Cultivated Pigeonpea Research Articles

Cajanus platycarpus Flavonoid 3'5' Hydroxylase_2 (CpF3'5'H_2) