Cytoplasm Of Untreated Cells Research Articles

Is RNA Binding in the Rossmann Fold Essential for GAPDH Intranuclear Functions?

In addition to its prominent enzymatic activity, GAPDH is an enigmatic component of multiple unrelated biochemical entities. In this study, we explored a series of mutated GAPDH and fusion EGFP-GAPDH polypeptides and compared nuclear accumulation, intranuclear mobility and RNA binding properties of the wild type and variant GAPDH proteins. Our results revealed that RNA binding to T99I-mutated GAPDH with non-functional NAD+ binding center occurred outside the Rossmann fold. At the cellular level, wild type and mutated EGFP-GAPDH demonstrated distinct intranuclear localization in unstressed cells versus cells exposed to genotoxic stress. Wild type EGFP-GAPDH protein localized in the cytoplasm of untreated cells and accumulated in the nucleus following araC treatment (11.8±2.72% vs. 27.4±4.28% nuclear EGFP-GAPDH, % of total EGFP-GAPDH, p = 0.0007). Mutated T99I EGFP-GAPDH accumulated at high level in the nuclei of untreated and araC-treated cells (34.3±8.49% vs. 41.3±16.0% nuclear EGFP-GAPDH, % of total EGFP-GAPDH, p = 0.21). Mutated T99I EGFP-GAPDH lost its ability to form tight interactions with intranuclear macromolecules. After araC treatment, immobile fraction (1-Mf) of wild type EGFP-GAPDH in the nuclei of SW48-297 cells was three times higher (0.75±0.127 vs. 0.26±0.133%, p<0.0001), recovery half-time was three times higher (0.84±0.075 vs. 0.3±0.085 s, p<0.0001) and diffusion coefficient D was five times lower (4.6±0.85 vs. 23.3±13.79 μm2/s, p = 0.0001) compared to cells expressing T99I variant. Our results suggest that the switch between RNA and NAD+ binding to GAPDH could be a regulatory mechanism governing participation of GAPDH in NAD+-dependent complexes and could serve a depot to supply diverse biochemical processes with NAD+.

Low-Dose Actinomycin-D Induces Redistribution of Wild-Type and Mutated Nucleophosmin Followed by Cell Death in Leukemic Cells.

Specific mutations involving C-terminal part of the nucleolar protein nucleophosmin (NPM) are associated with better outcome of acute myeloid leukemia (AML) therapy, possibly due to aberrant cytoplasmic NPM localization facilitating induction of anti-NPM immune response. Actinomycin D (actD) is known to induce nucleolar stress leading to redistribution of many nucleolar proteins, including NPM. We analyzed the distribution of both wild-type and mutated NPM (NPMmut) in human cell lines, before and after low-dose actD treatment, in living cells expressing exogenous fluorescently labeled proteins as well as using immunofluorescence staining of endogenous proteins in fixed cells. The wild-type NPM form is prevalently nucleolar in intact cells and relocalizes mainly to the nucleoplasm following actD addition. The mutated NPM form is found both in the nucleoli and in the cytoplasm of untreated cells. ActD treatment leads to a marked increase in NPMmut amount in the nucleoplasm while a mild decrease is observed in the cytoplasm. Cell death was induced by low-dose actD in all the studied leukemic cell lines with different p53 and NPM status. In cells expressing the tumor suppresor p53 (CML-T1, OCI-AML3), cell cycle arrest in G1/G0 phase was followed by p53-dependent apoptosis while in p53-null HL60 cells, transient G2/M-phase arrest was followed by cell necrosis. We conclude that although actD does not increase NPM concentration in the cytoplasm, it could improve the effect of standard chemotherapy in leukemias through more general mechanisms.

Detection of AHR in in vitro-generated Th17 cells using novel monoclonal antibodies (P1191)

