Derivatives Of Kanamycin Research Articles

Synthesis and antibacterial activity of 6″-decanesulfonylacetamide-functionalised amphiphilic derivatives of amikacin and kanamycin

Aminoglycoside antibiotics represent the first class of successful drugs in the treatment of tuberculosis; however, mycobacteria and other bacterial species possess several drug resistance mechanisms to inactivate these natural products. In the past 15 years, a variety of amphiphilic aminoglycosides have been shown to have improved activity against infectious microorganisms and to subvert resistance mechanisms. Here, we report on four novel synthetic compounds derived from two existing potent antitubercular compounds and describe their activity against both Mycobacterium tuberculosis and Staphylococcus aureus. It was found that a decanesulfonylacetamide-based conjugate of amikacin displayed promising preliminary antitubercular activities, warranting further investigation to assess the therapeutic potential of these unique antimicrobials.

Molecular basis of the pleiotropic effects by the antibiotic amikacin on the ribosome

Aminoglycosides are a class of antibiotics that bind to ribosomal RNA and exert pleiotropic effects on ribosome function. Amikacin, the semisynthetic derivative of kanamycin, is commonly used for treating severe infections with multidrug-resistant, aerobic Gram-negative bacteria. Amikacin carries the 4-amino-2-hydroxy butyrate (AHB) moiety at the N1 amino group of the central 2-deoxystreptamine (2-DOS) ring, which may confer amikacin a unique ribosome inhibition profile. Here we use in vitro fast kinetics combined with X-ray crystallography and cryo-EM to dissect the mechanisms of ribosome inhibition by amikacin and the parent compound, kanamycin. Amikacin interferes with tRNA translocation, release factor-mediated peptidyl-tRNA hydrolysis, and ribosome recycling, traits attributed to the additional interactions amikacin makes with the decoding center. The binding site in the large ribosomal subunit proximal to the 3’-end of tRNA in the peptidyl (P) site lays the groundwork for rational design of amikacin derivatives with improved antibacterial properties.

Antibacterial Activity of Combination of Ethanol Extract of Pepermine Leaves (Mentha piperita L.) and Amikacin Against Klebsiella pneumonia, Staphylococcus aureus, and Escherichia coli

Peppermint leaves have been known to have antibacterial and antifungal activity. Amikacin is a semisynthetic derivative of kanamycin which is active against both Gram-positive and Gram-negative enteric bacteria. The combination of plant extracts with antibiotics is one way or alternative to overcome bacterial resistance to antibiotics. The purpose of this study was to determine the combined effect of the ethanolic extract of peppermint (Mentha piperita L.) and amikacin against Klebsiella pneumonia, Staphylococcus aureus, and Escherichia coli as well as the compounds contained in the ethanolic extract of peppermint (Mentha piperita L.) leaves. Antibacterial activity was tested using the disk diffusion method (Kirby Bauer) and the phytochemical screening test using the tube test method. The concentration of peppermint leaf ethanol extract for the combination test was 200 mg/mL and 400 mg/mL, for the concentration of amikacin used was 5 mg/mL with three comparisons made, namely 25:75, 50:50, and 75:25. The results showed a synergistic effect with the largest inhibition zone diameter at a ratio of 25:75 at a concentration of 200 mg/mL, which was 36.25±2.5 mm on Klebsiella pneumonia bacteria. While at a concentration of 400 mg/mL the diameter of the largest inhibition zone was 40±1.63 mm in Klebsiella pneumoniae bacteria with a ratio of 75:25. The results of statistical tests using the t-test showed a significance value of 0.000 0.05 so that there was a significant difference in the administration of each concentration to the resulting inhibition zone. The results of the phytochemical screening test contained alkaloids, phenolic compounds, flavonoids, tannins.

