Dermatitidis Strains Research Articles

P007 Fumaric reductase analog regulates sensitivity of pyrvinium pamoate and voriconazoole against Exophiala Dermatiti dis

Poster session 1, September 21, 2022, 12:30 PM - 1:30 PM ObjectivesThe black yeast Exophiala dermatitidis is an opportunistic pathogen that causes phaeohyphomycosis in both immunocompetent individuals and immunosuppressed patients, resulting in localized cutaneous and subcutaneous infections to more severe systemic forms such as neurotropic infections. Besides, E. dermatitidis was frequently found as a colonizer of pulmonary of cystic fibrosis patients, which appears to be associated with more advanced disease. Infections of E. dermatitidis are often chronic and recalcitrant. Previously, we have demonstrated that pyrvinium pamoate (PP) exerted antifungal activity alone (MIC 2 μg/ml) and favorable synergy with azoles against E. dermatitidis in vitro, which was confirmed in vivo via Galleria mellonella model. Further investigation revealed pyrvinium resulted in significant growth restriction of E. dermatitidis, reduction of biofilm formation, and significantly (P <.05) decrease of the efflux of Rhodamine 6 G. However, the underlying mechanism and probable target of PP are still unknown. The aim of this study is to investigate the role of fumaric reductase analog in the effect of PP against E. dermatitidis.MethodsThe knockout strain named △Exfr was constituted via polyethyleneglycol (PEG)-mediated transformation of protoplasts. A gene replacement cassette was generated as described. E. dermatitidis wild-type strain ATCC34100 DNA was used for molecular cloning. The pan7-1 plasmid vector, which contained the genetic markers hygromycin B phosphotransferase, was applied as a selection marker provider. DNA manipulation was performed according to standard laboratory procedures. The 5′ and 3′ flanking regions of fumaric reductase analog coding gene Exfr (Genbank geneID 20312383) were amplified using the primers ExfruF, ExfruR, and ExfrdF, ExfrdR, respectively. The selection maker Hph was amplified from pan7-1 by using primers hphF and hphR. These three fragments are subsequently fused via PCR with primers ExfuF and ExfuR. The protoplasts of wild-type strain ATCC34100 were prepared as described. Further, the fused gene fragment and PEG was mixed with protoplast to complete transformation, and the transformants were transferred to SDA solid culture base (containing a final concentration of 50 μg/ml hygromycin). DNA extracted from the transformants that could grow stably on HPH medium was sent for sequencing to verify that the target gene had been introduced into the location. The growth, morphology, and in vitro susceptibility of ATCC34100 and △Exfr were further investigated.ResultsThere was no significant difference in the colony or conidial morphology. However, the growth rate of △Exfr was slightly slower than that of the wild-type strain. In addition, the MICs of pyrvinium pamoate (PP) and voriconazole against △Exfr were 2-fold higher (16 ug/ml and 0.5ug/ml, respectively), compared with that of the wild-type strain.ConclusionThe preliminary results suggested that fumaric reductase analog may play an important role in drug sensitivity of E. dermatitidis, especially the sensitivity to PP and voriconazole. In addition, △Exfr is currently the only E. dermatitidis strain that was successfully knocked out by protoplast procedure, which provides reference for subsequent researches on E. dermatitidis gene knockout.Table 1.Primers used in this study.Primer nameSequence (5′ → 3’)ExfruFATCAGTAGTACTGTACGTCGTGTGCExfruRGATCTTGCCGATCCCCGTCGATCGCExfrdFGTGTTGTTCAAGTTGGGTGCATGTGExfrdRTCTTGAAGGCGAGTAGACGGACTCAExfuFGTTCAACTTTGGTTTTGTGGAGGAGExfuRCCTTCTCCCTCTTCCTACCGTCCTChphFCTCCGGAGTTGAGACAAATGGhphRCATCCACTGCACCTCAGAGC

Proteomics Reveals Distinct Changes Associated with Increased Gamma Radiation Resistance in the Black Yeast Exophiala dermatitidis.

