Azacitidine Treatment Cycles Research Articles

Azacitidine treatment for myeloid leukemia associated with Down syndrome: A nationwide retrospective study in Japan.

Hypomethylating agent treatment for myeloid leukemia associated with Down syndrome (ML-DS) has been scarcely reported. Herein, we collected information on azacitidine treatment for ML-DS in Japan. Forty-eight cycles of azacitidine treatment were performed for 12 patients, including 11 relapsed or refractory (R/R) patients. In 40 cycles, azacitidine was used as monotherapy. No azacitidine-related death was observed. One cycle concurrently administered with methotrexate-based intrathecal therapy was discontinued due to toxicities. Only 4 of the 19 cycles given in non-remission achieved complete or partial remission. In conclusion, although most toxicities were acceptable, azacitidine monotherapy might be insufficient for R/R ML-DS cases.

Real-world study of the use of azacitidine in myelodysplasia in Australia.

Hypomethylating agents are the most widely used upfront therapy for patients with myelodysplastic syndrome (MDS) who are not suitable for hematopoietic stem cell transplantation. In Australia, azacitidine was, until recently, the only approved and subsidized treatment for patients with intermediate-2 and high-risk MDS, chronic myelomonocytic leukemia, and low blast acute myeloid leukemia. We analyzed prescription data to evaluate the real-world persistence and overall survival (OS) of patients prescribed azacitidine for the first time in Australia. A retrospective cohort analysis of patients who had been prescribed Pharmaceutical Benefits Scheme (PBS)-listed azacitidine for the first time, between January 2016 and April 2021, was conducted using the PBS 10% dataset. Treatment persistence and OS were estimated using Kaplan-Meier methods. The impact of the number of treatment cycles and treatment adherence on OS was also estimated. There were 351 patients in the PBS 10% dataset who initiated treatment with azacitidine. The average age (standard deviation [SD]) at azacitidine initiation was 71.9 (11.1) years and the average number (SD) of azacitidine prescriptions was 5.6 (0.2). The median persistence on azacitidine was 15.6 months, and the OS was 13.4 months. The median OS for patients who had six or more cycles of azacitidine treatment was greater compared to patients who had five or less cycles of treatment. The data from this real-world study illustrate the unmet medical needs of patients with MDS treated with azacitidine in Australia. The majority of patients are not treated with the optimal number of cycles of azacitidine, which is negatively correlated with patient outcomes.

Real-World Treatment Patterns, Outcomes and Disease Burden of Japanese Patients with High-Risk Myelodysplastic Syndrome: A Claims Database Study

Introduction Inherent complex pathophysiology of myelodysplastic syndrome (MDS) along with its higher occurrences in elderly population often limits available treatment options. In Japan, azacitidine (AZA) is the only first-line (1L) treatment, which is not cytarabine-based, available for patients (pts) with high-risk MDS (HR-MDS) ineligible for hematopoietic stem cell transplantation (HSCT). Prior autoimmune diseases have been associated with susceptibility of MDS. However, durability of AZA treatment and data on MDS-specific comorbidities, especially immune-driven events are currently lacking in Japanese pts. This study aimed to answer clinical questions on AZA real-world treatment outcomes in Japan, the epidemiology of autoimmune diseases in this specific pt cohort, as well as treatment cost. Methods This was a retrospective, longitudinal study utilizing hospital-based administrative claims for MDS patients in the Medical Data Vision (MDV) database in Japan. Data on pt demographics, clinical characteristics, treatments, procedures and hospitalization records were collected. Adult pts with first a confirmed MDS diagnosis either as an inpatient or twice in outpatient setting during the identification period (1October 2008 - 30 September 2017), who had a bone marrow biopsy in ±3 months from index date and at least 1 MDS-related treatment post-index date, were included in this real-world study. Pts with confirmed acute myeloid leukemia (AML) diagnosis or who had any history of HSCT, graft-versus-host-disease or transplant-related disorder/complications were excluded. As IPSS/R scoring is unavailable in MDV, pts were classified as HR-MDS if they had either AZA treatment or HSCT within 6 months post-index date, or pancytopenia diagnosis within 6 months post-index date and initiated AZA within 12 months. Results Of 6204 pts who met the eligibility criteria (main cohort), 2138 pts were assigned as HR-MDS. The median age of pts in the main cohort was 74.0 years (range: 18.0 - 100.0 years, ≥60 years old: 87.8%) vs 73.0 years (range: 20.0 - 95.0 years; ≥60 years old: 88.6%) in the HR-MDS cohort. Mean Charlson Comorbidity Index was 1.7 (± 1.66) and 1.6 (± 1.47) for the main cohort and HR-MDS cohort respectively. The proportion of transfusion-dependent pts in the main cohort was 9.4% vs 7.1% of patients in the HR-MDS cohort. Among 2138 pts with HR-MDS, 251 pts reported having concomitant autoimmune disease with rheumatoid arthritis (32.3%), glomerulonephritis (26.7%) and seronegative arthritis (23.1%) being the most common. More pts in the main cohort (53.2%) compared to pts with HR-MDS (38.9%) received anti-anemic drugs, G-CSF and iron chelators as supportive therapy at 1L. Compared to 39.5% pts in main cohort, 88.3% pts with HR-MDS received antineoplastic agents at 1L therapy. In HR-MDS cohort, 2078 pts received AZA in different cycles (1-3 cycles: 40.5%, 4-6 cycles: 21.1%, 7-9 cycles: 11.5%, >9 cycles: 26.9%) but only 121 pts received intensive chemotherapy (1 cycle: 90.1%, 2 cycles: 9.1%, >2 cycles: 0.8%). Median duration of MDS-specific treatment for patients with HR-MDS was 9.8 months. Significantly higher median OS (P<0.001) was achieved in pts with HR-MDS who received more cycles of AZA (Fig. 1: 1-3 cycles: 14.6 months, 4-6 cycles: 21.4 months, 7-9 cycles: 22.8 months, >9 cycles 40.8 months). After controlling for death as a competing risk, the cumulative incidence function (CIF) of HSCT and AML transformation was not affected by the number of cycles of AZA received. Although more cycles of AZA treatment increased the total treatment cost, median cost per pt per month was inversely affected with the lowest cost for pts receiving >9 cycles (Fig. 2). Conclusion Our findings based on the real-world data analysis in Japanese pts follow the similar trend of elderly pts with HR-MDS mostly receiving AZA as 1L treatment. Despite higher median OS being associated with higher number of AZA cycles, only ~27% pts with HR-MDS received >9 cycles of AZA. Autoimmune disease was reported by 11.7% of pts with HR-MDS. Although treatment cost increased with number of cycles of AZA received, median cost per pt per month was lowest in patients receiving >9 cycles. The cost per pt per month for other MDS-related treatment as well as costs for blood transfusions and infection related treatments were lower as increasing cycles of AZA were given which contributed to lower cost per pt per month. Figure 1View largeDownload PPTFigure 1View largeDownload PPT Close modal

