Detection Of Nucleic Acid Targets Research Articles

Rapid isothermal detection assay: a probe amplification method for the detection of nucleic acids

Simple, accurate, and stable diagnostic tests are essential to control viral infectious diseases such as avian influenza virus. The current technologies are often inaccessible to people who need them, mainly because of the specialized equipment and the need for highly trained technologists. Here, we describe a rapid isothermal nucleic acid detection assay (RIDA) that can be used to detect both DNA and RNA targets. Using chemically modified probes, we designed a lateral-flow (LF) immunoassay that can be used in combination with RIDA for equipment-free nucleic acid target detection. RIDA is a “probe amplification” assay that uses the single-strand nicking activity of restriction nicking endonucleases to repeatedly cleave synthetic probes hybridizing to the same target sequences. In the RIDA-LF combined assay, chemically labeled probes are covalently conjugated to magnetic microbeads, which is propitious to separate cleaved probes from the reaction solution. The cleaved probes in the solution are then detected with an LF immunoassay. The real-time assay shows that RIDA is able to specifically detect target sequences in 5 to 15 min. The RIDA-LF combined assay can specifically detect nucleic acid targets without sophisticated equipment. In this report, our data suggest that RIDA is a flexible simple assay that could be applied for point-of-care detection. The modified-RIDA described in this report further extends the application of this technology.

Immuno-polymerase chain reaction as a unique molecular tool for detection of infectious agents

Theoretically, the immuno-polymerase chain reaction (IPCR) method is the most sensitive technique for the detection of proteins and gains its uniqueness through the exponential amplification of a signal-generating nucleic acid intermediate attached to a protein target. This method is similar to PCR for the detection of nucleic acid targets, and has now been shown to offer the ability to detect infectious agents where nucleic acids are not present. Although the technical development of IPCR has taken a torturous path down a winding avenue of encouraging advances, the method remains rarely utilized by the scientific community and completely unused as a clinical diagnostic test approved by a national accrediting agency. Although the use of real-time instrumentation has enhanced the performance of IPCR to higher levels of statistical accuracy and reproducibility, as compared with the conventional method, its application remains limited by the high standards required for clinical diagnoses of infectious diseases. This review summarizes experimental data published to date describing the utilization of the IPCR method as it relates to the detection and diagnosis of human infectious disease, and examines the progressive development of this method, as well as the factors impeding its universal application as a clinical diagnostic tool. With further standardization and validation, the IPCR method has the potential to become the most analytically sensitive method available for the detection of target proteins of infectious diseases.

Simultaneous Control of DNA and RNA Processing Efficiency Using a Nucleic Acid Calibration Set

PCR-based detection techniques enables reliable and sensitive nucleic acid target detection. However, quantitative determination methods often fail to control for the efficiency of nucleic acid extraction, reverse transcription, and PCR amplification. This problem is even more prominent when working with clinical samples due to target sequence loss during nucleic acid processing or the co-purification of PCR inhibitors (1,2). Handling processes are often assumed to approach 100% efficiency in the laboratory, even if practical experience shows that this efficiency can be much lower. This inability to ensure accuracy can lead to significant error in uncalibrated DNA sample quantitation. The additional need for reverse transcription of RNA may further increase the quantitative error rate, as yet another enzymatic process is involved. Nucleic acid controls have been developed based upon known sequences to calibrate either DNA or RNA handling; DNA calibrators have been used to control for the amplification of target sequences using realtime PCR methods (3–8), while RNA calibrators have been developed to test reverse transcription and amplification efficiencies (9–11). A nonpathogenic viral particle carrying a sequence for use as an external positive control of extraction and amplification has also been described (12). Unfortunately, most of the established processing controls are only suitable for limited applications (i.e., either DNA or RNA detection). Cross-contamination of biological samples or minute detection from natural sources reveals the need for completely synthetic sequences, with no homology to sequences in the nucleic acid databases. It is, therefore, beneficial to design an internal, synthetic calibration system that can control for both DNA and RNA processing steps in a single tube. This set includes both RNA and DNA targets with identical primer binding sites and, thus, primer binding efficiency, but easily distinguishable sequence characteristics, allowing for simultaneous detection, quantitation, and calibration of nucleic acid processing efficiency. A 150-bp randomly generated nucleic acid sequence was developed for use as a short control (SC). A GCrich 75-bp sequence was inserted in the middle of the 150-bp sequence to generate a 225-bp sequence, long control (LC). Besides size, the two sequences were designed to have easily distinguishable probe binding sites with a predicted product melting temperature difference of 4°C. Calibrator sequences have been published as GenBank® accession nos. EF143258 (DNA control, LC) and EF143257 (RNA control, SC). Simultaneous control of DNA and RNA processing efficiency using a nucleic acid calibration set