Abstract Several studies have shown an increase in the mRNA levels of AHR in both mouse and human Th17 cells, however, protein levels in Th17 cells have been difficult to assess due to lack of reagents for flow cytometry. We developed novel monoclonal antibodies to enable detection of AHR by flow cytometry. The antibodies were characterized by western blot, flow cytometry, and immunocytochemistry. By western blot, both antibodies produced bands of approximately 95-100 kDa in lysates prepared from transiently transfected HEK-293T cells and HepG2 or Hepa1c1c7 cells (for human and mouse AHR, respectively). The anti-mouse AHR antibody also recognized a band of 95 kDa in liver lysates prepared from C57Bl/6 mice but not from AHR knockout mice. High levels of AHR protein were detected in cells polarized under Th17 conditions for 3 days, and these levels decreased on days 6 and 10, while AHR was not detected if Th17 were polarized from splenocytes from AHR knockout mice. Analysis of AHR expression by immunocytochemistry showed that these antibodies recognized AHR in the cytoplasm of untreated cells. Upon treatment of cells with FICZ, a high affinity ligand for AHR, AHR translocated to the nucleus. These antibodies will enable the examination of expression levels of AHR by flow cytometry and immunocytochemistry to provide insight into the role of AHR in many biological systems.

Anti-Migration Effects of Gekko Sulfated Glycopeptide on Human Hepatoma SMMC-7721 Cells

Gekko swinhonis Guenther has been used as an anti-cancer drug in traditional Chinese medicine for hundreds of years. Previous studies showed that the Gekko sulfated polysaccharide-protein complex suppressed the proliferation and migration of hepatoma cells. Gekko sulfated glycopeptide α was obtained from Gekko sulfated polysaccharide-protein complex using papain hydrolysis. Gekko sulfated glycopeptide α inhibited the proliferation and migration of SMMC-7721 cells. The secretion of IL-8 and the concentration of intracellular calcium were decreased after Gekko sulfated glycopeptide α exposure. SMMC-7721 cells in the control group showed abnormal features, with a polygonal shape, whereas this changed to a spindle shape after the treatment with Gekko sulfated glycopeptide α. Actin filaments were distributed diffusely along the cell membrane in control cells, whereas those were polymerized and preferentially accumulated in the cytoplasm of treated cells. Microtubules distributed in the cytoplasm of untreated cells were located diffusely whereas those in treated cells were polymerized. Therefore, Gekko sulfated glycopeptide α inhibit the migration of hepatoma cells via reducing the secretion of IL-8 and the concentration of intracellular calcium, as well as regulating the reorganization of cytoskeleton.

Identification of cyclophilin A as a CD99-binding protein by yeast two-hybrid screening

CD99 is a 32 kDa surface glycoprotein, which is involved in the migration of leukocytes and the transport of ganglioside GM1 and transmembrane proteins. To identify signaling mechanisms triggered by CD99 engagement, a LexA-based yeast two-hybrid system was utilized to identify proteins interacting with the cytoplasmic domains of CD99. In seven positive clones, we attempted to ascertain whether cyclophilin A (CypA) was involved in CD99-mediated signaling, since CypA had been implicated as a signaling regulator for kinases and phosphatases. The interaction between CD99 and CypA was confirmed by co-immunoprecipitation and confocal immunofluorescence studies. Interestingly, the amounts of CypA associated with CD99 increased upon CD99 engagement. We prepared an expression plasmid by inserting CypA cDNA into pEGFP, in order to visualize cellular CypA. In HeLa or HEK 293T cells transfected with the pEGFP-CypA plasmid, GFP-tagged CypA was diffusely present in the cytoplasm of untreated cells. However, CypA-GFP moved to the cell periphery and membrane blebbing, and became colocalized with CD99 upon CD99 engagement. These results suggest that CypA may be either a signaling mediator or a signaling regulator for CD99.

GRIM-19, a death-regulatory gene product, suppresses Stat3 activity via functional interaction.

Signal transducer and activator of transcription 3 (Stat3) is a latent cytoplasmic transcription factor that can be activated by cytokines and growth factors. Stat3 plays important roles in cell growth, anti-apoptosis and cell transformation, and is constitutively active in various cancers. We examined its potential regulators by yeast two-hybrid screening. GRIM-19, a gene product related to interferon-beta- and retinoic acid-induced cancer cell death, was identified and demonstrated to interact with Stat3 in various cell types. The interaction is specific for Stat3, but not for Stat1 and Stat5a. The interaction regions in both proteins were mapped, and the cellular localization of the interaction was examined. GRIM-19 itself co-localizes with mitochondrial markers, and forms aggregates at the perinulear region with co-expressed Stat3, which inhibits Stat3 nuclear translocation stimulated by epidermal growth factor (EGF). GRIM-19 represses Stat3 transcriptional activity and its target gene expression, and also suppresses cell growth in Src-transformed cells and a Stat3-expressing cell line. Our data suggest that GRIM-19 is a novel negative regulator of Stat3.