Real-world data on efficacy and safety of azacitidine therapy in chronic myelomonocytic leukemia in China: results from a multicenter, retrospective study

SummaryChronic myelomonocytic leukemia (CMML) is a rare and aggressive myeloid malignancy with overlapped features of myelodysplastic syndromes/myeloproliferative neoplasms. Azacitidine (AZA), a hypomethylating agent, has been approved for the treatment of CMML in China, but real-world data are limited. Medical records of CMML patients who had received subcutaneously injected AZA were reviewed from January 2018 at five participating sites in China. Response was assessed according to the modified International Working Group (IWG 2006) criteria. Between January 2018 and November 2020, a total of 24 patients with CMML were included with a median age of 63 years. Patients received a median of 3 cycles of AZA treatment (range, 1–8). Overall response rate (ORR) was 37.5% (9 of 24); CR rate, PR rate, and mCR/HI rate were 8.3% (n = 2), 8.3% (n = 2), and 20.8% (n = 5), respectively. At a median duration of follow-up of 14.0 months (range 0.0–22.0 months), the median overall survival (OS) was 23.0 months. Univariate analysis revealed that ≥ 3 cycles of treatment was significantly associated with a higher 1-year OS rate compared with < 3 cycles of AZA treatment. Treatment was generally well-tolerated. The most common (> 10%) AEs were thrombocytopenia (n = 7, 29.2%), pneumonitis (n = 4, 16.7%) and fever (n = 3, 12.5%). This study provides valuable real-life data in China on the treatment schedules, efficacy and safety of AZA in the treatment of CMML.

JUVENILE MYELOMONOCYTIC LEUKEMIA SINGLE CENTER EXPERIENCE

In the 5-year follow-up of patients diagnosed with Juvenile Myelomonocytic Leukemia (JMML) in a single center; reveal treatment and survival analyzes In this study, clinical and laboratory data of 12 JMML patients followed in Ankara Pediatric Hematology Hospital and Ankara City Hospital Pediatric Hematology Clinics between 2015-2020 were analyzed retrospectively. The median age at diagnosis was 1.7 years (0.23-5.7). Monosomy 7, 4 PTPN11, 2 NRAS, 4 KRAS, 1 CBL mutations were detected in 2 of the patients. Hematopoietic stem cell transplantation was performed in 8 of the patients. Before transplantation, 7 patients had received a median of 4 cycles of azacitidine treatment. The mean time from diagnosis to transplantation was 15 months (1-29 months). The 5-year overall survival at median 15-month follow-up was 50%. With hypomethylating agents and HSCT, survival in JMML improves compared to historical control groups. However, further multicenter prospective studies are needed to prevent long-term mortality and morbidity.

Management of adverse events in patients with acute myeloid leukemia in remission receiving oral azacitidine: experience from the phase 3 randomized QUAZAR AML-001 trial

BackgroundMost older patients with acute myeloid leukemia (AML) who attain morphologic remission with intensive chemotherapy (IC) will eventually relapse and post-relapse prognosis is dismal. In the pivotal QUAZAR AML-001 trial, oral azacitidine maintenance therapy significantly prolonged overall survival by 9.9 months (P < 0.001) and relapse-free survival by 5.3 months (P < 0.001) compared with placebo in patients with AML in first remission after IC who were not candidates for transplant. Currently, the QUAZAR AML-001 trial provides the most comprehensive safety information associated with oral azacitidine maintenance therapy. Reviewed here are common adverse events (AEs) during oral azacitidine treatment in QUAZAR AML-001, and practical recommendations for AE management based on guidance from international cancer consortiums, regulatory authorities, and the authors’ clinical experience treating patients in the trial.MethodsQUAZAR AML-001 is an international, placebo-controlled randomized phase 3 study. Patients aged ≥ 55 years with AML and intermediate- or poor-risk cytogenetics at diagnosis, who had attained first complete remission (CR) or CR with incomplete blood count recovery (CRi) within 4 months before study entry, were randomized 1:1 to receive oral azacitidine 300 mg or placebo once-daily for 14 days in repeated 28-day cycles. Safety was assessed in all patients who received ≥ 1 dose of study drug.ResultsA total of 469 patients received oral azacitidine (n = 236) or placebo (n = 233). Median age was 68 years. Patients received a median of 12 (range 1–80) oral azacitidine treatment cycles or 6 (1–73) placebo cycles. Gastrointestinal AEs were common and typically low-grade. The most frequent grade 3–4 AEs during oral azacitidine therapy were hematologic events. AEs infrequently required permanent discontinuation of oral azacitidine (13%), suggesting they were effectively managed with use of concomitant medications and oral azacitidine dosing modifications.ConclusionOral azacitidine maintenance had a generally favorable safety profile. Prophylaxis with antiemetic agents, and blood count monitoring every other week, are recommended for at least the first 2 oral azacitidine treatment cycles, and as needed thereafter. Awareness of the type, onset, and duration of common AEs, and implementation of effective AE management, may maximize treatment adherence and optimize the survival benefits of oral azacitidine AML remission maintenance therapy.Trial registration This trial is registered on clinicaltrials.gov: NCT01757535 as of December 2012.

Relationship between Low Pretreatment Geriatric Nutritional Risk Index and Poor Tolerability of Azacitidine in Patients with Myelodysplastic Syndromes

Background: Predicting tolerability and treatment-related risks associated with azacitidine (AZA) in patients with myelodysplastic syndromes (MDS) before the initiation of therapy is required for appropriate treatment. Thus, in this study, the nutritional status of patients with MDS prior to AZA treatment was evaluated using the geriatric nutritional risk index (GNRI). Tolerability and overall survival (OS) after AZA initiation were also investigated. Methods: This was a single-center retrospective observational study. A total of 59 patients with MDS treated with AZA were assessed using GNRI, and a comparison of undernourished (GNRI <92, n = 27) and non-undernourished (GNRI ≥92, n = 32) patients was performed. Results: The undernourished group had a significant reduction in the number of patients that successfully completed 4 cycles of AZA treatment compared with the non-undernourished group (undernourished group, 11/27 patients, 40.7% vs. non-undernourished group, 24/32 patients, 75.0%; p = 0.009). Factors associated with the difference included karyotype and GNRI. There was also a significant increase in the rate of infectious complications in the undernourished group compared with the non-undernourished group (undernourished group, 33/60 cycles, 55.0% vs. non-undernourished group, 31/92 cycles, 33.7%; p = 0.012). Lastly, a significant reduction in OS was observed in the undernourished group compared with the non-undernourished group (undernourished group, 11.5 months; 95% CI, 5.2–16.7 vs. non-undernourished group, 21.9 months; 95% CI, 13.8–24.0; p = 0.026). Factors associated with OS included both the revised International Prognostic Scoring System (IPSS-R) and GNRI. Conclusions: These results indicate that predicting treatment completion and adverse events in patients with MDS prior to AZA treatment is important. This study suggests GNRI may be a valuable nutritional assessment tool for determining tolerability and OS of AZA treatment.

