Cytosine Analogue Research Articles

Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter.

Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.

Oxidative phosphorylation inhibition induces anticancerous changes in therapy-resistant-acute myeloid leukemia patient cells.

Treatment of acute myeloid leukemia (AML) is still a challenge because of common relapses or resistance to treatment. Therefore, the development of new therapeutic approaches is necessary. Various studies have shown that certain cancers, including some chemoresistant AML subsets, have upregulated oxidative phosphorylation. In this study, we aimed to assess treatment-resistant AML patients' cell modulation using oxidative phosphorylation inhibitors metformin and atovaquone alone and in various combinations with cytosine analog cytarabine and apoptosis inducer venetoclax. Metabolic activity analysis using Agilent Seahorse XF Extracellular Flux Analyzer revealed that peripheral blood mononuclear cells' metabolic state was different among treatment-resistant AML patients. We demonstrated that metformin decreased therapy-resistant-AML cell oxidative phosphorylation ex vivo, cotreatment with cytarabine and venetoclax slightly increased the effect. However, treatment with atovaquone did not have a marked effect in our experiment. Cell treatment had a slight effect on cell proliferation inhibition; combination of metformin, cytarabine, and venetoclax had the strongest effect. Moreover, a slightly higher effect on cell proliferation and cell cycle regulation was demonstrated in the cells with higher initial oxidative phosphorylation rate as demonstrated by gene expression analysis using reverse transcription quantitative polymerase chain reaction (RT-qPCR). Proteomic analysis by liquid chromatography-mass spectrometry demonstrated that chemoresistant AML cell treatment with metformin modulated metabolic pathways, while metformin combination with cytarabine and venetoclax boosted the effect. We suggest that oxidative phosphorylation inhibition is effective but not sufficient for chemoresistant AML treatment. Indeed, it causes anticancerous changes that might have an important additive role in combinatory treatment.

Silver(I)-mediated base pairing in parallel-stranded DNA involving the luminescent cytosine analog 1,3-diaza-2-oxophenoxazine.

1,3-Diaza-2-oxophenoxazine (X) has been introduced as a ligand in silver(I)-mediated base pairing in a parallel DNA duplex. This fluorescent cytosine analog is capable of forming stabilizing X-Ag(I)-X and X-Ag(I)-C base pairs in DNA duplexes, as confirmed by temperature-dependent UV spectroscopy and luminescence spectroscopy. DFT calculations of the silver(I)-mediated base pairs suggest the presence of a synergistic hydrogen bond. Molecular dynamics (MD) simulations of entire DNA duplexes nicely underline the geometrical flexibility of these base pairs, with the synergistic hydrogen bond facing either the major or the minor groove. Upon silver(I) binding to the X:X or X:C base pairs, the luminescence emission maximum experiences a red shift from 448 to 460nm upon excitation at 370nm. Importantly, the luminescence of the 1,3-diaza-2-oxophenoxazine ligand is not quenched significantly upon binding a silver(I) ion. In fact, the luminescence intensity even increases upon formation of a X-Ag(I)-C base pair, which is expected to be beneficial for the development of biosensors. As a consequence, the silver(I)-mediated phenoxazinone base pairs represent the first strongly fluorescent metal-mediated base pairs.

Effect of Different DNA Demethylating Agents on In vitro Cultures of Peach Rootstock GF 677

The appearance of somaclonal variability induced by in vitro cultivation is relatively frequent and, in some cases, provides a valuable source of new phenotypes suitable for crop improvement. Numerous studies have confirmed that these changes can be explained by alterations of DNA methylation. Interestingly, a group of chemical compounds termed ‘demethylating agents’ (DMT agents) enable artificial changes to be made in the DNA methylation state. Thus, these agents are theoretically able to induce new phenotypes or more favourable properties. The objective of the present study was to verify suitable conditions for the application of different DMT agents within in vitro protocols for micropropagation using the stone fruit rootstock GF 677 as an example. The impact of these agents on the properties of plant regenerants was evaluated, and their DNA methylation state was controlled by using an AFLP protocol based on a restriction endonuclease that differed in its sensitivity to methylated cytosines. Moreover, the effect of newly synthesised derivates was compared with that of conventional compounds with a well-documented DNA-demethylating impact. Based on the results, the suitable concentration for treatment by a DMT agent was established as approximately 50 µM. Promising results were generated using a combination of DMT agents with different mechanisms of action, such as azacytidine and dihydroxypropyladenine; under these conditions, probable synergy between methyltransferase interception by the cytosine analogue and interruption of methyl group donation by dihydroxypropyladenine significantly changed the DNA methylation state of treated plants. Regarding newly synthesised compounds, the 5,6-dihydro-5-azacytosine nucleoside showed the most promising results, which can likely be explained by its higher stability in the media used for in vitro cultivation.
 