Efficient and selective catalytic hydroxylation of unsaturated plant oils: a novel method for producing anti-pathogens

With the increasing demand for antimicrobial agents and the spread of antibiotic resistance in pathogens, the exploitation of plant oils to partly replace antibiotic emerges as an important source of fine chemicals, functional food utility and pharmaceutical industries. This work introduces a novel catalytic method of plant oils hydroxylation by Fe(III) citrate monohydrate (Fe3+-cit.)/Na2S2O8 catalyst. Methyl (9Z,12Z)-octadecadienoate (ML) was selected as an example of vegetable oils hydroxylation to its hydroxy-conjugated derivatives (CHML) in the presence of a new complex of Fe(II)-species. Methyl 9,12-di-hydroxyoctadecanoate 1, methyl-9-hydroxyoctadecanoate 2 and methyl (10E,12E)-octadecanoate 3 mixtures is produced under optimized condition with oxygen balloon. The specific hydroxylation activity was lower in the case of using Na2S2O8 alone as a catalyst. A chemical reaction has shown the main process converted of plantoils hydroxylation and (+ 16 Da) of OH- attached at the methyl linoleate (ML-OH). HPLC and MALDI-ToF-mass spectrometry were employed for determining the obtained products. It was found that adding oxidizing agents (Na2S2O8) to Fe3+ in the MeCN mixture with H2O would generate the new complex of Fe(II)-species, which improves the C-H activation. Hence, the present study demonstrated a new functional method for better usage of vegetable oils.Producing conjugated hydroxy-fatty acids/esters with better antipathogenic properties. CHML used in food industry, It has a potential pathway to food safety and packaging process with good advantages, fundamental to microbial resistance. Lastly, our findings showed that biological monitoring of CHML-minimum inhibitory concentration (MIC) inhibited growth of various gram-positive and gram-negative bacteria in vitro study. The produced CHML profiles were comparable to the corresponding to previousstudies and showed improved the inhibition efficiency over the respective kanamycin derivatives.

Connexin hemichannel inhibitors with a focus on aminoglycosides

Connexins are membrane proteins involved directly in cell-to-cell communication through the formation of gap-junctional channels. These channels result from the head-to-head docking of two hemichannels, one from each of two adjacent cells. Undocked hemichannels are also present at the plasma membrane where they mediate the efflux of molecules that participate in autocrine and paracrine signaling, but abnormal increase in hemichannel activity can lead to cell damage in disorders such as cardiac infarct, stroke, deafness, cataracts, and skin diseases. For this reason, connexin hemichannels have emerged as a valid therapeutic target. Know small molecule hemichannel inhibitors are not ideal leads for the development of better drugs for clinical use because they are not specific and/or have toxic effects. Newer inhibitors are more selective and include connexin mimetic peptides, anti-connexin antibodies and drugs that reduce connexin expression such as antisense oligonucleotides. Re-purposed drugs and their derivatives are also promising because of the significant experience with their clinical use. Among these, aminoglycoside antibiotics have been identified as inhibitors of connexin hemichannels that do not inhibit gap-junctional channels. In this review, we discuss connexin hemichannels and their inhibitors, with a focus on aminoglycoside antibiotics and derivatives of kanamycin A that inhibit connexin hemichannels, but do not have antibiotic effect.

ENHANCEMENT OF ORAL UPTAKE OF AMIKACIN USING COPOLYMERS

Amikacinis a semisynthetic derivative of Kanamycin; it was approved for clinical use in the U.S. in 1976. Amikacin is broad-spectrum and potent aminoglycoside with limited clinical use owing high dose requirement.Many gram-negative bacteria, including many strains of Pseudomonas, Enterobacter, and serratiaare inhibited by 1-20 mcg/ml amikacin in vitro. After injection of 500mg of amikacin every 12hours (15mg/kg/d) intramuscularly, peak levels in serum are 10-30 mcg/ml . Amikacinis valuable because it was more active to aminoglycoside inactivating bacterial enzymes than is gentamicin. Since it was more inflated, amikacin was reserved for treatment of infections with gentamicin-resistant organisms. Peak plasma concentration should be kept between 20-30 mg/ml and trough concentration below 10mg/ml.There is no oral form of Amikacinis available as it is not absorbed orally. Various research on oral formulation of amikacinare going onsuch assignificantly improved oral uptake of amikacin in fvb mice in the presence of crl-1605 copolymer, liposomal amikacin dry powder inhaler effect of fines on in vitro performance, thiolated chitosan nanoparticles as an oral delivery system for amikacin. Key Word: Gram-negative bacteria, aminoglycoside,chitosan nanoparticles.

Divergent Synthesis of Three Classes of Antifungal Amphiphilic Kanamycin Derivatives.