Continuity and efficacy of real-world use of azacitidine.

Long-term azacitidine (AZA) treatment is necessary for its maximal therapeutic effect. This study examined the continuity and efficacy of AZA treatment in real-world use. We conducted a retrospective study in 38 patients who had completed AZA treatment at the Ogaki Municipal Hospital between April 2011 and August 2019. The median number of AZA received cycles was 4. The number of AZA treatment cycles received was 1-3 cycles in 15 (39.5%), 4-6 cycles in 15 (39.5%), and ≥ 7 cycles in 8 (21.1%). The most common reason for discontinued AZA treatment was infection. Overall response rate was 33.3% in patients with discontinued AZA use (< 4 cycles) and 56.5% in patients with continued AZA (≥ 4). Median overall survival (OS) was 124 (15-529) days and 391 (132-2,825) days in the respective groups (p<0.01). The presence of peripheral blood blasts (PBs) was a prognostic factor for continuation of treatment (p =0.03). Discontinued AZA treatment due to infection (p <0.01), and PBs (p =0.03) were unfavourable prognostic factors for OS. Long-term AZA use is beneficial for improvement and survival. Infection control and presence of PBs were important factors for continuing AZA. These data support the idea of long-term continued treatment with AZA for optimal benefit to patients.

Leczenie upustami krwi przeładowania żelazem u pacjenta z zespołem mielodysplastycznym w trakcie skutecznego leczenia azacytydyną

We present the case of 75 year-old-man who was treated with azacitidine because of myelodysplastic syndrome RAEB-2 (refractory anemia with excess of blasts 2). The treatment was started with azacitidine, erytropoietin and regular blood transfusion (13 units in total). After 4 courses of treat­ment the blood picture has normalized and the program of regular venesections was implemented. The patient underwent 11 phlebotomy sessions which resulted in ferritin level decrease from 879 μ g/mL to 471 μ g/mL. After 27 cycles of azacitidine treatment the disease transformed to acute myeloblastic leukamia. The patient survived 3 years from the diagnosis of MDS. We believe that signifficant reduction of ferritin level prevented the development of iron overload symptoms and delayed transformation to acute leukemia.

Azacitidine in Lower-Risk Myelodysplastic Syndromes: A Meta-Analysis of Data from Prospective Studies.

After erythropoiesis-stimulating agent (ESA) failure, lenalidomide and hypomethylating agents are the only remaining treatment options for most patients with lower-risk myelodysplastic syndromes (LR-MDS). Optimal choice of these agents as front-line therapy in non-del(5q) LR-MDS is unclear. Because azacitidine clinical data mainly describe experience in higher-risk MDS, we performed a meta-analysis of patient-level data to evaluate azacitidine in patients with red blood cell (RBC) transfusion-dependent LR-MDS. We searched English-language articles for prospective phase II and III azacitidine clinical trials and patient registries published between 2000 and 2015, and Embase abstracts from 2015 conferences. Patient-level data from identified relevant studies were provided by investigators. Meta-analyses followed Preferred Reporting Items for Systematic Reviews and Meta-Analyses guidelines. Efficacy endpoints were RBC transfusion independence (TI) and Clinical Benefit (RBC-TI, erythroid response, and complete or partial remission, per International Working Group 2006 criteria for MDS). Data for 233 patients from 6 clinical studies and 1 registry study met criteria for inclusion in analyses. Overall, 90.3% of patients had non-del(5q) LR-MDS. Pooled estimates from random-effects models of RBC-TI and Clinical Benefit were 38.9% and 81.1%, respectively; for the ESA-refractory subgroup, they were 40.5% and 77.3%; and for patients with isolated anemia, they were 41.9% and 82.5%. In multivariate analyses, planned use of ≥6 azacitidine treatment cycles was significantly predictive of response. Azacitidine effects in these patients, most with non-del(5q) LR-MDS, were promising and generally similar to those reported for lenalidomide in similar patients. The choice of initial therapy is important because most patients eventually stop responding to front-line therapy and alternatives are limited. Lower-risk myelodysplastic syndromes (LR-MDS) are primarily characterized by anemia. After erythropoiesis-stimulating agent (ESA) failure, lenalidomide and hypomethylating agents are the only remaining treatment options for most patients. This meta-analysis of 233 azacitidine-treated red blood cell (RBC) transfusion-dependent patients with LR-MDS (92.3% non-del[5q]) from 7 studies showed 38.9% became RBC transfusion-independent. There is no clear guidance regarding the optimal choice of lenalidomide or hypomethylating agents for patients with non-del(5q) LR-MDS following ESA failure. Clinical presentation (e.g., number of cytopenias) and potential outcomes after hypomethylating agent failure are factors to consider when making initial treatment decisions for LR-MDS patients.

Identification of a Prognostic Gene Expression Signature for AZA Response in MDS and CMML Patients

Myelodysplastic syndrome (MDS) and chronic myelomonocytic leukaemia (CMML) are haematological disorders that develop in haematopoietic stem or progenitor cells (HSPCs) and are characterised by ineffective haematopoiesis. 5′-Azacitidine (AZA) is a DNA demethylating agent that is effective in treating MDS and CMML. However, response rates are less than 50% and the basis for poor response is currently unknown. A patient’s potential to respond cannot be currently determined until after multiple cycles of AZA treatment and alternative treatment options for poor responders are limited. To address these fundamental questions, we enrolled patients on a compassionate access program prior to the listing of AZA on the pharmaceuticals benefit scheme in Australia. We have collected bone marrow from 18 patients (10 MDS, 8 CMML) at seven different stages of treatment, starting from before treatment until after six cycles of AZA treatment, and isolated high-purity CD34+ HSPCs at each stage. 10 of these patients (5 MDS and 5 CMML) responded completely to AZA while 8 did not achieve complete response.We performed next-generation sequencing (RNA-seq) of these HSPCs to identify the basis of poor response to AZA therapy. Analysis of the RNA-seq data from pre-treatment HSPCs has revealed a striking differential expression of 1148 genes between patients who were subsequently complete (CR) or non-complete responders (non-CR) to AZA therapy (Figure 1A). Using a Fluidigm nanofluidic system, we have validated the differential expression of a subset of these genes between CR and non-CR patients in two independent cohorts, totalling 67 patients, from the U.K. and Sweden. We have additionally confirmed that our gene signature does not simply segregate patients based on disease severity or poor overall survival, but rather uniquely prognosticates best AZA response. Pathway analyses of the differentially expressed genes indicates that the HSPCs of non-CR patients have decreased cell cycle progression and DNA damage pathways, while concomitantly possessing increased signalling through integrin and mTOR/AKT pathways.Using computational methods, we have determined that the expression of 15 genes (within the 1148 gene set) is sufficient to separate CRs from non-CRs across independent cohorts (Figure 1B). We have also developed a predictive AZA response algorithm that utilises the expression of these genes to identify potential complete and non-complete responders to AZA with high specificity and sensitivity (Figure 1C). Furthermore, we have identified statistically significant correlations between recurrent DNA mutations in MDS and our prognostic gene signature (SF3B1 &TET2 with CR, STAG2 and NUP98 with non-CR, p<0.05).We have used these findings to first, develop a clinically useful method to predict the likelihood of AZA response and second, use targeted therapies to promote AZA response in likely poor responders. To predict AZA response, we assess cell cycle progression of MDS/CMML CD34+ subsets by flow cytometry using unfractionated bone marrow aspirates. To improve drug response in predicted non-CR patients, we have performed combinatorial drug testing experiments with AZA using primary MDS/CMML CD34+ HSPCs, in a co-culture system using MS5 stromal cells, targeting up-regulated pathways identified from our RNA-seq data. (Figures 1D, 1E).Our findings have immediate clinical utility to both prospectively identify CR and non-CR patients prior to AZA therapy and to improve AZA response in the latter by using combination therapy targeting specific pathways. [Display omitted] DisclosuresLynch:Celgene Pty Ltd: Employment, Equity Ownership. Mufti:Celgene: Honoraria, Membership on an entity’s Board of Directors or advisory committees, Research Funding. Pimanda:Celgene Pty Ltd: Research Funding.