Monocytic Differentiation of HL-60 Cells Is Characterized by the Nuclear Translocation of Phosphatidylinositol 3-Kinase and of Definite Phosphatidylinositol-Specific Phospholipase C Isoforms

Immunochemical and immunocytochemical data indicate that nuclei of HL-60 cells contain different enzymes involved in the phosphoinositide cycle, such as PI 3-K and the phosphatidylinositol-specific PLC isoforms β3, γ1 and γ2. These enzymes translocate differently to the nuclear fraction when HL-60 cells are treated with differentiating doses of vitamin D3: PI 3-K translocated progressively to the nucleus in parallel with full differentiation until 96 hours. PLC β3 increased until 72 hours of treatment and then lowered its intranuclear amount and PLC γ1 was unchanged at all the examined times. PLC γ2 nuclear translocation increased progressively until 96 hours of vitamin D3 administration. A fourth PLC isozyme, β2, present in the cytoplasm of untreated cells, translocates to the cytoplasm after vitamin D3 addition and reaches the highest concentration at the end of monocytic differentiation. Terminal monocytic differentiation was characterized at the nuclear level by high levels of PI 3-K and PLC γ2 and by the novel expression of PLC β2. We then observed that the ξ isoform of PKC, constitutively present in nuclei of HL-60 cells, translocated to the nucleus when cells were induced to differentiate along the monocytic lineage, but the nuclear translocation of PKC ξ was blocked as a consequence of PI 3-K inhibition by Wortmannin. These findings indicate that the main components of the noncanonical and canonical inositol lipid signal transduction pathways, including PI 3-K, PLC β2 and β3, PLC γ2, undergo nuclear translocation and may therefore play a relevant role during monocytic differentiation at the nuclear level. Furthermore, PKC ξ nuclear translocation appears to be related to PI 3-K activity.

Signal Transduction and Hormone-dependent Internalization of the Thyrotropin-releasing Hormone Receptor in Cells Lacking Gq and G11

The thyrotropin-releasing hormone (TRH) receptor was expressed in embryonic fibroblasts from mice lacking the alpha subunits of Gq and G11 (Fq/11 cells) to determine whether G protein coupling is necessary for agonist-dependent receptor internalization. Neither TRH nor agonists acting on endogenous receptors increased intracellular calcium unless the cells were co-transfected with the alpha subunit of Gq. In contrast, temperature-dependent internalization of [3H]MeTRH in Fq/11 cells was the same whether Gqalpha was expressed or not. A rhodamine-labeled TRH analog and fluorescein-labeled transferrin co-localized in endocytic vesicles in Fq/11 cells, indicating that endocytosis took place via the normal clathrin pathway. Cotransfection with beta-arrestin or V53D beta-arrestin increased TRH-dependent receptor sequestration. Fq/11 cells were co-transfected with the TRH receptor and a green fluorescent protein (GFP)-beta-arrestin conjugate. GFP-beta-arrestin was uniformly distributed in the cytoplasm of untreated cells and quickly translocated to the periphery of the cells when TRH was added. A truncated TRH receptor that lacks potential phosphorylation sites in the cytoplasmic carboxyl terminus signaled but did not internalize or cause membrane localization of GFP-beta-arrestin. These results prove that calcium signaling by the TRH receptor requires coupling to a G protein in the Gq family, but TRH-dependent binding of beta-arrestin and sequestration do not.

Effect of dexamethasone on cell proliferation of neuroepithelial tumor cell lines.

The effect of glucocorticoid on cell proliferation, the expression of glucocorticoid receptor, and the relationship between inhibition of cell growth and apoptosis were investigated in four established neuroepithelial tumor cell lines (KNS42, T98G, A172, and U251MG). Glucocorticoid receptor expression was located in the cytoplasm of untreated cells, but translocated into nuclei after treatment with dexamethasone in KNS42, T98G, and A172 cells. U251MG did not express glucocorticoid receptors. Dexamethasone significantly inhibited the growth of KNS42 and T98G cell lines, at high concentrations in contrast to growth stimulation at low concentration. Dexamethasone inhibited proliferation of A172 cell line at all concentrations from 10(-4) M to 10(-7) M. These were prevented by RU38486, a specific glucocorticoid antagonist. Apoptosis did not occur in any cell lines after dexamethasone treatment. There was no response to glucocorticoid by U251MG cells. Dexamethasone treatment of neuroepithelial tumor cells expressing glucocorticoid receptors causes translocation into the nucleus to modulate cell proliferation upon binding of different concentrations of dexamethasone in vitro. Dexamethasone inhibits proliferation of some neuroepithelial cell lines, not by glucocorticoid-induced apoptosis. The bimodal potential of glucocorticoid to stimulate or suppress proliferation of neuroepithelial tumor cells expressing glucocorticoid receptor must be considered in clinical trials.