 *********
 In press - Online First. Article has been peer reviewed, accepted for publication and published online without pagination. It will receive pagination when the issue will be ready for publishing as a complete number (Volume 47, Issue 3, 2019). The article is searchable and citable by Digital Object Identifier (DOI). DOI link will become active after the article will be included in the complete issue.
 *********

Factors influencing the intracellular exposure of gemcitabine triphosphate in children with CNS tumors.

e13547 Background: Gemcitabine (dFdC), a cytosine analog, is currently being evaluated as a therapy to treat children and young adults with central nervous systems (CNS) tumors in two clinical trials (NCT01878617 and NCT03434262). Once in the cell, dFdC undergoes complex and highly variable conversion to gemcitabine triphosphate (dFdCTP), which is responsible for its cytotoxic effects. Our objective is to identify the factors influencing dFdC and dFdCTP exposures in children. Methods: As part of treatment, patients with newly diagnosed medulloblastoma and patients with recurrent/refractory medulloblastoma or ependymoma receive 28-day cycles of dFdC, as a 30-minute IV infusion at 750, 1000 or 1250 mg/m2 on days 1 and 15 of each cycle. Patients with recurrent/refractory disease also receive concomitant ribociclib. Pharmacokinetic (PK) studies were performed after one dose of dFdC alone (day 1) and with ribociclib (day 15). dFdC and dFdCTP concentrations were measured in plasma and in peripheral blood mononuclear cells respectively, for up to 4h post-dose, using validated LC-MS/MS methods. The concentrations were analyzed using a population PK model. A preliminary covariate analysis was performed to evaluate the impact of factors (e.g., patient demographics and infusion rate) on dFdC and dFdCTP exposure (area under the curve). Results: dFdC and dFdCTP concentrations were fitted with a three-compartment linear model. dFdC infusion rate significantly influenced the drug exposures with a faster plasma dFdC elimination and higher dFdCTP formation observed at the lower infusion rate. On average, patients receiving dFdC as 25 or 33 mg/m2/min had a dFdCTP exposure of 526 µM·h vs 205 µM·h with a rate of 42 mg/m2/min (p < 0.001). Patient with lower body surface area also showed higher dFdC clearance. Significant intra-patient differences were observed in dFdCTP concentrations measured on days 1 and 15. Conclusions: This preliminary PK analysis shows a saturable formation of dFdCTP in children with CNS tumors, and suggests the need for longer infusion duration with higher dFdC dosages. Future work will evaluate potential drug-drug interaction with ribociclib and the effect of genotypic variants on dFdCTP exposure.

Abstract 2823: DNA methyltransferase inhibitors sensitize NSCLC cells to PARP inhibitors by induction of a double strand break repair defect