Hematologic Response To Oral Azacitidine (CC-486) In Subjects With WHO-Defined RAEB-1 Or RAEB-2 Myelodysplastic Syndromes (MDS)

▪ BackgroundSubcutaneous (SC) azacitidine prolongs overall survival in subjects with higher-risk MDS (Fenaux, JCO, 2009). Previous Phase I and II studies have shown extended oral azacitidine dosing schedules to be safe and effective in subjects with IPSS-defined lower-risk MDS (Garcia-Manero et al, ASH 2010 and ASH 2012). ObjectiveTo assess the efficacy and safety of extended oral azacitidine dosing schedules in subjects with WHO-defined RAEB-1 or RAEB-2 MDS. MethodsThe subset of subjects with WHO-defined RAEB-1 or RAEB-2 MDS from two ongoing Phase I/II studies was included in this ad hoc analysis. Subjects received oral azacitidine 300mg QD or 200mg BID for 14 or 21 days of repeated 28-day cycles. For purposes of this analysis, subject data were analyzed collectively. Hematologic responses were defined by International Working Group (IWG) 2006 criteria. Overall Response was calculated as any response of complete or partial remission (CR or PR), RBC or platelet transfusion independence (TI), and/or any hematologic improvement (HI). Marrow complete remission (mCR) was not included in Overall Response. Serious treatment-emergent adverse events (STEAEs) that occurred in 2 or more subjects are reported. ResultsOf 23 subjects in all, 20 received 300mg QD oral azacitidine x 14 or 21 days/28-day cycle and 3 received oral azacitidine 200mg BID x 14 days/28-day cycle. Subjects had median age of 71 (range: 36 - 90) years and were predominantly male (61%). Fourteen subjects (61%) had a diagnosis of RAEB-1 and 9 (39%) had RAEB-2, median time from diagnosis was 2.1 (0.1 - 33.2) months, and ECOG performance status scores were 0 (n=4, 17%), 1 (n=15, 65%), or 2 (n=4, 17%). Five subjects had received prior MDS treatments (azacitidine injection; erythropoiesis stimulating agent [ESA]; thalidomide; azacitidine injection and decitabine; G-CSF, anti-thymocyte globulin, methylprednisolone, cyclosporine, and ESA). Median number of oral azacitidine treatment cycles was 3 (1 - 29). Overall Response was achieved by 11/22 subjects (50%) (Table). Four subjects achieved mCR only and are not included in the Overall Response category. RBC TI was achieved by 5/12 subjects (42%) and platelet TI was achieved by 2/5 subjects (40%). Two subjects were able to consolidate remission and proceed to allogeneic stem cell transplant and 1 subject progressed to AML on-study. Oral azacitidine was generally well tolerated. Three subjects discontinued treatment due to an AE. STEAEs were consistent with the known safety profile of SC azacitidine. Of 8 subjects who had an STEAE of febrile neutropenia, pneumonia, and/or septic shock, 3 were severely neutropenic (ANC <0.5 x 109/L) at baseline. Other STEAEs were diarrhea, nausea, and vomiting (n=2 subjects each). ConclusionsThis analysis in subjects with RAEB-1 and RAEB-2 is the first to assess extended oral azacitidine dosing schedules in higher-risk MDS. One-half of treated subjects achieved a hematologic response to oral azacitidine, which is easy to administer and was generally well-tolerated. Two Phase III studies of extended oral azacitidine dosing (in lower-risk MDS and as maintenance therapy in older patients with AML) are ongoing. Results of these large studies will better elucidate the use of extended oral azacitidine dosing schedules in treating hematologic malignancies. Disclosures:Gore:Celgene Corporation: Consultancy. Cogle:Celgene Corporation: Honoraria, Research Funding. Conkling:US Oncology: Research Funding. Beach:Celgene Corporation: Employment. Hetzer:Celgene Corporation: Employment. Dong:Celgene Corporation: Employment. Skikne:Celgene Corporation: Employment.

Pre-Treatment WT1 mRNA Expression Level In Peripheral Blood Predicts Response and Overall Survival Of Myelodysplastic Syndrome Patients In The Azacitidine Era