A concise and novel method for site-selective alkylation of 1,3,6',3″-tetraazidokanamycin has been developed that leads to the divergent synthesis of three classes of kanamycin A derivatives. These new amphiphilic kanamycin derivatives bearing alkyl chains length of 4, 6, 7, 8, 9, 10, 12, 14, and 16 have been tested for their antibacterial and antifungal activities. The antibacterial effect of the synthesized kanamycin derivatives declines or disappears as compared to the original kanamycin A. Several compounds, especially those with octyl chain at O-4″ and/or O-6″ positions on the ring III of kanamycin A, show very strong activity as antifungal agents. In addition, these compounds display no toxicity toward mammalian cells. Finally, computational calculation has revealed possible factors that are responsible for the observed regioselectivity. The simplicity in chemical synthesis and the fungal specific property make the lead compounds ideal candidates for the development of novel antifungal agents.

Separation and Characterization of Unknown Impurities in Amikacin Sulfate by HPLC–MS n

Nine impurities in amikacin sulfate made in China were separated and identified by HPLC–MS n for the further improvement of official monographs in pharmacopoeias. The mass fragmentation patterns and structural assignment of these impurities were studied. The column was Acchrom Click XIon (250 × 4.6 mm, 5 μm). The mobile phase was 250 m mol L−1 ammonium formate and 1.4 % formic acid aqueous solution–acetonitrile–water (30:48:22). In positive mode, full scan LC–MS was first performed in order to obtain the m/z value of the protonated molecules, LC–MS–MS was then carried out on the compounds of interest on AB SCIEX 4000 Q TRAP™ composite triple quadrupole/linear ion trap tandem mass spectrometer. The complete fragmentation patterns of nine impurities were studied and used to obtain information about the structure of these impurities. The structures of nine impurities in amikacin sulfate were deduced based on the HPLC–MS n data, in which three impurities were novel impurities. Three novel impurities were 1-N-(l-4-amino-2-hydroxybutyryl) derivative of 4-O-(6-AG)DS, 1-N-(l-4-amino-2-hydroxybutyryl) derivative of 6-O-(3-AG)DS and 1-N-(l-4-amino-2-hydroxybutyryl) derivative of kanamycin D.

CuAAC-mediated diversification of aminoglycoside–arginine conjugate mimics by non-reducing di- and trisaccharides

Di- and triguanidinylation of trehalose, sucrose, and melizitose has been achieved via a Huisgen-cycloaddition approach. They can serve as aminoglycoside–arginine conjugate mimics, which has been demonstrated by their biological profiles in assays against Bacillus subtilis. For comparative studies, tetraguanidinylated neamine and kanamycin derivatives have also been synthesized and evaluated.

Kanamycin A 6′-pyrenylamide: a selective probe for heparin detection

We have synthesized a novel derivative of kanamycin A bearing a pyrenyl fluorophore which can be used for the specific recognition of heparin in EtOH:H2O (1:3) through formation of a 2:1 complex. The receptor shows specific optical signalling for heparin, but exhibits no significant changes on addition of various other biological molecules.

Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer

A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants ( K d [kanamycin] = 78.8 nM, K d [kanamycin B] = 84.5 nM, and K d [tobramycin] = 103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5′-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.

Rational design and synthesis of potent aminoglycoside antibiotics against resistant bacterial strains

Based on the structural information of biomacromolecule-aminoglycoside complexes, a series of kanamycin B analogues were rationally designed and synthesized. A convenient approach to the construction of kanamycin derivatives, in which the C4'-position on ring I of neamine moiety was modified, was developed. Most synthetic analogues exhibited good to excellent antibiotic activity against some typical drug-resistant bacteria. The disclosed results suggested that the C4'-position of aminoglycosides such as kanamycin may be an ideal site for modification to gain new modifying enzyme-resistant aminoglycoside antibiotics.

ChemInform Abstract: Synthesis of 3′,4′,6′-Trideoxy-6′-fluorokanamycin C, 3′,4′-Dideoxy-6′- C-(fluoromethyl)kanamycin B, and Their 1-N-((S)-4-Amino-2- hydroxybutanoyl) Derivatives.