Interferon activation of the transcription factor Stat91 involves dimerization through SH2-phosphotyrosyl peptide interactions

Stat91 (a 91 kd protein that acts as a signal transducer and activator of transcription) is inactive in the cytoplasm of untreated cells but is activated by phosphorylation on tyrosine in response to a number of polypeptide ligands, including interferon α (IFN-α) and IFN-γ. We report here that the inactive Stat91 in the cytoplasm of untreated cells is a monomer and that upon IFN-γ-induced phosphorylation it forms a stable homodimer. Only the dimer is capable of binding to a specific DNA sequence directing transcription. Through dissociation and reassociation assays, we show that dimerization of Stat91 is mediated through SH2-phosphotyrosyl peptide interactions. Dimerization involving SH2 recognition of specific phosphotyrosyl peptides may well provide a prototype for interactions among family members of STAT proteins to form different transcription complexes.

DNA-Binding Protein Activated by Gamma Radiation in Human Cells

DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.

DNA-binding protein activated by gamma radiation in human cells.

DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.

Rapid activation by interferon alpha of a latent DNA-binding protein present in the cytoplasm of untreated cells.

The highly conserved interferon (IFN)-stimulated regulatory elements of the human genes 6-16 and 9-27 bind to one or more proteins (E factor) detected in extracts of human Bristol 8 B cells or human foreskin fibroblast cells treated with IFN-alpha. E factor is not detectable in extracts of untreated cells and appears in IFN-treated cells within less than 1 min in a form extractable with low salt and thus presumably not bound to DNA. After a few more minutes, the level of this form decreases in parallel with the increase of a form extractable only with high salt and thus presumably bound to DNA. Induction of E factor by IFN-alpha can occur in nuclei-free cytoplasts, whereas no E factor was detected in IFN-treated nucleoplasts. Together, these results suggest a model for signal transduction in which latent E factor, located in the cytoplasm, is activated or released from an inhibitor very rapidly upon binding of IFN-alpha to its receptor. Active E factor can then migrate to the nucleus, where it binds to the IFN-stimulated regulatory elements of IFN-regulated genes, activating their transcription.

Anatomy of herpes simplex virus DNA VII. alpha-RNA is homologous to noncontiguous sites in both the L and S components of viral DNA

Previous reports from this laboratory (Honess and Roizman, 1974) have operationally defined alpha polypeptides as the viral proteins that are synthesized first in HEp-2 cells treated with cycloheximide from the time of infection with herpes simplex virus type 1 until the withdrawal of the drug 12 to 15 h after infection. It has also been shown that the viral RNA (designated alpha RNA) that accumulates in the cytoplasm during cycloheximide treatment and on polyribosomes immediately upon withdrawal of the drug is homologous to 10 to 12% of viral DNA, whereas the viral RNA accumulating in the cytoplasm of untreated cells at 8 to 14 h after infection is homologous to 43% of viral DNA (Kozak and Roizman, 1974). In the present study, alpha RNA and cytoplasmic RNA extracted from untreated cells 8 h after infection were each hybridized in liquid to in vitro labeled restriction endonuclease fragments generated by cleavage of herpes simplex virus type 1 DNA with Hsu I, with Bgl II, and with both enzymes simultaneously. The data show that only a subset of the fragments hybridized to alpha RNA, and these are scattered within both the L and S components of the DNA. There are at least five noncontiguous regions in the DNA homologous to alpha RNA; two of these are located partially within the reiterated sequences in the S component. All fragments tested hybridized more extensively with 8-h cytoplasmic RNA than with alpha RNA. Four adjacent fragments, corresponding to 30% of the DNA and mapping within the L component, hybridized exclusively with the cytoplasmic RNA extracted from cells 8 h after infection.