BackgroundThe Wilms' tumor gene (WT1), originally discovered as a tumor suppressor has been proven to have an oncogenic role in leukemia and several other cancers. WT1 mRNA expression levels in peripheral blood (PBWT1) has been reported as a useful marker for the risk evaluation of myelodysplastic syndrome (MDS). In the era of hypomethylating agents, the significance of PBWT1 on MDS prognosis is still unknown. This study aimed to clarify the impact of pre-treatment PBWT1 levels on overall response (OR) and overall survival (OS) in MDS patients treated with azacitidine (AZA). Patients and MethodsWe retrospectively analyzed all patients from March 2011 to March 2013 with World Health Organization 2008 defined MDS, CMML or AML with 20–30% bone marrow blasts who received AZA treatment in our department for at least one cycle (37.5–75.0 mg/m2/day during 7 days, every 28 days). Patients' peripheral blood specimens were collected before AZA initiation, mRNA was extracted from leukocytes using the RNeasy Mini-Kit (Qiagen, Valencia, CA), and the amount containing WT1 mRNA was measured using a WT1 mRNA Assay Kit (Otsuka Pharmaceutical Co., Ltd., Tokyo, Japan). Hematologic response was evaluated according to International Working Group 2006. OR was defined as a best overall response of complete remission (CR), partial remission, marrow CR, or hematologic improvement. Univariate analyses for OR were carried out using Fisher's exact test. Factors associated with at least borderline significance (p < 0.10) were subjected to a multivariate analysis, using logistic regression model. OS was estimated according to the Kaplan-Meier method. Multivariate analysis was performed with proportional hazard Cox model, including all variables with p < 0.10 in univariate analyses. ResultsOf 55 patients enrolled, pre-treatment PBWT1 levels were available in 41 patients and the median level was 790 copies/µg RNA (range, less than 50–310000). Baseline characteristics according to PBWT1 levels (≤ 790 [lower group] [n = 21] and > 790 [higher group] [n = 20]) are summarized in Table 1. Median number of AZA treatment cycles was 4 (range, 1–18). Four patients (2 in higher group, and 2 in lower group) received allogeneic stem cell transplantation (alloSCT) after AZA treatment. OR rates were significantly lower in PBWT1 higher group than lower group (30.0 vs 71.4%, p = 0.03). In univariate analysis, other significant risk factors or with borderline significance for OR were higher serum ferritin levels (> 1000 ng/ml) and RBC transfusion dependency ≥ 4 units/8 weeks. In multivariate analysis, higher PBWT1 levels independently predicted reduced likelihood of OR (odds ratio = 0.212, 95% CI 0.01-0.95, p = 0.02). OS was significantly inferior in PBWT1 higher group as shown in Figure 1. In univariate analysis, other significant factor was Revised International Prognostic Scoring System (IPSS-R) risk groups (high risk defined as IPSS-R high or higher, and low risk defined as IPSS-R intermediate or lower). In multivariate analysis, higher PBWT1 levels (hazard ratio [HR] = 9.75, 95% CI 1.22-77.58, p = 0.03) and IPSS-R high risk (HR=7.04, 95% CI 1.43-34.48, p = 0.02) were independent predictors for OS.Table 1Patient baseline characteristics according to pre-treatment PBWT1 levelsPBWT1(copies/µg RNA)≤ 790 (n=21)>790 (n=20)p valueMedian age, years71.070.5WHO 2008 classification, %0.202RARS4.80.0RCMD19.010.0RAEB-123.840.0RAEB-238.140.0CMML-114.30.0AML0.010.0IPSS-R risk group, %0.003Very low0.00.0Low28.60.0Intermediate33.330.0High33.325.0Very high4.845.0Absolute neutrophil count, mean ± SD, 103/µl2.0 ± 2.61.4 ± 1.20.392Platelets, mean ± SD, 104/µl15.1 ± 25.610.8 ± 18.10.545Hb level, mean ± SD, g/dl9.5 ± 2.37.7 ± 1.50.008Ferritin level, mean ± SD, ng/ml531.1 ± 902.1741.0 ± 1008.10.503Marrow blast, %0.111< 5 %52.325.0≥ 5 %47.675.0RBC transfusion dependency, %0.326Yes23.840.0No76.260.0 [Display omitted] ConclusionOur results suggest that PBWT1 can predict both response and survival of MDS patients treated with AZA. Although salvage therapy including alloSCT can affect the survival, poor survival might result from inferior response rates in PBWT1 high patients. In MDS with high PBWT1, restoration of epigenetically silenced tumor suppressor genes with AZA might not induce apoptosis. We propose that alternative therapeutic strategies should be sought in MDS patients with high PBWT1 levels. Disclosures:No relevant conflicts of interest to declare.

Safety and Efficacy of Oral Azacitidine (CC-486) Administered in Extended Treatment Schedules to Patients with Lower-Risk Myelodysplastic Syndromes

AbstractAbstract ▪424▪This icon denotes a clinically relevant abstract Background:Azacitidine for injection has been shown to prolong overall survival in patients (pts) with higher-risk myelodysplastic syndromes (MDS) compared with conventional care regimens (CCR) (Lancet Oncol, 2009). An oral formulation of azacitidine (CC-486) is in development. Oral azacitidine may maximize convenience, eliminate injection-site reactions, and if administered in extended dosing schedules, may enhance and prolong the therapeutic effects of azacitidine. Oral azacitidine administered once-daily (QD) for 7 days (d) of repeated 28d cycles has been shown to be bioavailable, biologically and clinically active, and well-tolerated in pts with MDS and acute myeloid leukemia (Garcia-Manero, J Clin Oncol, 2011). Preliminary evidence suggests that extending oral azacitidine dosing to 14d or 21d of the 28d cycle may enhance pharmacodynamic and epigenetic activity (Laille, Leuk Res, 2011). Purpose:To evaluate hematologic response and safety associated with extended dosing regimens of oral azacitidine in pts with lower-risk MDS. Methods:This ongoing, multicenter, phase 1 study, enrolled pts with lower-risk (IPSS Low or INT-1) MDS who were RBC transfusion dependent (TD) and/or thrombocytopenic (average platelet count ≤50,000 within 56d prior to the first dose) at baseline. Pts were sequentially assigned to receive oral azacitidine 300mg QD for either 14d or 21d of repeated 28d cycles. Hematologic assessments were made every 2 weeks. Hematologic response was assessed using IWG 2006 criteria (Cheson, Blood, 2006). Adverse events (AEs) were graded using NCI-CTCAE version 3.0. Results:At data cut-off (May 18, 2012), 53 pts with lower-risk MDS had enrolled (300mg oral azacitidine QDx14d, n=26; QDx21d, n=27). Demographic and disease characteristics at baseline were similar in the 14d and 21d treatment cohorts (Table 1). Median (range) hematology counts at baseline were Hgb 8.7 g/L (6.0–13.0), ANC 1.6×109/L (0–30.3), and platelets 56.0×109/L (6.0–564.0). At study entry, 40% of pts had received no prior MDS treatment (except transfusions), 45% had received erythropoiesis-stimulating agents, and 15% had received WBC growth factors. The number of oral azacitidine treatment cycles received ranged from 1 to 12 (median numbers of oral azacitidine cycles were 6 in the QDx14d and 4 in the QDx21d cohorts). Four pts in the 21d cohort and 1 pt in the 14d cohort received reduced oral azacitidine doses (200mg QD). Overall, 10 pts discontinued the study, including 6 pts (3 pts in each cohort) who discontinued due to AEs that may have been treatment-related (gastrointestinal [n=2] or intracranial [n=1] hemorrhage, febrile neutropenia [n=1], pneumonia [n=1], thrombocytopenia [n=1]). Overall response rates (ORR), which included complete (CR) and partial remission (PR), any hematologic improvement (HI), and transfusion independence (TI), ranged from 38.5% in the QDx14d cohort to 29.6% in the QDx21d cohort, and RBC TI was achieved by 47% and 33%, respectively, of pts who were RBC TD at baseline (Table 2). For pts who received at least 4 cycles of oral azacitidine (14d, n=19; 21d, n=14), ORR was 47.4% in the 14d and 50.0% in the 21d cohorts, and RBC TI rates in RBC TD pts (n=16) were 67% in the 14d and 57% in the 21d cohorts. The most frequent (≥5%) grade 3/4 hematologic AEs in the QDx14d cohort were anemia (11.5%), thrombocytopenia (11.5%), and neutropenia (7.7%); and in the QDx21d cohort were neutropenia (14.8%), anemia (7.4%), and febrile neutropenia (7.4%). Most frequent grade 3/4 non-hematologic AEs were gastrointestinal, including vomiting (7.7%) in the QDx14d cohort, and diarrhea (11.1%) and vomiting (7.4%) in the QDx21d cohort. Conclusions:Oral azacitidine 300mg QD administered in extended dosing schedules of 14d or 21d of repeated 28d cycles was effective and well-tolerated in these pts with lower-risk MDS. Beside hematologic AEs, the most frequently observed AEs with oral azacitidine were gastrointestinal and were manageable. Efficacy and safety outcomes with 300mg QD oral azacitidine were generally comparable between the 14d and 21d extended dosing regimens. Based on these data, oral azacitidine administered once-daily in extended dosing schedules is active and well-tolerated and warrants further investigation in randomized, controlled trials. [Display omitted] [Display omitted] Disclosures:Garcia-Manero:Celgene: Research Funding, Speakers Bureau. Gore:Celgene Corporation: Consultancy, Research Funding. Scott:Celgene Corporation: Honoraria, Research Funding, Speakers Bureau. Hetzer:Celgene Corporation: Employment, Equity Ownership. Kumar:Celgene Corporation: Employment, Equity Ownership. Skikne:Celgene: Employment, Equity Ownership.