Multiplexed Detection of Anthrax-Related Toxin Genes

Simultaneous analysis of three targets in three colors on any real-time polymerase chain reaction (PCR) instrument would increase the flexibility of real-time PCR. For the detection of Bacillus strains that can cause inhalation anthrax-related illness, this ability would be valuable because two plasmids confer virulence, and internal positive controls are needed to monitor the testing in cases lacking target-specific signals. Using a real-time PCR platform called MultiCode-RTx, multiple assays were developed that specifically monitor the presence of Bacillus anthracis-specific virulence plasmid-associated genes. In particular for use on LightCycler-1, two triplex RTx systems demonstrated high sensitivity with limits of detection nearing single-copy levels for both plasmids. Specificity was established using a combination of Ct values and correct amplicon melting temperatures. All reactions were further verified by detection of an internal positive control. For these two triplex RTx assays, the analytical detection limit was one to nine plasmid copy equivalents, 100% analytical specificity with a 95% confidence interval (CI) of 9%, and 100% analytical sensitivity with a CI of 2%. Although further testing using clinical or environmental samples will be required to assess diagnostic sensitivity and specificity, the RTx platform achieves similar results to those of probe-based real-time systems.

An ultrasensitive photoelectrochemical nucleic acid biosensor

A simple and ultrasensitive procedure for non-labeling detection of nucleic acids is described in this study. It is based on the photoelectrochemical detection of target nucleic acids by forming a nucleic acid/photoreporter adduct layer on an ITO electrode. The target nucleic acids were hybridized with immobilized oligonucleotide capture probes on the ITO electrode. A subsequent binding of a photoreporter—a photoactive threading bis-intercalator consisting of two N,N′-bis(3-propyl-imidazole)-1,4,5,8-naphthalene diimides (PIND) linked by a (bpy = 2,2′-bipyridine) complex (PIND–Ru–PIND)—allowed for photoelectrochemical detection of the target nucleic acids. The extremely low dissociation rate of the adduct and the highly reversible photoelectrochemical response under visible light illumination (490 nm) make it possible to conduct nucleic acid detection, with a sensitivity enhancement of four orders of magnitude over voltammetry. These results demonstrate for the first time the potential of photoelectrochemical biosensors for PCR-free ultrasensitive detection of nucleic acids.

Immobilized stem-loop structured probes as conformational switches for enzymatic detection of microbial 16S rRNA

We have designed and evaluated novel DNA stem–loop structured probes for enzymatic detection of nucleic acid targets. These probes constitute a novel class of conformational switches for enzymatic activity, which in the absence of a target sterically shield an affinity label and upon hybridization of the target to the recognition sequence that forms the loop of the probe restore accessibility of the label for the binding of a reporter enzyme. Analysis of probe characteristics revealed stem stability as the most important parameter governing detection functionality, while other factors such as the length of linker molecules attaching the label to the stem–loop structure and the nature of the solid support proved to be less critical. Apparently, the bulky nature of the reporter enzyme facilitates shielding of the label in the absence of the target, thereby conferring considerable structural tolerance to the conformational switch system. The stem–loop structured probes allow sensitive detection of unlabeled nucleic acid targets. Employing a microtiter assay format, 4 ng of bacterial 16S ribosomal RNA corresponding to 8 fmol could be detected, which can be compared favorably with current immobilized molecular beacon concepts based on fluorescence detection.

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides.

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.

Universal sensing strategy for the detection of nucleic acid targets by optical biosensor based on surface plasmon resonance.