The yeast Exophiala dermatitidis exhibits high resistance to γ-radiation in comparison to many other fungi. Several aspects of this phenotype have been characterized, including its dependence on homologous recombination for the repair of radiation-induced DNA damage, and the transcriptomic response invoked by acute γ-radiation exposure in this organism. However, these findings have yet to identify unique γ-radiation exposure survival strategies—many genes that are induced by γ-radiation exposure do not appear to be important for recovery, and the homologous recombination machinery of this organism is not unique compared to more sensitive species. To identify features associated with γ-radiation resistance, here we characterized the proteomes of two E. dermatitidis strains—the wild type and a hyper-resistant strain developed through adaptive laboratory evolution—before and after γ-radiation exposure. The results demonstrate that protein intensities do not change substantially in response to this stress. Rather, the increased resistance exhibited by the evolved strain may be due in part to increased basal levels of single-stranded binding proteins and a large increase in ribosomal content, possibly allowing for a more robust, induced response during recovery. This experiment provides evidence enabling us to focus on DNA replication, protein production, and ribosome levels for further studies into the mechanism of γ-radiation resistance in E. dermatitidis and other fungi.

In Vitro and In Vivo Study on the Synergistic Effect of Minocycline and Azoles against Pathogenic Fungi.

In vitro and in vivo interactions of minocycline and azoles, including itraconazole, voriconazole, and posaconazole, against filamentous pathogenic fungi were investigated. A total of 56 clinical isolates were studied in vitro via broth microdilution checkerboard technique, including 20 strains of Aspergillus fumigatus, 7 strains of Aspergillus flavus, 16 strains of Exophiala dermatitidis, 10 strains of Fusarium solani, and 3 strain s of Fusarium oxysporum The results revealed that minocycline did not exhibit any significant antifungal activity against any of the tested strains. However, favorable synergy of minocycline with itraconazole, voriconazole, or posaconazole was observed against 34 (61%), 28 (50%), and 38 (68%) isolates, respectively, including azole-resistant A. fumigatus and Fusarium spp. with inherently high MICs of azoles. Synergistic combinations resulted in 4-fold to 16-fold reduction of effective MICs of minocycline and azoles. No antagonism was observed. In vivo effects of minocycline-azole combinations were evaluated by survival assay in a Galleria mellonella model infected with E. dermatitidis strain BMU00034; F. solani strain FS9; and A. fumigatus strains AF293, AFR1, and AFR2. Minocycline acted synergistically with azoles and significantly increased larvae survival in all isolates (P < 0.001), including azole-resistant A. fumigatus and azole-inactive Fusarium spp. In conclusion, the results suggested that minocycline combined with azoles may help to enhance the antifungal susceptibilities of azoles against pathogenic fungi and had the potential to overcome azole resistance issues.

Comparative Genomic Analysis of Capsule-Producing Black Yeasts Exophiala dermatitidis and Exophiala spinifera, Potential Agents of Disseminated Mycoses.

The two black yeasts Exophiala dermatitidis and Exophiala spinifera that are clinically considered as the most virulent species potentially causing disseminated infections are both producing extracellular capsule-like material, are compared. In this study, 10 genomes of E. spinifera and E. dermatitidis strains, including both clinical and environmental isolates, were selected based on phylogenetic analysis, physiology tests and virulence tests, sequenced on the Illumina MiSeq sequencer and annotated. Comparison of genome data were performed between intraspecific and interspecific strains. We found capsule-associated genes were however not consistently present in both species by the comparative genomics. The prevalent clinical species, E. dermatitidis, has small genomes containing significantly less virulence-associated genes than E. spinifera, and also than saprobic relatives. Gene OG0012246 and Myb-like DNA-binding domain and SANT/Myb domain, restricted to two strains from human brain, was shared with the neurotropic species Rhinocladiella mackenziei. This study indicated that different virulence profiles existed in the two capsule-producing black yeasts, and the absence of consistent virulence-associated profiles supports the hypothesis that black yeasts are opportunists rather than primary pathogens. The results also provide the key virulence genes and drive the continuing research forward pathogen–host interactions to explore the pathogenesis.