Evidence for Selective Benefit of Sequential Treatment with Azanucleosides in Patients with Myelodysplastic Syndromes (MDS)

AbstractAbstract 4937 Background:Azanucleosides (AZN) remain the mainstay of therapy in Myelodysplastic syndrome (MDS). Azacitidine (AZA) and decitabine (DAC) have distinct differences in nucleic acid specificity and mechanisms of cellular resistance. The only published experience with sequential treatment described 14 patients, with a 28% response with DAC treatment after failure or lack of response to AZA. The response rate to AZA after DAC is unknown. Sequential use of alternative AZNs is common practice given the limited alternatives. To investigate the potential benefit of this approach, we reviewed cases of sequential AZN treatment. Methods:Patients who received treatment with both AZNs were identified through the Moffitt Cancer Center (MCC) MDS database. Two groups were identified; group one who received DAC after AZA failure, and group 2, who received AZA after DAC failure. AZN failure was defined as lack of response, loss of response or discontinuation due to adverse events or disease progression. The primary objective was to estimate response rates according to the International Working Group (IWG) 2006 criteria. Results:A total of 39 MDS patients were identified. Complete records were available in 31 patients, including 21 patients in group 1 (DAC after AZA), and 10 patients in group 2 (AZA after DAC). Table-1 summarizes baseline characteristics. In Group 1, 21 patients received DAC after AZA, 57% were originally red blood cell transfusion dependent (RBC TD). The median time from diagnosis to AZA treatment was 10 month (0. 2–52). The mean number of AZA treatment cycles was 8 (1–20). IWG responses to AZA treatment were 2 (10%) CR, 4 (20%) marrow CR (mCR), 7 (33%) hematological improvement (HI), 1 (5%) stable disease (SD) and 6 (28%) progressive disease (PD). Reasons for AZA discontinuation were 7(33%) no response, 1 (5%) progression, 9 (43%) lost response, and 4 (19%) toxicity. The median interval between end of AZA and initiation of DAC was 118 days (21–948). The mean number of DAC cycles was 4 (1–18). IWG responses to DAC were 1 (5%) mCR, 3 (14%) HI, 14 (67%) PD, and 3 (14%) unknown. The best overall response was 19%. The median OS from time of DAC initiation was 17. 8 month (95%CI 14–21). The rate of AML transformation was 29%.In Group 2, 10 patients received AZA after DAC, and 70% were originally RBC TD. The median time from diagnosis to DAC treatment was 2. 5 month (0–56). The mean number of DAC cycles was 4. 3 (1–9). IWG responses to DAC treatment were 2 (10%) mCR, 4 (40%) HI, 2 (20%) PD. The reasons for DAC discontinuation were no response (n=1), loss of response (n=3), PD (n=2), toxicity (n=3), and physician choice (n=1). The median interval between end of DAC and initiation of AZA was 179 days (19–448). The mean number of AZA cycles was 6 (2–12). The best responses to AZA were 2 (20%) mCR, 2 (20%) HI, 2 (20%) SD, 4 (40%) PD. The best overall response was 40%. The median OS from time of AZA start was 22 month. The rate of AML transformation was 20%.The median OS for Group 1 from diagnosis was 48 month and for group 2 was100 month (p=0. 7). Table-2 summarizes key differences between the two groups. Conclusions:Sequential use of AZNs after failure of first line may be an effective alternative outside the context of clinical trials. Despite limitations of cohort size and retrospective nature of the analysis, our findings suggest that response rate may be higher in patients who receive AZA after DAC, which could reflect the dual RNA/DNA drug actions. Sequential use of HMA should be considered in context of randomized clinical trial of novel agent as the control arm.Table-1Group 1 (n=21)Group 2 (n=10)AgeMean (yrs)6868WHORA3 (14%)1 (10%)RARS4 (19%)1 (10%)RCMD2 (10%)2 (20%)RAEB11 (52%)6 (60%)Del 5q1 (5%)0IPSS prior AZALow4 (19%)0Int-15 (24%)4 (40%)Int-25 (24%)5 (50%)High2 (10%)1 (10%)Missing5 (24%)0IPSS prior DACLow1 (5%)0Int-12 (10%)5 (50%)Int-28 (38%)3 (30%)High2 (10%)2 (20%)Missing8 (38%)0Table-2Group 1 (n=21)Group 2 (n=10)Time to First line AZN from diagnosismedian102.41st line cyclesmean841st line best response (HI+)%6350Lag between 1st and 2nd linedays1181792nd line cycles462nd line best response (HI+)%1940%Median OS (mo)From start of 2nd line17.822From Diagnosis48100AML transformation%2920 Disclosures:List:Celgene: Consultancy. Komrokji:Celgene: Honoraria, Speakers Bureau.