Abstract Non-small cell lung cancer (NSCLC) is the leading cause of cancer-related death in the US. Poly (ADP-ribose) polymerase inhibitors (PARPi) show efficacy as radiosensitizers in NSCLC, but arguably have gained greater importance in cancer therapeutics by exhibiting synthetic lethality (SL) in tumors with defects in the homologous recombination (HR) pathway of double strand break repair (DSBR). Mechanistically, PARPi cytotoxicity is partially mediated through trapping of PARP1 at sites of DNA damage, with next generation PARPis such as talazoparib (Tal) being potent PARP trappers. Our group has previously demonstrated that combining Tal with a DNA methyltransferase inhibitor (DNMTi) enhances PARPi cytotoxicity in acute myeloid leukaemia and breast cancer models. DNMTis are cytosine analogs that become incorporated into replicating DNA, where they covalently bind their target enzyme DNMT1. When combined with PARPi, DNMTis enhance PARP trapping at damage sites, which collapse into cytotoxic double strand breaks (DSB) when encountered by a replication fork. In the current study, we demonstrate synergistic cytotoxicity of Tal in combination with the DNMTi 5-azacytidine (Aza) in NSCLC cell lines by combination index analyses and colony forming assays. Further potentiation of Tal+Aza cytotoxicity is observed following induction of DNA damage via IR. These results were substantiated in an A549 xenograft model (n=8 per group) where Tal+Aza+IR significantly reduced tumor volume and increased survival compared to vehicle (p<0.001) or Tal+Aza without IR (p<0.05). We and others have previously reported that low dose DNMTi results in stable transcriptional changes in the cancer epigenome, including DNA damage response pathways. Here, we show by microarray analysis that NSCLC cell lines (A549, H23, H1299, H460) treated with Aza exhibit up- and downregulation of multiple genes in the DNA repair reactome, including decreased expression of the key HR-related gene FANCD2, and the non-homologous end joining (NHEJ) gene Ku80. These results were validated by mRNA and protein quantification in Aza-treated NSCLC cell lines and xenograft tumor samples. In keeping with a FANCD2-associated HR defect, Aza exposure is associated with reduced accumulation of RAD51 foci following IR, and reduced HR activity in an extrachromosomal HR assay. Additionally, increased sensitivity to IR post Aza treatment can be explained by decreased expression of NHEJ factor Ku80. These results indicate that Aza treatment in NSCLC induces a DSBR deficiency that can be targeted for SL by PARPi and can further sensitize to IR. Given these agents are currently in use in the clinic, this combination offers a promising therapeutic strategy that could be rapidly translated into clinical practice. Citation Format: Rachel Abbotts, Michael Topper, Daniel Fontaine, Christopher Biondi, Eun Yong Choi, Rena Lapidus, Stephen Baylin, Feyruz Rassool. DNA methyltransferase inhibitors sensitize NSCLC cells to PARP inhibitors by induction of a double strand break repair defect [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2018; 2018 Apr 14-18; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2018;78(13 Suppl):Abstract nr 2823.

Neurotoxicity of cytarabine (Ara-C) in dorsal root ganglion neurons originates from impediment of mtDNA synthesis and compromise of mitochondrial function.

Peripheral Nervous System (PNS) neurotoxicity caused by cancer drugs hinders attainment of chemotherapy goals. Due to leakiness of the blood nerve barrier, circulating chemotherapeutic drugs reach PNS neurons and adversely affect their function. Chemotherapeutic drugs are designed to target dividing cancer cells and mechanisms underlying their toxicity in postmitotic neurons remain to be fully clarified. The objective of this work was to elucidate progression of events triggered by antimitotic drugs in postmitotic neurons. For proof of mechanism study, we chose cytarabine (ara-C), an antimetabolite used in treatment of hematological cancers. Ara-C is a cytosine analog that terminates DNA synthesis. To investigate how ara-C affects postmitotic neurons, which replicate mitochondrial but not genomic DNA, we adapted a model of Dorsal Root Ganglion (DRG) neurons. We showed that DNA polymerase γ, which is responsible for mtDNA synthesis, is inhibited by ara-C and that sublethal ara-C exposure of DRG neurons leads to reduction in mtDNA content, ROS generation, oxidative mtDNA damage formation, compromised mitochondrial respiration and diminution of NADPH and GSH stores, as well as, activation of the DNA damage response. Hence, it is plausible that in ara-C exposed DRG neurons, ROS amplified by the high mitochondrial content shifts from physiologic to pathologic levels signaling stress to the nucleus. Combined, the findings suggest that ara-C neurotoxicity in DRG neurons originates in mitochondria and that continuous mtDNA synthesis and reliance on oxidative phosphorylation for energy needs sensitize the highly metabolic neurons to injury by mtDNA synthesis terminating cancer drugs.

Construction of All‐Carbon Quaternary Stereocenters via Asymmetric Cyclopropanations: Synthesis of Chiral Carbocyclic Pyrimidine Nucleosides

AbstractAn efficient route to synthesize chiral carbocyclic pyrimidine nucleoside analogues containing all‐carbon quaternary stereocenters has been established via the asymmetric intermolecular cyclopropanation of N1‐vinylpyrimidines and α‐aryl diazoesters. With 2 mol% of chiral dirhodium (II) carboxylate complex as the catalyst, a variety of chiral carbocyclic cytosine or uracil nucleoside analogues were obtained in good yields (up to 96% yield), high diastereoselectivities (>20:1 dr), and excellent enantioselectivities (up to 99% ee).magnified image

Kinetics and Thermodynamics of DNA Processing by Wild Type DNA-Glycosylase Endo III and Its Catalytically Inactive Mutant Forms.