Exophiala dermatitidis isolates from various sources: using alternative invertebrate host organisms (Caenorhabditis elegans and Galleria mellonella) to determine virulence

Exophiala dermatitidis causes chromoblastomycosis, phaeohyphomycosis and fatal infections of the central nervous system of patients with Asian background. It is also found in respiratory secretions from cystic fibrosis (CF) patients. In this study a variety of E. dermatitidis strains (isolates from Asia, environmental and CF) were characterized in their pathogenicity by survival analyzes using two different invertebrate host organisms, Caenorhabditis elegans and Galleria mellonella. Furthermore, the morphological development of hyphal formation was analyzed. E. dermatitidis exhibited pathogenicity in C. elegans. The virulence varied in a strain-dependent manner, but the nematodes were a limited model to study hyphal formation. Analysis of a melanin-deficient mutant (Mel-3) indicates that melanin plays a role during virulence processes in C. elegans. The strains isolated from Asian patients exhibited significantly higher virulence in G. mellonella compared to strains from other sources. Histological analyzes also revealed a higher potential of invasive hyphal growth in strains isolated from Asian patients. Interestingly, no significant difference was found in virulence between the Mel-3 mutant and their wild type counterpart during infection in G. mellonella. In conclusion, invasive hyphal formation of E. dermatitidis was associated with increased virulence. This work is the basis for future studies concerning E. dermatitidis virulence.

In vitro activities of antifungal drugs against environmental Exophiala isolates and review of the literature.

Exophiala is a genus of black fungi isolated worldwide from environmental and clinical specimens. Data on antifungal susceptibility of Exophiala isolates are limited and the methodology on susceptibility testing is not yet standardised. In this study, we investigated in vitro antifungal susceptibilities of environmental Exophiala isolates. A total of 87 Exophiala isolated from dishwashers or railway ties were included. A CLSI M38-A2 microdilution method with modifications was used to determine antifungal susceptibility for fluconazole, voriconazole, posaconazole, itraconazole, amphotericin B and terbinafine. Minimum inhibitory concentration (MIC) values were determined visually at 48hours, 72hours and 96hours. MIC-0 endpoint (complete inhibition of growth) was used for amphotericin B and azoles, except fluconazole, for which MIC-2 endpoint (~50% inhibition compared to growth control) was used. Both MIC-0 and MIC-1 (~80% inhibition compared to growth control) results were analysed for terbinafine to enable comparison with previous studies. Fungal growth was sufficient for determination of MICs at 48hours for all isolates except two Exophiala dermatitidis strains. At 72hours, most active antifungal agents according to GM MIC were voriconazole and terbinafine, followed by posaconazole, itraconazole and amphotericin B in rank order of decreasing activity. While amphotericin B displayed adequate in vitro activity despite relatively high MICs, fluconazole showed no meaningful antifungal activity against Exophiala.

Evaluation of malachite green decolorizing activity of Exophiala dermatitidis and Exophiala phaeomuriformis strains

Evaluation of malachite green decolorizing activity of Exophiala dermatitidis and Exophiala phaeomuriformis strains

Lonafarnib synergizes with azoles against Aspergillus spp. and Exophiala spp.

Farnesylation, which is catalyzed by farnesyltransferase, promotes membrane association of the modified protein and protein-protein interactions, and plays an important role in a number of physiological processes of pathogenic fungi, including stress response, environmental adaption and virulence. Lonafarnib is an orally bioavailable nonpeptide tricyclic farnesyltransferase inhibitor with excellent pharmacokinetic and safety profile. In the present study, we investigated the in vitro activities of lonafarnib alone or combined with azoles, including itraconazole, voriconazole, and posaconazole, against 22 strains of Aspergillus spp. and 18 strains of Exophiala dermatitidis via broth microdilution checkerboard technique. Lonafarnib alone was inactive against all isolates tested. However, synergistic effects between lonafarnib and itraconazole were observed in 86% Aspergillus strains and 94% E. dermatitidis strains. In addition, lonafarnib/posaconazole combination also exhibited synergism against 59% of Aspergillus strains and 100% E. dermatitidis strains. However, synergistic effects of lonafarnib/voriconazole were only observed in 32% Aspergillus strains and 28% E. dermatitidis strains. The effective working ranges of lonafarnib were 2-4μg/ml and 1-4μg/ml against Aspergillus isolates and E. dermatitidis isolates, respectively. No antagonism was observed in all combinations. This study demonstrated that lonafarnib could enhance the in vitro antifungal activity of itraconazole, posaconazole and voriconazole against Aspergillus spp. and E. dermatitidis, suggesting that azoles, especially itraconazole and posaconazole, combined with farnesyltransferase inhibitor might provide a potential strategy to the management of Aspergillus and Exophiala infections. However, further studies are warranted to elucidate the underlying mechanism and to investigate the potential of reliable and safe application in clinical practice.

