP activity detection, mineralized nodules staining, detection of osteogenic genes and proteins, and immune-histochemical staining. BMSCs with or without MGO osteogenic differentiation induction were collected and subjected to high-throughput circular ribonucleic acids (circRNAs) sequencing, and then crucial circRNA circAars was screened and identified. Bioinformatics analysis, Dual-luciferase reporter assay, RNA binding protein immunoprecipitation (RIP), fluorescence in situ hybridization (FISH) and osteogenic-related examinations were used to further explore the ability of circAars to participate in MGO nanocomposites regulation of osteogenic differentiation of BMSCs and its potential mechanism. Furthermore, critical-sized calvarial defects were constructed and were performed to verify the osteogenic differentiation induction effects and its potential mechanism induced by MGO nanocomposites. We verify the good biocompatibility and osteogenic differentiation improvement effects of BMSCs mediated by MGO nanocomposites. Furthermore, a new circRNA-circAars, we find and identify, is obviously upregulated in BMSCs mediated by MGO nanocomposites. Silencing circAars could significantly decrease the osteogenic ability of MGO nanocomposites. The underlying mechanism involved circAars sponging miR-128-3p to regulate the expression of SMAD5, which played an important role in the repair craniomaxillofacial bone defects mediated by MGO nanocomposites. We found that MGO nanocomposites regulated osteogenic differentiation of BMSCs via the circAars/miR-128-3p/SMAD5 pathway, which provided a feasible and effective strategy for the treatment of craniomaxillofacial bone defects.