Endonuclease III (Endo III or Nth) is one of the key enzymes responsible for initiating the base excision repair of oxidized or reduced pyrimidine bases in DNA. In this study, a thermodynamic analysis of structural rearrangements of the specific and nonspecific DNA-duplexes during their interaction with Endo III is performed based on stopped-flow kinetic data. 1,3-diaza-2-oxophenoxazine (tCO), a fluorescent analog of the natural nucleobase cytosine, is used to record multistep DNA binding and lesion recognition within a temperature range (5–37 °C). Standard Gibbs energy, enthalpy, and entropy of the specific steps are derived from kinetic data using Van’t Hoff plots. The data suggest that enthalpy-driven exothermic 5,6-dihydrouracil (DHU) recognition and desolvation-accompanied entropy-driven adjustment of the enzyme–substrate complex into a catalytically active state play equally important parts in the overall process. The roles of catalytically significant amino acids Lys120 and Asp138 in the DNA lesion recognition and catalysis are identified. Lys120 participates not only in the catalytic steps but also in the processes of local duplex distortion, whereas substitution Asp138Ala leads to a complete loss of the ability of Endo III to distort a DNA double chain during enzyme–DNA complex formation.

High Performance Liquid Chromatography Separation of Epigenetic Cytosine Variants.

Epigenetic modifications enable cells to genetically respond to chemical inputs from environmental sources. These marks play a pivotal role in normal biological processes (e.g., differentiation, host defense and metabolic programs) but also contribute to the development of a wide variety of pathological conditions (e.g., cancer and Alzheimer’s disease). In particular, DNA methylation represents very stable epigenetic modification of cytosine bases that is strongly associated with a reduction in gene activity. Although High Performance Liquid Chromatography (HPLC) methodologies have been used to resolve methylated cytosine from unmodified cytosine bases, these represent only two of the five major cytosine analogs in the cell. Moreover, failure to resolve these other cytosine analogs might affect an accurate description of the cytosine methylation status in cells. In this present study, we determined the HPLC conditions required to separate the five cytosine analogs of the methylation/demethylation pathway. This methodology not only provides a means to analyze cytosine methylation as a whole, but it could also be used to more accurately calculate the methylation ratio from biological samples.

Twenty-Five Years of Lamivudine: Current and Future Use for the Treatment of HIV-1 Infection.

Innovation in medicine is a dynamic, complex, and continuous process that cannot be isolated to a single moment in time. Anniversaries offer opportunities to commemorate crucial discoveries of modern medicine, such as penicillin (1928), polio vaccination (inactivated, 1955; oral, 1961), the surface antigen of the hepatitis B virus (1967), monoclonal antibodies (1975), and the first HIV antiretroviral drugs (zidovudine, 1987). The advent of antiretroviral drugs has had a profound effect on the progress of the epidemiology of HIV infection, transforming a terminal, irreversible disease that caused a global health crisis into a treatable but chronic disease. This result has been driven by the success of antiretroviral drug combinations that include nucleoside reverse transcriptase inhibitors such as lamivudine. Lamivudine, an L-enantiomeric analog of cytosine, potently affects HIV replication by inhibiting viral reverse transcriptase enzymes at concentrations without toxicity against human polymerases. Although lamivudine was approved more than 2 decades ago, it remains a key component of first-line therapy for HIV because of its virological efficacy and ability to be partnered with other antiretroviral agents in traditional and novel combination therapies. The prominence of lamivudine in HIV therapy is highlighted by its incorporation in recent innovative treatment strategies, such as single-tablet regimens that address challenges associated with regimen complexity and treatment adherence and 2-drug regimens being developed to mitigate cumulative drug exposure and toxicities. This review summarizes how the pharmacologic and virologic properties of lamivudine have solidified its role in contemporary HIV therapy and continue to support its use in emerging therapies.

Markerless deletion of putative alanine dehydrogenase genes in Bacillus licheniformis using a codBA-based counterselection technique.