PCR is an important technique for identifying specific nucleic acid targets; for example, sequences associated with diseases and pathogens in clinical, environmental, and food samples. Many techniques currently used for sequence-specific detection of PCR products either require manual processing or are limited in the speed or scale of analysis. The development of biosensors in recent years has provided promising techniques for efficient sequence-specific DNA analysis (1). Biosensors have been used to detect target sequences in PCR products. Most studies have been conducted with the commercially available biosensor BIAcore, which is based on surface plasmon resonance (SPR) technology. In those investigations, either sequence-specific oligonucleotide probe (2)(3)(4)(5)(6)(7)(8) or amplified products themselves (8)(9)(10)(11) were immobilized on the sensor chip, limiting their application to one sequence or to one particular sample. Such a strategy suffers several drawbacks: (a) it compromises the automation and high-throughput capability of such instruments when different targets are analyzed; (b) chip-to-chip variation makes it difficult to compare different measurements; and (c) probe immobilization and chip consumption make running costs substantial. To overcome these drawbacks, we describe here a “one-chip-for-all” strategy that is capable of, in principle, detecting different target sequences by use of the same sensor chip. Target sequences are amplified by asymmetric PCR using a primer pair in which the low-concentration primer carries a common tag sequence that is identical to that of the oligonucleotide capture probe immobilized on the sensor chip. The PCR product is then injected and captured on the sensor chip, and its sequence identity can be further verified by use of a target-specific probe (see Fig. 1 in the Data Supplement that accompanies the online version of this Technical Brief at http://www.clinchem.org/content/vol50/issue6/). We exemplify this application by …

Detection of attomole quantities [correction of quantitites] of DNA targets on gold microelectrodes by electrocatalytic nucleobase oxidation.

The electrochemical detection of nucleic acid targets at low concentrations has a number of applications in diagnostics and pharmaceutical research. Self-assembled monolayers of alkanethiol-derivatized oligonucleotides on gold electrodes provide a useful platform for such detectors, and the electrocatalytic oxidation of nucleobases included in the DNA targets is a particularly sensitive method of electrochemical detection. A strategy has been developed for combining these two aspects by substituting either 7,8-dihydro-8-oxoguanine (8G) or 5-aminouridine (5U) into DNA targets. Upon hybridization of targets containing these modified nucleobases, electrocatalytic signals at probe-modified gold electrodes are observed in the presence of Os(bpy)(3)(2+), which oxidizes both 8G and 5U upon oxidation to the Os(III) state. Self-assembled monolayers were prepared on both macro (1.6 mm) and micro (25 microm) gold electrodes using published procedures involving C6-terminated alkanethiol oligonucleotides and mercaptohexanol as the diluent. The extent of electrode modification by the modified probe was assessed using radiolabeling and a standard chronocoulometry method; both approaches gave loading levels within expected ranges ((1-6) x 10(12) molecules/cm(2)). Hybridization of the modified targets where the non-native nucleobase was incorporated by solid-phase synthesis produced electrocatalytic signals from strands that were independently detected using radiolabeling and chronocoulometry. This result was used as a basis to develop an on-electrode amplification scheme where Taq polymerase was used to extend the immobilized DNA probes from solution-phase polymeric templates using modified nucleotriphosphates. This reaction produced an electrode that was modified with extended DNA containing the appropriate modified nucleotide. Radiolabeled nucleotide triphosphates were used to confirm the desired on-electrode DNA synthesis. When these electrodes were cycled in the presence of Os(bpy)(3)(2+), electrocatalytic signals were observed when as little as 40 amol (400 fM) of the desired target was present in the hybridization solution.

Electronic detection of target nucleic acids by a 2,6-disulfonic acid anthraquinone intercalator.