Bone Marrow Hypocellularity Does Not Impair the Tolerability or Efficacy of Azacitidine (AZA) in Patients with Higher-Risk Myelodysplastic Syndromes Treated in the AZA-001 Study

AbstractAbstract 3808 Background:Approximately 10–15% of patients with myelodysplastic syndromes (MDS) have a hypocellular bone marrow (BM) at diagnosis. Some studies have suggested hypocellular MDS may have an adverse prognostic impact, but this is controversial. In the Phase 3 randomized AZA-001 study, AZA prolonged overall survival (OS) in patients with higher-risk MDS compared with conventional care regimens (CCR) (Lancet Oncol, 2009). However, the efficacy and tolerability of AZA in the subset of patients with hypocellular MDS has not been determined. Purpose:This post hoc analysis was conducted to determine whether the prolongation of OS observed with AZA compared with CCR in the AZA-001 study is influenced by baseline BM cellularity. We also sought to explore the tolerability of AZA treatment in patients with higher-risk MDS and hypocellular BM. Methods:Study design of AZA-001 is reported elsewhere (Lancet Oncol, 2009). Briefly, patients with higher-risk MDS (FAB: RAEB, RAEB-t, or CMML, and IPSS Int-2 or High risk disease) were randomized to AZA (75 mg/m2/d SC × 7d q 28d) or to CCR (supportive care, low-dose Ara-C [LDAC], or intensive chemotherapy [IC]). In the current analysis, patients were divided into 2 groups based on centrally reviewed baseline BM biopsy samples which confirmed the diagnosis of MDS (J. Bennett): a hypocellular (≤30%) group and a non-hypocellular (>30%) group. OS was assessed using Kaplan-Meier methods and treatments were compared by log-rank analysis. Results:Of 358 patients in AZA-001 (AZA n=179, CCR n=179), BM cellularity data were available for 299 patients (AZA n=154, CCR n=145). At baseline, 87% of patients (n=260) had non-hypocellular BM and 13% of patients (n=39) had hypocellular BM. Of patients with hypocellular BM in the CCR group (n=18), 7 patients (39%) received supportive care, 9 (50%) LDAC, and 2 (11%) IC. In general, baseline characteristics were similar between the hypocellular and non-hypocellular BM groups. Similarly, age, % BM blasts, cytogenetics, cytopenias, and transfusion dependence, were generally balanced across treatments within the 2 cellularity groups (Table). Median (range) duration of AZA treatment cycles in hypocellular patients was 35.5 (28–54) days and in non-hypocellular patients was 33.0 (15–75) days. Response (complete or partial response [CR+PR]) rates in hypocellular patients treated with AZA were 0% and with CCR were 5.6% (p=0.4615); and hematologic improvement (HI) rates were 52% and 41%, respectively (p=0.532). In non-hypocellular patients treated with AZA or CCR, rates of CR+PR were 7.5% and 0.8%, respectively (p=0.010); and HI rates were 48% and 28% (p=0.001), respectively. The improvement in OS in AZA-treated patients was more pronounced in the hypocellular group than the non-hypocellular group, whereas OS in CCR-treated patients was similar regardless of BM cellularity (Figure). Median OS was significantly prolonged with AZA vs. CCR in both the hypocellular and non-hypocellular groups. In patients with hypocellular BM, at 33 months median OS was not reached (NR; 95% CI: 19.2, NR) in the AZA arm vs. 16.9 months (95% CI: 11.1, 19.3) in the CCR arm (p=0.001). In patients with non-hypocellular BM, median OS in the AZA arm was 21.1 months (95% CI: 16.2, 34.7) vs. 15.3 months (95% CI: 9.3, 17.6) in the CCR arm (p=0.012). Safety and tolerability in the two BM cellularity groups were similar to that seen in the overall AZA-001 study (Lancet Oncol, 2009). Frequencies of grade 3–4 hematologic AEs in AZA-treated patients in the hypocellular and non-hypocellular groups were similar: anemia (9.5% vs 14.7%, respectively), febrile neutropenia (9.5% vs 11.6%), leukopenia (14.3% vs 13.2%), neutropenia (61.9% vs 60.5%), and thrombocytopenia (61.9% vs 58.1%). Conclusions:In this post hoc analysis, the prevalence of patients with hypocellular MDS was 13%, consistent with the reported prevalence in the general MDS population (Bennett, 2009). The survival advantage with AZA vs. CCR in both baseline BM cellularity groups observed in this analysis was consistent with the overall OS advantage with AZA shown in AZA-001. These findings suggest AZA is a safe and effective treatment option for patients with BM hypocellularity. [Display omitted] [Display omitted] Disclosures:Seymour:Celgene Corporation: Consultancy, Honoraria, Speakers Bureau, Travel support Other. Bennett:Celgene Corporation: Consultancy. List:Celgene Corporation: Consultancy. Mufti:Celgene Corporation: Consultancy, Research Funding, Speakers Bureau. Gore:Celgene Corporation: Consultancy, Research Funding. Fenaux:Celgene: Honoraria, Research Funding. Hetzer:Celgene Corporation: Employment, Equity Ownership. Songer:Celgene Corporation: Employment, Equity Ownership. Skikne:Celgene: Employment, Equity Ownership. Beach:Celgene Corporation: Employment, Equity Ownership.

Circulating Exosomal MicroRNA-21 As a Potential Biomarker That May Predict Response to Azacitidine Treatment in Myelodysplastic Syndromes,

Abstract 3804Prognostic factors for response and survival in patients with myelodysplastic syndromes (MDS) treated with azacitidine (AZA) remain largely unknown. Identification of molecular biomarkers in MDS is needed to predict clinical outcomes and help stratify MDS patients for epigenetic therapy. MicroRNA(miR)-21 has been recognized to be implicated in carcinogenesis, resistance to chemotherapy, and regulation of DNA methylation. A several prognostic studies found that a higher miR-21 expression was significantly associated with advanced diseases and worse outcomes in a variety of cancers. MicroRNA profiling of circulating tumor exosomes could potentially be used as surrogate diagnostic markers. Therefore, we evaluated the expression level of miR-21 in exosomes isolated from sera of patients with MDS and analyzed the association between exosomal miR-21 level and the response to AZA treatment and prognosis. Among 63 MDS cases enrolled in this study, WHO classification was RA/RARS in 19.1%, RCMD in 31.7%, RAEB-1 in 19.1%, RAEB-2 in 19.1%, and MDS-U in 11.0%. IPSS risk group was low in 7.5%, intermediate-1 in 60.3%, intermediate-2 in 28.6%, and high in 3.2%. AZA was administered subcutaneously with an initial dose of 75 mg/m2/day for 7 days every 28 days. Patients received AZA for a median of 6 cycles (range, 1–12). Response was evaluated after 4 cycles of AZA by blood count, marrow study, and cytogenetic analysis. CR, PR, marrow CR, stable disease (SD), hematologic improvement (HI), and progression were defined according to IWG 2006 criteria. Total RNA was isolated from exosomes, which were obtained from patients’ serum using the Exoquick exosome precipitation solution. Serum was obtained at initial diagnosis, and after 4th, 8th cycles of AZA treatment. Quantitative RT-PCR was performed using SYBRRRT-PCR method. miR-21 primer was: forward GCCCGCTAGCTTATCAGACTGATG, reverse GTGCAGGGTCCGAGGT. RNU6B was taken as reference gene for exosomal miR normalization. Relative level of the circulating miR-21 was determined using the comparative CT (2−ΔΔCT) formula. With AZA treatment, the overall response rate was 58.7% (CR in 9.5%, PR in 3.2%, and HI in 46.0%). Baseline level of serum exosomal miR-21 was significantly higher in MDS patients compared with healthy volunteers (p <0.001). Serum miR-21 level was independent of age, sex, and IPSS risk group. Circulating miR-21 level prior-AZA therapy was significantly higher in the non-responder group compared to the AZA responder group (CR/PR/HI) (466.1±127.3 vs 31.8±14.3, p <0.001). The cut-off level of higher miR-21 was determined by ROC analysis. The response rate (including HI) was significantly lower in the higher miR-21 patients group (p< 0.005). We found that patients with higher level of circulating exosomal miR-21, compared with patients with lower level, had a significantly shorter median overall survival (10.7 vs 22.8 month, respectively, p =0.001) and significantly shorter median progression-free survival (14.0 vs 20.0 months, respectively, p =0.003). In multivariate analysis, high miR-21 level prior to AZA treatment was an independent risk factor for lower overall survival (hazard ratio 16.12, 95% CI 1.64–159.2, p< 0.01). We demonstrated for the first time that the circulating exosomal miR-21 is upregulated in MDS and its levels can be considered as a potential biomarker that may predict response to AZA treatment. Although the clinical potentiality of circulating exosomal miR-21 as biomarker in MDS will be prospectively validated in a large cohort of patients, these findings may be useful for directing AZA treatment, leading to improving treatment response and outcomes. Disclosures:No relevant conflicts of interest to declare.