The Dynamic Genome and Transcriptome of the Human Fungal Pathogen Blastomyces and Close Relative Emmonsia.

Three closely related thermally dimorphic pathogens are causal agents of major fungal diseases affecting humans in the Americas: blastomycosis, histoplasmosis and paracoccidioidomycosis. Here we report the genome sequence and analysis of four strains of the etiological agent of blastomycosis, Blastomyces, and two species of the related genus Emmonsia, typically pathogens of small mammals. Compared to related species, Blastomyces genomes are highly expanded, with long, often sharply demarcated tracts of low GC-content sequence. These GC-poor isochore-like regions are enriched for gypsy elements, are variable in total size between isolates, and are least expanded in the avirulent B. dermatitidis strain ER-3 as compared with the virulent B. gilchristii strain SLH14081. The lack of similar regions in related species suggests these isochore-like regions originated recently in the ancestor of the Blastomyces lineage. While gene content is highly conserved between Blastomyces and related fungi, we identified changes in copy number of genes potentially involved in host interaction, including proteases and characterized antigens. In addition, we studied gene expression changes of B. dermatitidis during the interaction of the infectious yeast form with macrophages and in a mouse model. Both experiments highlight a strong antioxidant defense response in Blastomyces, and upregulation of dioxygenases in vivo suggests that dioxide produced by antioxidants may be further utilized for amino acid metabolism. We identify a number of functional categories upregulated exclusively in vivo, such as secreted proteins, zinc acquisition proteins, and cysteine and tryptophan metabolism, which may include critical virulence factors missed before in in vitro studies. Across the dimorphic fungi, loss of certain zinc acquisition genes and differences in amino acid metabolism suggest unique adaptations of Blastomyces to its host environment. These results reveal the dynamics of genome evolution and of factors contributing to virulence in Blastomyces.

Analyses of black fungi by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS): species-level identification of clinical isolates of Exophiala dermatitidis.

Conventional mycological identifications based on the recognition of morphological characteristics can be problematic. A relatively new methodology applicable for the identification of microorganisms is based on the exploitation of taxon- specific mass patterns recorded from abundant cell proteins directly from whole-cell preparations, using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). This study reports the application of MALDI-TOF MS for the differentiation and identifications of black yeasts, isolated from the respiratory tracts of patients with cystic fibrosis (CF). Initial phenotypic and DNA sequence-based analyses identified these isolates to be Exophiala dermatitidis. The type strains of E. dermatitidis (CBS 207.35(T)) and other species of Exophiala were included in the MALDI-TOF MS analyses to establish the references for comparing the mass spectra of the clinical isolates of Exophiala. MALDI-TOF MS analyses exhibited extremely close relationships among the clinical isolates and with the spectra generated from the type strain of E. dermatitidis. The relationships observed between the E. dermatitidis strains from the MALDI-TOF MS profiling analyses were supported by DNA sequence-based analyses of the rRNA ITS1 and ITS2 regions. These data demonstrated the applicability of MALDI-TOF MS as a reliable, rapid and cost-effective method for the identification of isolates of E. dermatitidis and other clinically relevant fungi and yeasts that typically are difficult to identify by conventional methods.

Calcium Binding by the Essential Virulence Factor BAD-1 of Blastomyces dermatitidis