A DNA hybridization biosensor based on long-range electron transfer that is capable of detecting DNA single-base mismatch is presented. A mixed self-assembled monolayer of single-stranded DNA (ss-DNA), thiolated at the 3' end, and 6-mercapto-1-hexanol was formed on a gold surface. This probe ss-DNA-modified gold surface was incubated in 2,6-disulfonic acid anthraquinone (AQDS) intercalator solution, rinsed, and placed in an AQDS-free buffer solution, whereupon voltammetric experiments were performed. No voltammetric peaks were observed for probe ss-DNA-modified gold electrodes. Upon DNA hybridization and incubation in AQDS, clear voltammetric peaks, consistent with the oxidation and reduction of AQDS, were observed. The absence of AQDS electrochemistry for ss-DNA-modified surfaces clearly shows the electrochemistry is due to long-range electron transfer through the DNA duplex. No peak currents were observed when the probe ss-DNA-modified surface was exposed to noncomplementary target DNA, but there was a diminution in current signal upon hybridization with C-A mismatched and a G-A mismatched targets.

Hybridization of DNA and PNA Molecular Beacons to Single-Stranded and Double-Stranded DNA Targets

Molecular beacons are sensitive fluorescent probes hybridizing selectively to designated DNA and RNA targets. They have recently become practical tools for quantitative real-time monitoring of single-stranded nucleic acids. Here, we comparatively study the performance of a variety of such probes, stemless and stem-containing DNA and PNA (peptide nucleic acid) beacons, in Tris-buffer solutions containing various concentrations of NaCl and MgCl(2). We demonstrate that different molecular beacons respond differently to the change of salt concentration, which could be attributed to the differences in their backbones and constructions. We have found that the stemless PNA beacon hybridizes rapidly to the complementary oligodeoxynucleotide and is less sensitive than the DNA beacons to the change of salt thus allowing effective detection of nucleic acid targets under various conditions. Though we found stemless DNA beacons improper for diagnostic purposes due to high background fluorescence, we believe that use of these DNA and similar RNA constructs in molecular-biophysical studies may be helpful for analysis of conformational flexibility of single-stranded nucleic acids. With the aid of PNA "openers", molecular beacons were employed for the detection of a chosen target sequence directly in double-stranded DNA (dsDNA). Conditions are found where the stemless PNA beacon strongly discriminates the complementary versus mismatched dsDNA targets. Together with the insensitivity of PNA beacons to the presence of salt and DNA-binding/processing proteins, the latter results demonstrate the potential of these probes as robust tools for recognition of specific sequences within dsDNA without denaturation and deproteinization of duplex DNA.

A dumbbell-like complex formation for DNA target assay.

A simple and highly sensitive test for the detection of nucleic acid targets is described. It is based upon complex formation between a small-diameter magnetic particle and a larger and nonmagnetic particle through a hybridization reaction, what we have called a dumbbell-like complex. During the different steps, nonreacting nonmagnetic conjugates were eliminated by magnetic separation. At the end of the process, dumbbell complex number was estimated by counting under a microscope. Compared to the already described two-particle tests, our model was able to reach higher sensitivities, with a threshold typically in the amol/mL range (10(6) copies of HIV DNA/mL) without the need for complex instrumentation or genomic amplification reactions.

Interference-based detection of nucleic acid targets on optically coated silicon.

Sequence-specific detection of polynucleotides typically requires modified reporter probes that are labeled with radioactive, fluorescent, or luminescent moieties. Although these detection methods are capable of high sensitivity, they require instrumentation for signal detection. In certain settings, such as clinical point of care, instrumentation might be impractical or unavailable. Here we describe a detection approach in which formation of a nucleic acid hybrid is enzymatically transduced into a molecular thin film that can be visually detected in white light. The system exploits a flat, optically coated silicon-based surface to which capture oligonucleotides are covalently attached. The optimized system is capable of detection of nucleic acid targets present at sub-attomole levels. To supplement visual detection, signals can be quantitated by a charge-coupled device. The design and composition of the optical surface, optimization of immobilization chemistry for attachment of capture probes, and characterization of the efficiency of the hybridization process are presented. We describe the application of this system to detection of a clinically relevant target, the mecA gene present in methicillin-resistant Staphylococcus aureus.