Prolonged Survival without Complete Remission (CR) In AML Patients (Pts) Treated with Azacitidine (AZA)

AbstractAbstract 2183 Background:AZA has been shown to improve overall survival (OS) compared with conventional care regimens (p=0.005) in elderly pts with WHO-defined AML (20-30%) bone marrow [BM] blasts), despite a modest 18% CR rate (AZA 001 trial, JCO, 2010;10:223). AZA as frontline therapy also appears active in pts with AML with >30% blasts who are unfit for intensive chemotherapy (IC) (Thépot et al, Blood, 2009:A843). For AML pts receiving IC, CR is often considered a prerequisite to improved survival. In pts with higher-risk myelodysplastic syndromes (MDS) treated with AZA, an OS benefit has been observed in pts with a best response of partial remission (PR) or hematological improvement (HI), and most recently, stable disease (SD) (JCO, 2008;26:A7006; JCO, 2010;28:A6503). It is unknown whether OS benefits with AZA in the absence of CR will be obtained by pts with AML. We analyzed the best response to AZA obtained by pts with WHO AML (>20% blasts) from 2 independent pt cohorts who survived ≥2 years. Methods:AZA-001 included 55 pts with WHO-defined AML (20-30% BM blasts, none of them therapy related) randomized to AZA treatment, and the French AZA compassionate program (ATU) included 148 pts with WHO-defined AML treated with AZA as frontline therapy (median 33% marrow blasts), of whom 24% had therapy-related AML and 38% had AML post-MDS. Pts received AZA at the FDA/EMEA-approved schedule (75mg/m2/d × 7d/28d) for a minimum of 6 cycles in the AZA -001 trial, as did 48% of pts in the ATU for a minimum of 4 cycles (52% of pts in the ATU received AZA in a 5-day regimen, or less often, as a flat 100mg daily dose over 7 days). Responses to AZA in the ATU cohort reflect AML response criteria (JCO 2003;21:4642), or in the case of HI, IWG 2006 criteria for MDS (Blood 2006;108:419). Responses to AZA in the AZA-001 cohort reflect IWG 2000 criteria for MDS (Blood 2000;96:3671). Best responses were evaluated in pts who survived ≥2 years in both cohorts. Results:The 55 pts in the AZA-001 cohort had a median age of 70 years (52-80), 23% (20-34%) median BM blast count, and 26% and 69%, had IPSS unfavorable or intermediate cytogenetics, respectively. Pts received a median of 8 (1–39) AZA treatment cycles. With a median follow-up of 20.1 months, 11/55 (20%) pts in this cohort were alive ≥2 years after beginning AZA. None of the 11 pts had achieved CR or PR with AZA. According to IWG 2000 criteria, 4 pts had achieved HI and 7 pts had SD as best responses.In the ATU cohort, median follow-up was 15.6 months. Of 148 AML pts, 68 (46%) had entered the study ≥2 years before the reference date of analysis (Jan 2010). Of them, 29 pts had 20–30% BM blasts and 39 pts had >30% BM blasts. Of pts with 20–30% BM blasts, 7/29 (24%) were alive at 2 years. As best response to AZA, only 2 of the 7 pts (29%) had achieved CR, 2 achieved HI, and 3 had SD. Of pts with >30% BM blasts, 5/39 (13%) were alive at 2 years; best responses included CR (n=1), PR (n=1), morphologic CR with incomplete count recovery (CRi; n=2), and SD (n=1). Only 1 of the 12 AML pts who survived ′2 years had undergone allogeneic transplant (pt had AML with 20–30% BM blasts and SD as best response), after 4 cycles of AZA. Conclusion:In 2 independent cohorts of pts with AML treated with AZA, most pts with 20–30% BM blasts who survived ≥2 years (16/18, 89%) did so despite a lack of CR or PR. This finding appeared less clear in patients with >30% blasts. These results warrant confirmation in larger pt numbers but suggest that, as in MDS, traditional morphological responses of CR/PR may not be required to obtain prolonged survival in pts with AML, especially pts with 20–30% BM blasts, treated with AZA. Disclosures:Off Label Use: Azacitidine in Acute Myeloid Leukemia with >30% marrow blasts. Beach: Celgene: Employment. Swern: Celgene: Employment. Fenaux: Celgene: Honoraria, Research Funding; Novartis: Honoraria, Research Funding; Janssen Cilag: Honoraria, Research Funding; Roche: Honoraria, Research Funding; Amgen: Honoraria, Research Funding; GSK: Honoraria, Research Funding; Merck: Honoraria, Research Funding; Cephalon: Honoraria, Research Funding.

Therapeutic Response to Azacitidine (AZA) In Patients with Secondary Myelodysplastic Syndromes (sMDS) Enrolled In the AVIDA Registry

Therapeutic Response to Azacitidine (AZA) In Patients with Secondary Myelodysplastic Syndromes (sMDS) Enrolled In the AVIDA Registry

The effects of continued azacitidine treatment cycles on response in higher-risk patients with myelodysplastic syndromes: An update

The international, phase III, multi-centre AZA-001 trial demonstrated azacitidine (AZA) is the first treatment to significantly extend overall survival (OS) in higher risk myelodysplastic syndromes (MDS) patients (Fenaux (2007) Blood 110 817). The current treatment paradigm, which is based on a relationship between complete remission (CR) and survival, is increasingly being questioned (Cheson (2006) Blood 108 419). Results of AZA-001 show CR is sufficient but not necessary to prolong OS (List (2008) Clin Oncol 26 7006). Indeed, the AZA CR rate in AZA-001 was modest (17%), while partial remission (PR, 12%) and haematological improvement (HI, 49%) were also predictive of prolonged survival. This analysis was conducted to assess the median number of AZA treatment cycles associated with achievement of first response, as measured by IWG 2000-defined CR, PR or HI (major + minor). The number of treatment cycles from first response to best response was also measured.