3′,4′,6′-Trideoxy-6′-fluorokanamycin C (5) has been prepared by treatment of a protected kanamycin C derivative having the free 6-hydroxyl group with DAST, as the key step. Two 3′,4′-dideoxy-6′-C-(fluoromethyl)kanamycin B′s (17a and 17b) have been prepared from a 5′-C-aldehyde derivative of kanamycin C through a sequence of reactions involving nitromethane condensation and 6′,7′-(N-tosylepimino)-ring opening with KHF2, as the key steps. 1-N-[(S)-4-Amino-2-hydroxybutanoyl] derivatives of 5 and 17a were prepared by coupling of the [(S)-4-amino-2-hydroxybutanoyl] residue to the 1-amino group of 5 and 17a by utilizing the zinc acetate-ethyl trifluoroacetate method. Biological effects caused by the introduction of the fluorine atom in these products were discussed based on the chemical character of fluorine.

Functional characterization of KanP, a methyltransferase from the kanamycin biosynthetic gene cluster of Streptomyces kanamyceticus

KanP, a putative methyltransferase, is located in the kanamycin biosynthetic gene cluster of Streptomyces kanamyceticus ATCC12853. Amino acid sequence analysis of KanP revealed the presence of S-adenosyl-L-methionine binding motifs, which are present in other O-methyltransferases. The kanP gene was expressed in Escherichia coli BL21 (DE3) to generate the E. coli KANP recombinant strain. The conversion of external quercetin to methylated quercetin in the culture extract of E. coli KANP proved the function of kanP as S-adenosyl-L-methionine-dependent methyltransferase. This is the first report concerning the identification of an O-methyltransferase gene from the kanamycin gene cluster. The resistant activity assay and RT-PCR analysis demonstrated the leeway for obtaining methylated kanamycin derivatives from the wild-type strain of kanamycin producer.

Two-dimensional combinatorial screening and the RNA Privileged Space Predictor program efficiently identify aminoglycoside–RNA hairpin loop interactions

Herein, we report the identification of RNA hairpin loops that bind derivatives of kanamycin A, tobramycin, neamine, and neomycin B via two-dimensional combinatorial screening, a method that screens chemical and RNA spaces simultaneously. An arrayed aminoglycoside library was probed for binding to a 6-nucleotide RNA hairpin loop library (4096 members). Members of the loop library that bound each aminoglycoside were excised from the array, amplified and sequenced. Sequences were analyzed with our newly developed RNA Privileged Space Predictor (RNA-PSP) program, which analyzes selected sequences to identify statistically significant trends. RNA-PSP identified the following unique trends: 5′UNNNC3′ loops for the kanamycin A derivative (where N is any nucleotide); 5′UNNC3′ loops for the tobramycin derivative; 5′UNC3′ loops for the neamine derivative; and 5′UNNG3′ loops for the neomycin B derivative. The affinities and selectivities of a subset of the ligand–hairpin loop interactions were determined. The selected interactions have Kd values ranging from 10 nM to 605 nM. Selectivities ranged from 0.4 to >200-fold. Interestingly, the results from RNA-PSP are able to qualitatively predict specificity based on overlap between the RNA sequences selected for the ligands. These studies expand the information available on small molecule–RNA motif interactions, which could be useful to design ligands targeting RNA.

NMR-Based Analysis of Aminoglycoside Recognition by the Resistance Enzyme ANT(4′): The Pattern of OH/NH3+ Substitution Determines the Preferred Antibiotic Binding Mode and Is Critical for Drug Inactivation

The most significant mechanism of bacterial resistance to aminoglycosides is the enzymatic inactivation of the drug. Herein, we analyze several key aspects of the aminoglycoside recognition by the resistance enzyme ANT(4') from Staphylococcus aureus, employing NMR complemented with site-directed mutagenesis experiments and measurements of the enzymatic activity on newly synthesized kanamycin derivatives. From a methodological perspective, this analysis provides the first example reported for the use of transferred NOE (trNOE) experiments in the analysis of complex molecular recognition processes, characterized by the existence of simultaneous binding events of the ligand to different regions of a protein receptor. The obtained results show that, in favorable cases, these overlapping binding processes can be isolated employing site-directed mutagenesis and then independently analyzed. From a molecular recognition perspective, this work conclusively shows that the enzyme ANT(4') displays a wide tolerance to conformational variations in the drug. Thus, according to the NMR data, kanamycin-A I/II linkage exhibits an unusual anti-Psi orientation in the ternary complex, which is in qualitative agreement with the previously reported crystallographic complex. In contrast, closely related, kanamycin-B is recognized by the enzyme in the syn-type arrangement for both glycosidic bonds. This observation together with the enzymatic activity displayed by ANT(4') against several synthetic kanamycin derivatives strongly suggests that the spatial distribution of positive charges within the aminoglycoside scaffold is the key feature that governs its preferred binding mode to the protein catalytic region and also the regioselectivity of the adenylation reaction. In contrast, the global shape of the antibiotic does not seem to be a critical factor. This feature represents a qualitative difference between the target A-site RNA and the resistance enzyme ANT(4') as aminoglycoside receptors.