BAD-1 (Blastomyces adhesin 1), a 120-kDa protein of Blastomyces dermatitidis, functions as an adhesin, immune modulator, and essential virulence factor. Structurally, BAD-1 is composed of a short N-terminal region, a core of 30 tandem repeats critical for virulence, and a C-terminal epidermal growth factor domain that binds the protein to yeast cell surface chitin. Each of the 30 acidic residue-rich tandem repeats contains a sequence that resembles the calcium-binding loop of the EF-hand domain found in many calcium-binding proteins. Here, we investigated the binding of calcium by BAD-1 and its biological significance. Yeast washed with double distilled H2O released surface-bound BAD-1, but EGTA washes were an order of magnitude more efficient, suggesting an interaction between BAD-1 and calcium. Immobilized BAD-1 was stained with ruthenium red dye, an indicator of calcium-binding proteins. In equilibrium dialysis, BAD-1 bound 45Ca2+ with an affinity of 0.41 x 10(-5) m and a capacity of 27 calcium/mol. Mass spectrometry confirmed this capacity. Elevated [Ca2+] diminished BAD-1 solubility. Upon deletion of its C-terminal epidermal growth factor-like domain, BAD-1 resisted aggregation by elevated [Ca2+] but retained its affinity and capacity for calcium. Removing 20 copies of the tandem repeat, however, sharply reduced the capacity of BAD-1 for calcium. Growth of the bad-1 null yeast was inhibited by 5 mm EGTA, and re-expression of BAD-1 in trans or the addition of exogenous purified BAD-1 restored growth. Thus, BAD-1 is a high capacity calcium-binding protein. This property contributes to the structure and function of BAD-1, as well as to B. dermatitidis acquisition of calcium from the environment.

Glutathione-dependent extracellular ferric reductase activities in dimorphic zoopathogenic fungi

In this study, extracellular glutathione-dependent ferric reductase (GSH-FeR) activities in different dimorphic zoopathogenic fungal species were characterized. Supernatants from Blastomyces dermatitidis, Histoplasma capsulatum, Paracoccidioides brasiliensis and Sporothrix schenckii strains grown in their yeast form were able to reduce iron enzymically with glutathione as a cofactor. Some variations in the level of reduction were noted amongst the strains. This activity was stable in acidic, neutral and slightly alkaline environments and was inhibited when trivalent aluminium and gallium ions were present. Using zymography, single bands of GSH-FeRs with apparent molecular masses varying from 430 to 460 kDa were identified in all strains. The same molecular mass range was determined by size exclusion chromatography. These data demonstrate that dimorphic zoopathogenic fungi produce and secrete a family of similar GSH-FeRs that may be involved in the acquisition and utilization of iron. Siderophore production by these and other fungi has sometimes been considered to provide a full explanation of iron acquisition in these organisms. Our work reveals an additional common mechanism that may be biologically and pathogenically important. Furthermore, while some characteristics of these enzymes such as extracellular location, cofactor utilization and large size are not individually unique, when considered together and shared across a range of fungi, they represent an important novel physiological feature.

Evaluation of the in vitro and in vivo dimorphism of Sporothrix schenckii, Blastomyces dermatitidis, and Paracoccidioides brasiliensis isolates after preservation in mineral oil.

Morphological differentiation has commanded attention for its putative impact on the pathogenesis of invasive fungal infections. We evaluated in vitro and in vivo the dimorphism from mycelial to yeast-phase of Sporothrix schenckii, Blastomyces dermatitidis and Paracoccidioides brasiliensis isolates, two strains for each species, preserved in mineral oil. S. schenckii strains showed typical micromorphology at 25 degrees C but one strain was unable to complete the dimorphic process in vitro. After in vivo passage through mice the strains had the ability to turn into yeast-like cells and to form colonies on brain-heart infusion medium at 36 degrees C. B. dermatitidis strains grew as dirty white to brownish membranous colonies at 25 degrees C and their micromorphology showed thin filaments with single hyaline conidia. At 36 degrees C the colonies did not differ from those grown at 25 degrees C, but produced a transitional micromorphology. P. brasiliensis strains grew as cream-colored cerebriform colonies at 25 degrees C showing a transitional morphology. B. dermatitidis and P. brasiliensis strains did not turn into yeast-like cells in vivo. The present results demonstrate that B. dermatitidis and P. brasiliensis strains were unable to complete the dimorphic process even after in vivo passage, in contrast to the S. schenckii strain.

High prevalence of the neurotrope Exophiala dermatitidis and related oligotrophic black yeasts in sauna facilities.

The black yeast Exophiala dermatitidis, an agent of fatal brain infections in East Asia, is common in European steam baths. The related fungi Sarcinomyces phaeomuriformis and Exophiala mesophila were isolated from locations in these complexes with lower ambient temperature and/or moisture. The latter two species had dry, rather than slimy, colonies and lower maximum growth temperatures (38 degrees C, 32 degrees C) than E. dermatitidis (42 degrees C). Exophiala dermatitidis produces abundant extracellular polysaccharide (EPS). The only E. dermatitidis strains lacking EPS were found outside the steam baths. Therefore it is likely that the extracellular polysaccharides commonly produced by E. dermatitidis are significant to survival under hot and moist conditions. Substrates sampled as controls, such as fruit surfaces and human faeces, yielded Exophiala dermatitidis at very low frequency.