Bacillus licheniformis strains are used for the large-scale production of industrial exoenzymes from proteinaceous substrates, but details of the amino acid metabolism involved are largely unknown. In this study, two chromosomal genes putatively involved in amino acid metabolism of B. licheniformis were deleted to clarify their role. For this, a convenient counterselection system for markerless in-frame deletions was developed for B. licheniformis. A deletion plasmid containing up- and downstream DNA segments of the chromosomal deletion target was conjugated to B. licheniformis and integrated into the genome by homologous recombination. Thereafter, the counterselection was done by using a codBA cassette. The presence of cytosine deaminase and cytosine permease exerted a conditionally lethal phenotype on B. licheniformis cells in the presence of the cytosine analogue 5-fluorocytosine. Thereby clones were selected that lost the integrated vector sequence and the anticipated deletion target after a second recombination step. This method allows the construction of markerless mutants in Bacillus strains in iterative cycles. B. licheniformis MW3 derivatives lacking either one of the ORFs BL03009 or BL00190, encoding a putative alanine dehydrogenase and a similar putative enzyme, respectively, retained the ability to grow in minimal medium supplemented with alanine as the carbon source. In the double deletion mutant MW3 ΔBL03009 ΔBL00190, however, growth on alanine was completely abolished. These data indicate that the two encoded enzymes are paralogues fulfilling mutually replaceable functions in alanine utilization, and suggest that in B. licheniformis MW3 alanine utilization is initiated by direct oxidative transamination to pyruvate and ammonium.

Synthesis of the Phosphoramidite Units for Benzene-Glycol Nucleic Acid.

Benzene-glycol nucleic acid-DNA chimeras form thermally and thermodynamically stable duplexes with complementary RNAs, and have base-discriminating abilities. This unit describes the synthesis of four nucleoside analogs, an adenine, cytosine, thymine, and guanine analogs with base-benzene-glycol structure. The synthesis starts with conversion of (S)-mandelic acid in arylboronic acid derivative, common intermediate. Nucleobase coupling of the intermediate and phosphitylation afford to phosphoroamidite units. © 2017 by John Wiley & Sons, Inc.

Substitution of Cytosine with Guanylurea Decreases the Stability of i-Motif DNA.

Both 5-aza-2'-deoxycytidine (decitabine) and its primary breakdown product, 2'-deoxyriboguanylurea (GuaUre-dR), have been shown to act as mutagens and epimutagens that cause replication stress and alter both DNA methylation and gene expression patterns. As cytosine analogues, both are expected to be preferentially incorporated into regions of GC skew where runs of cytosine residues are sequestered on one strand and guanine residues on the other. Given that such regions have been identified as sites with the potential for effects on gene expression and replication stress linked to formation of alternative DNA secondary structures, it is of interest to determine the influence that these base analogues might have on the stability of structures of this kind. Here we report that incorporation of GuaUre-dR into an i-motif-forming sequence decreases both the thermal and pH stability of an i-motif despite the apparent ability of GuaUre-dR to base pair with cytosine.

Toward Complete Sequence Flexibility of Nucleic Acid Base Analogue FRET.

Förster resonance energy transfer (FRET) using fluorescent base analogues is a powerful means of obtaining high-resolution nucleic acid structure and dynamics information that favorably complements techniques such as NMR and X-ray crystallography. Here, we expand the base-base FRET repertoire with an adenine analogue FRET-pair. Phosphoramidite-protected quadracyclic 2'-deoxyadenosine analogues qAN1 (donor) and qAnitro (acceptor) were synthesized and incorporated into DNA by a generic, reliable, and high-yielding route, and both constitute excellent adenine analogues. The donor, qAN1, has quantum yields reaching 21% and 11% in single- and double-strands, respectively. To the best of our knowledge, this results in the highest average brightness of an adenine analogue inside DNA. Its potent emissive features overlap well with the absorption of qAnitro and thus enable accurate FRET-measurements over more than one turn of B-DNA. As we have shown previously for our cytosine analogue FRET-pair, FRET between qAN1 and qAnitro positioned at different base separations inside DNA results in efficiencies that are highly dependent on both distance and orientation. This facilitates significantly enhanced resolution in FRET structure determinations, demonstrated here in a study of conformational changes of DNA upon binding of the minor groove binder netropsin. Finally, we note that the donor and acceptor of our cytosine FRET-pair, tCO and tCnitro, can be conveniently combined with the acceptor and donor of our current adenine pair, respectively. Consequently, our base analogues can now measure base-base FRET between 3 of the 10 possible base combinations and, through base-complementarity, between all sequence positions in a duplex.