Kanamycin A‐Derived Cationic Lipids as Vectors for Gene Transfection

Cationic lipids nowadays constitute a promising alternative to recombinant viruses for gene transfer. We have recently explored the transfection potential of a new class of lipids based upon the use of aminoglycosides as cationic polar headgroups. The encouraging results obtained with a first cholesterol derivative of kanamycin A prompted us to investigate this family of vectors further, by modulating the constituent structural units of the cationic lipid. For this study, we have investigated the transfection properties of a series of new derivatives based on a kanamycin A scaffold. The results primarily confirm that aminoglycoside-based lipids are efficient vectors for gene transfection both in vitro and in vivo (mouse airways). Furthermore, a combination of transfection and physicochemical data revealed that some modifications of the constitutive subunits of kanamycin A-based vectors were associated with substantial changes in their transfection properties.

Aminoglycoside-arginine conjugates that bind TAR RNA: synthesis, characterization, and antiviral activity.

Regulation of HIV gene expression is crucially dependent on binding of the trans-activator protein, Tat, to the trans-activation response RNA element, TAR, found at the 5' end of all HIV-1 transcripts. Tat-TAR interaction is mediated by a short arginine-rich domain of the protein. Disruption of this interaction could, in theory, create a state of complete viral latency. A new class of small-molecule peptidomimetic TAR RNA binders, conjugates of aminoglycosides and arginine, was recently designed [Litovchick, A., Evdokimov, A. G., and Lapidot, A. (1999) FEBS Lett. 445, 73-79]. Two of these compounds, the tri-arginine derivative of gentamicin C (R3G) and the tetra-arginine derivative of kanamycin A (R4K), bind efficiently and specifically to TAR RNA. These compounds display negligible toxicity while being transported and accumulated in cell nuclei. Here we present a detailed synthesis and chemical characterization of the aminoglycoside-arginine conjugates R3G and R4K as well as GB4K, the tetra-gamma-guanidinobutyric derivative of kanamycin A. Their binding sites on TAR RNA were assigned by RNase A, uranyl nitrate, and lead acetate footprinting. The conjugates interact with TAR RNA in the widened major groove, formed by the UCU bulge and the neighboring base pairs of the upper stem portion of TAR, the binding site of Tat protein, and Tat-derived peptides (e.g., R52). Our results suggest an additional binding site of R4K and R3G compounds, in the lower stem-bulge region of TAR. The antiviral activity of the conjugates in cultured equine dermal fibroblasts infected with equine infectious anemia virus, used as a model system of HIV-infected cells, is also presented.

Mass spectrometric studies on the fragmentation and structural characterization of aminoacyl derivatives of kanamycin A

Described herein are the fragmentation pathways of kanamycin A and its 6′- N- and 1- N-acyl derivatives, as well as the determination of their positional isomers by FABMS and ESIMS in combination with tandem mass spectrometry. The presence or absence of key ions and the difference in abundance of common ions are correlated with the position of the substitution.

Development of a gas chromatography–mass spectrometry method for the analysis of aminoglycoside antibiotics using experimental design for the optimisation of the derivatisation reactions

A packed column GC–electron-capture detection method for the analysis of the aminoglycoside antibiotics kanamycin and gentamicin was adapted to capillary GC–MS. The analytes were derivatised using a two-step procedure involving trimethylsilylation of the hydroxyl groups with trimethylsilylimidazole and acylation of the amino groups with heptafluoro-butyrylimidazole. Electron impact mass spectra of the resulting derivatives of kanamycin A and gentamicins C 1, C 1a and C 2 are given and interpreted. The derivatisation procedure was optimised using experimental design. This chemometrical approach considers main effects as well as interactions of the influential parameters, thus conducting a more thorough investigation of the method than the common step-by-step approach. Optimisation using fractional factorial and Box Behnken Designs produced a derivatisation method featuring better yield than previously published methods while in many cases requiring less reagents and shorter reaction times.