Mutation of the WI-1 gene yields an attenuated blastomyces dermatitidis strain that induces host resistance.

Systemic fungal infections are becoming more common and difficult to treat, and vaccine prevention is not available. Pulmonary infection with the dimorphic fungus Blastomyces dermatitidis often progresses and requires treatment to prevent fatality. We recently created a recombinant strain of the fungus lacking the WI-1 adhesin and pathogenicity. We show here that administration of viable yeast of this attenuated strain vaccinates against lethal pulmonary experimental infection due to isogenic and nonisogenic strains from diverse geographic regions. To our knowledge, this is the first example of a recombinant attenuated vaccine against fungi. The vaccine induces delayed-type hypersensitivity and polarized type 1 cytokine responses, which are linked with resistance. A cell-wall/membrane (CW/M) antigen from the vaccine strain also induces polarized and protective immune responses. Lymph node cells and CD4(+) T-cell lines raised with CW/M antigen transfer protective immunity when they release type 1 cytokine IFN-gamma, but not when they release IL-4, and neutralization of IFN-gamma confirmed its role in vivo. Thus, by mutating a pathogenetic locus in a dimorphic fungus, we have created an attenuated vaccine strain and have begun to elucidate fungal and host elements requisite for vaccine immunity.

Mitochondrial DNA analysis of Exophiala jeanselmei and Exophiala dermatitidis

Mitochondrial DNA (mtDNA) analysis with Hae III, Hind III and Msp I was performed in 45 Exophiala jeanselmei strains (30 Phialophora jeanselmei and 154 Phialophora gougerotii strains) and 31 Exophiala dermatitidis strains. The results were as follows, 1) P. jeanselmei and P. gougerotii are identical, 2) E. jeanselmei is classified into 18 types based on restriction profiles, 3) two strains of E. jeanselmei CBS 577.76 and CBS 578.76 are identified as E. dermatitidis, 4) E. dermatitidis has no intraspecific variation and is definitely distinct from E. jeanselmei, 5) E. jeanselmei is suggested to be a complex organism because of extensive mtDNA polymorphism.

Cottonseed extract versus pharmamedia for thein vitromould-yeast conversion ofBlastomyces dermatitidis

A cottonseed medium, based on a 1% aqueous extract of seeds of any of the eight indigenously available varieties of cotton belonging to Gossypium hirsutum or Gossypium arboreum, was evaluated for the mould-yeast conversion of Blastomyces dermatitidis in vitro, and compared with pharmamedia agar as a control. The cottonseed agar was found to be as efficient as pharmamedia agar for the mould-yeast conversion of the 19 B. dermatitidis strains tested. Therefore, cottonseeds provide an adequate and inexpensive substitute for pharmamedia for the mould-yeast conversion of B. dermatitidis. It should be noted that the term 'cottonseed' medium has been used rather loosely in the literature and that this medium is based on pharmamedia and not on a cottonseed extract. The authors suggest that media based on pharmamedia should be referred to as pharmamedia agar and the use of the term 'cottonseed' should be restricted to media containing cottonseed extract.

Susceptibility of Blastomyces dermatitidis conidia to products of oxidative metabolism