Identification of potent inhibitors of DNA methyltransferase 1 (DNMT1) through a pharmacophore-based virtual screening approach

DNA methylation is an epigenetic change that results in the addition of a methyl group at the carbon-5 position of cytosine residues. DNA methyltransferase (DNMT) inhibitors can suppress tumour growth and have significant therapeutic value. However, the established inhibitors are limited in their application due to their substantial cytotoxicity. Additionally, the standard drugs for DNMT inhibition are non-selective cytosine analogues with considerable cytotoxic side-effects. In the present study, we have designed a workflow by integrating various ligand-based and structure-based approaches to discover new agents active against DNMT1. We have derived a pharmacophore model with the help of available DNMT1 inhibitors. Utilising this model, we performed the virtual screening of Maybridge chemical library and the identified hits were then subsequently filtered based on the Naïve Bayesian classification model. The molecules that have returned from this classification model were subjected to ensemble based docking. We have selected 10 molecules for the biological assay by inspecting the interactions portrayed by these molecules. Three out of the ten tested compounds have shown DNMT1 inhibitory activity. These compounds were also found to demonstrate potential inhibition of cellular proliferation in human breast cancer MDA-MB-231 cells. In the present study, we have utilized a multi-step virtual screening protocol to identify inhibitors of DNMT1, which offers a starting point to develop more potent DNMT1 inhibitors as anti-cancer agents.

Fluorescent RNA cytosine analogue \u2013 an internal probe for detailed structure and dynamics investigations

The bright fluorescent cytosine analogue tCO stands out among fluorescent bases due to its virtually unquenched fluorescence emission in duplex DNA. However, like most reported base analogues, it has not been thoroughly characterized in RNA. We here report on the first synthesis and RNA-incorporation of tCO, and characterize its base-mimicking and fluorescence properties in RNA. As in DNA, we find a high quantum yield inside RNA duplexes (<ΦF> = 0.22) that is virtually unaffected by the neighbouring bases (ΦF = 0.20–0.25), resulting in an average brightness of 1900 M−1 cm−1. The average fluorescence lifetime in RNA duplexes is 4.3 ns and generally two lifetimes are required to fit the exponential decays. Fluorescence properties in ssRNA are defined by a small increase in average quantum yield (<ΦF > = 0.24) compared to dsRNA, with a broader distribution (ΦF = 0.17–0.34) and slightly shorter average lifetimes. Using circular dichroism, we find that the tCO-modified RNA duplexes form regular A-form helices and in UV-melting experiments the stability of the duplexes is only slightly higher than that of the corresponding natural RNA (<ΔTm> = + 2.3 °C). These properties make tCO a highly interesting fluorescent RNA base analogue for detailed FRET-based structural measurements, as a bright internal label in microscopy, and for fluorescence anisotropy measurements of RNA dynamics.

Identification of 4-(3-Pyridyl)-4-oxobutyl-2'-deoxycytidine Adducts Formed in the Reaction of DNA with 4-(Acetoxymethylnitrosamino)-1-(3-pyridyl)-1-butanone: A Chemically Activated Form of Tobacco-Specific Carcinogens.

Metabolic activation of the carcinogenic tobacco-specific nitrosamines 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK, 1) and N′-nitrosonornicotine (NNN, 2) results in the formation of 4-(3-pyridyl)-4-oxobutyl (POB)-DNA adducts, several of which have been previously identified both in vitro and in tissues of laboratory animals treated with NNK or NNN. However, 2′-deoxycytidine adducts formed in this process have been incompletely examined in previous studies. Therefore, in this study we prepared characterized standards for the identification of previously unknown 2′-deoxycytidine and 2′-deoxyuridine adducts that could be produced in these reactions. The formation of these products in reactions of 4-(acetoxymethylnitrosamino)-1-(3-pyridyl)-1-butanone (NNKOAc, 3), a model 4-(3-pyridyl)-4-oxobutylating agent, with DNA was investigated. The major 2′-deoxycytidine adduct, identified as its stable cytosine analogue O2-[4-(3-pyridyl)-4-oxobut-1-yl]-cytosine (12), was O2-[4-(3-pyridyl)-4-oxobut-1-yl]-2′-deoxycytidine (13), whereas lesser amounts of 3-[4-(3-pyridyl)-4-oxobut-1-yl]-2′-deoxycytidine (14) and N4-[4-(3-pyridyl)-4-oxobut-1-yl]-2′-deoxycytidine (15) were also observed. The potential conversion of relatively unstable 2′-deoxycytidine adducts to stable 2′-deoxyuridine adducts by treatment of the adducted DNA with bisulfite was also investigated, but the harsh conditions associated with this approach prevented quantitation. The results of this study provide new validated standards for the study of 4-(3-pyridyl)-4-oxobutylation of DNA, a critical reaction in the carcinogenesis by 1 and 2, and demonstrate the presence of previously unidentified 2′-deoxycytidine adducts in this DNA.