Light-Up Probes: Thiazole Orange-Conjugated Peptide Nucleic Acid for Detection of Target Nucleic Acid in Homogeneous Solution

We have constructed light-up probes for nucleic acid detection. The light-up probe is a peptide nucleic acid (PNA) oligonucleotide to which the asymmetric cyanine dye thiazole orange (TO) is tethered. It combines the excellent hybridization properties of PNA and the large fluorescence enhancement of TO upon binding to DNA. When the PNA hybridizes to target DNA, the dye binds and becomes fluorescent. Free probes have low fluorescence, which may increase almost 50-fold upon hybridization to complementary nucleic acid. This makes the light-up probes particularly suitable for homogeneous hybridization assays, where separation of the bound and free probe is not necessary. We find that the fluorescence enhancement upon hybridization varies among different probes, which is mainly due to variations in free probe fluorescence. For eight probes studied the fluorescence quantum yield at 25°C in the unbound state ranged from 0.0015 to 0.08 and seemed to depend mainly on the PNA sequence. The binding of the light-up probes to target DNA is highly sequence specific and a single mismatch in a 10-mer target sequence was readily identified.

Multicenter International Work Flow Study of an Automated Polymerase Chain Reaction Instrument

PCR has the potential of extreme sensitivity, specificity, and diversity. As a consequence, transition of this procedure from research to routine application has been relatively rapid in recent years. This transition has, however, been hampered by the labor-intensive, high-skill requirements of existing protocols. Furthermore, as a number of quality-assessment exercises have demonstrated (1)(2)(3)(4)(5)(6)(7)(8), many of the existing “in-house” developed test procedures are of poor reproducibility in routine application. The introduction of a commercially produced test procedure has improved the reliability of testing, but the procedure has remained a relatively high-skill test method with only certain steps becoming semiautomated. The COBAS AMPLICORTM automated PCR system (Roche Molecular Systems) represents the first approach to full automation of the amplification and detection of nucleic acid targets (9). Evaluations of this instrument (10)(11) suggest that the sensitivity and specificity of the automated method are equivalent to those of manual methods, that intraassay sample carryover does not occur (9)(10), and that intra- and interassay variation using the automated system is low (9). However, there remains a need to evaluate the ability of the instrument, which is limited to 24 samples per thermal cycle amplification and 48 samples for the detection phase, to cope with both the work load and test diversity of a routine diagnostic laboratory. Moreover, the ability of the instrument to decrease the high labor and skill requirements of PCR and to decrease the overall cost of PCR needed to be further evaluated. We conducted a multicenter, international evaluation of the instrument from the standpoint of automation, work flow, and labor savings in laboratories differing in size, diversity of testing, and laboratory working practices. Five laboratories, chosen to represent a wide range of working …

5591580 Method, test element and test kit for semi-quantitative detection of target nucleic acid : Bergmeyer Lynn; Cummins Thomas J Rochester, NY, United States Assigned to Johnson & Johnson Clinical Diagnostics Inc

5591580 Method, test element and test kit for semi-quantitative detection of target nucleic acid : Bergmeyer Lynn; Cummins Thomas J Rochester, NY, United States Assigned to Johnson & Johnson Clinical Diagnostics Inc

COBAS AMPLICOR: fully automated RNA and DNA amplification and detection system for routine diagnostic PCR

The COBAS AMPLICOR system automates amplification and detection of target nucleic acids, making diagnostic PCR routine for a variety of infectious diseases. The system contains a single thermal cycler with two independently regulated heating/cooling blocks, an incubator, a magnetic particle washer, a pipettor, and a photometer. Amplified products are captured on oligonucleotide-coated paramagnetic microparticles and detected with use of an avidin-horseradish peroxidase (HRP) conjugate. Concentrated solutions of amplicon or HRP were pipetted without detectable carryover. Amplified DNA was detected with an intraassay CV of < 4.5%; the combined intraassay CV for amplification and detection was < 15%. No cross-reactivity was observed when three different target nucleic acids were amplified in a single reaction and detected with three target-specific capture probes. The initial COBAS AMPLICOR menu includes qualitative tests for diagnosing infections with Chlamydia trachomatis, Neisseria gonorrhoeae, Mycobacterium tuberculosis, and hepatitis C virus. All tests include an optional Internal Control to provide assurance that specimens are successfully amplified and detected.

Patent Evaluation: PCR techniques for detection of target nucleic acids

Patent Evaluation: PCR techniques for detection of target nucleic acids