Conidia obtained from Blastomyces dermatitidis were exposed to H 2O 2, halide, and peroxidase, alone and in combination, and to hypochlorous acid, in order to determine fungal susceptibility to these compounds. B. dermatitidis strains V (ATCC 26199) and GA-1 (ATCC 26197) were used in this study. When exposed to H 2O 2, conidia from both strains were killed in a dose dependent fashion. LD 50's for strains V and GA-1 were 7 ± 4 and 3 ± 4 m M H 2O 2, respectively. A study of the kinetics of killing with 2.5 m M H 2O 2 revealed similarities in the rate of killing, except at 30 and 60 minutes, when the GA-1 strain was killed more rapidly than the V strain (59% vs 26% and 90% vs 42% dead at 30 and 60 minutes, respectively). All of the GA-1 conidia were killed within 120 minutes and 92 ± 5% of strain V were dead by this time. Exposure of conidia to KI or KCl demonstrated a lack of toxicity of either halide at concentrations up to 500 μ M. Similarly H 2O 2 and halide together did not kill more conidia of either strain than did either agent alone. When H 2O 2, KI, and either myeloperoxidase or houseradish peroxidase were incubated with strain V or GA-1, complete killing was seen at 60 minutes. Hypochlorous acid (10 μ M) was markedly fungicidal, killing 100% of both strains in 15 minutes. We conclude that both strains of B. dermatitidis conidia are susceptible to products of the phagocytic cell respiratory burst, but the concentrations of H 2O 2 required are beyond those produced in vivo. However, peroxidase, in concert with H 2O 2 and halide, as well as hypochlorous acid, is fungicidal in physiologically relevant concentrations.

Fungal-strain-dependent alterations in the time course and mortality of chronic murine pulmonary blastomycosis.

Intratracheal injection of 10(4) conidia of Blastomyces dermatitidis strain M1-A into mice was shown in previous work to induce chronic pulmonary and disseminated infection with histopathologic features of chronic human blastomycosis. Furthermore, 10-fold variations in inoculum density produced marked changes in mean survival times (MSTs), i.e., 32 days at 10(6), 36 days at 10(5), 97 days at 10(4), and 172 days at 10(3). A second strain (M1-B) failed to induce death in this model. To assess fungal-strain-dependent virulence, we extended these previous studies to 11 additional human isolates. Groups of male BALB/cByJ mice (6 to 8 weeks old) were injected intratracheally with 10(4) conidia from each of the 13 strains; the mice were weighed weekly and monitored for mortality, and their lungs were examined histopathologically. Infection rate and mortality were 100% in all groups except for the M1-B inoculated mice. For strains M1-B and M1-A, MST and mortality curves were not significantly different from those observed in our previously reported experiments. Four different survival patterns were noted in infected mice. The shortest MSTs were produced by strains M2-E, M2-B, M2-K, M2-H, and M2-A (24, 26, 26, 27, and 31 days, respectively), and the longest MST was seen in animal groups inoculated with strains M2-J and M2-G (130 and 134 days, respectively). Strains M2-I, M2-F, and M2-D produced intermediate MSTs of 65, 79, and 80 days, respectively. The 107-day MST induced by M1-A did not differ from strain M2-C-induced MST but differed significantly from the MST produced by the other strains. Pulmonary histopathology was similar in all animals dying with blastomycosis. The wide spectrum in survival times was not related to differences in clinical status of the patient from whom the isolate had been obtained, to fungal inoculum viability, or to individual mouse weight at inoculation. Strain-dependent virulence factors present in these fungal isolates alter the disease course in inbred mice in a fashion similar to that induced by 10-fold inoculum variation of strain M1-A conidia. These 13 isolates of B. dermatitidis, 1 avirulent and 12 with differing levels of virulence, provide tools for future studies into the nature of fungal virulence determinants in chronic blastomycosis.

Spontaneous mutant ofBlastomyces dermatitidisattenuated in virulence for mice

A spontaneous mutation occurred in cultures of a virulent strain of Blastomyces dermatitidis during serial passage at 35-37 degrees C. The mutant strain was shown to be 10,000-fold less virulent for mice than the parent strain, and this was independent of the challenge dose, the age of the challenged host, and the route of challenge (although attenuation was greater for pulmonary than for peritoneal challenge). The mutant grows as well as the parent in fungal media or in the presence of murine substrates. Studies of the chronology of pulmonary infection indicate the mutation affects an early event (first week after challenge) in establishment of infection and interaction with host defenses. Scanning electron microscopy showed that the mutant lacks deep irregular surface ridges and grooves present in the parent. It had increased resistance to crystal violet in vitro, increased susceptibility to bile, and could hydrolyze esculin. The latter findings are of interest because they place the mutant in an intermediate position with respect to these properties between the virulent parent and a previously studied avirulent strain. Lipid analyses indicated a marked increase in fatty acids in the mutant. Studies of four B. dermatitidis strains have also associated increasing palmitic acid and phospholipid content with increasing virulence.