Azacytidine Treatment Inhibits the Progression of Herpes Stromal Keratitis by Enhancing Regulatory T Cell Function.

Ocular infection with herpes simplex virus 1 (HSV-1) sets off an inflammatory reaction in the cornea which leads to both virus clearance and chronic lesions that are orchestrated by CD4 T cells. Approaches that enhance the function of regulatory T cells (Treg) and dampen effector T cells can be effective to limit stromal keratitis (SK) lesion severity. In this report, we explore the novel approach of inhibiting DNA methyltransferase activity using 5-azacytidine (Aza; a cytosine analog) to limit HSV-1-induced ocular lesions. We show that therapy begun after infection when virus was no longer actively replicating resulted in a pronounced reduction in lesion severity, with markedly diminished numbers of T cells and nonlymphoid inflammatory cells, along with reduced cytokine mediators. The remaining inflammatory reactions had a change in the ratio of CD4 Foxp3+ Treg to effector Th1 CD4 T cells in ocular lesions and lymphoid tissues, with Treg becoming predominant over the effectors. In addition, compared to those from control mice, Treg from Aza-treated mice showed more suppressor activity in vitro and expressed higher levels of activation molecules. Additionally, cells induced in vitro in the presence of Aza showed epigenetic differences in the Treg-specific demethylated region (TSDR) of Foxp3 and were more stable when exposed to inflammatory cytokines. Our results show that therapy with Aza is an effective means of controlling a virus-induced inflammatory reaction and may act mainly by the effects on Treg.IMPORTANCE HSV-1 infection has been shown to initiate an inflammatory reaction in the cornea that leads to tissue damage and loss of vision. The inflammatory reaction is orchestrated by gamma interferon (IFN-γ)-secreting Th1 cells, and regulatory T cells play a protective role. Hence, novel therapeutics that can rebalance the ratio of regulatory T cells to effectors are a relevant issue. This study opens up a new avenue in treating HSV-induced SK lesions by increasing the stability and function of regulatory T cells using the DNA methyltransferase inhibitor 5-azacytidine (Aza). Aza increased the function of regulatory T cells, leading to enhanced suppressive activity and diminished lesions. Hence, therapy with Aza, which acts mainly by its effects on Treg, can be an effective means to control virus-induced inflammatory lesions.

Rapid accumulation of HIV-1 thymidine analogue mutations and phenotypic impact following prolonged viral failure on zidovudine-based first-line ART in sub-Saharan Africa.

Background: Lack of viral load monitoring of ART is known to be associated with slower switch from a failing regimen and thereby higher prevalence of MDR HIV-1. Many countries have continued to use thymidine analogue drugs despite recommendations to use tenofovir in combination with a cytosine analogue and NNRTI as first-line ART. The effect of accumulated thymidine analogue mutations (TAMs) on phenotypic resistance over time has been poorly characterized in the African setting. Patients and methods: A retrospective analysis of individuals with ongoing viral failure between weeks 48 and 96 in the NORA (Nevirapine OR Abacavir) study was conducted. We analysed 36 genotype pairs from weeks 48 and 96 of first-line ART (14 treated with zidovudine/lamivudine/nevirapine and 22 treated with zidovudine/lamivudine/abacavir). Phenotypic drug resistance was assessed using the Antivirogram assay (v. 2.5.01, Janssen Diagnostics). Results: At 96 weeks, extensive TAMs (≥3 mutations) were present in 50% and 73% of nevirapine- and abacavir-treated patients, respectively. The mean (SE) number of TAMs accumulating between week 48 and week 96 was 1.50 (0.37) in nevirapine-treated participants and 1.82 (0.26) in abacavir-treated participants. Overall, zidovudine susceptibility of viruses was reduced between week 48 [geometric mean fold change (FC) 1.3] and week 96 (3.4, P = 0.01). There was a small reduction in tenofovir susceptibility (FC 0.7 and 1.0, respectively, P = 0.18). Conclusions: Ongoing viral failure with zidovudine-containing first-line ART is associated with rapidly increasing drug resistance that could be mitigated with effective viral load monitoring.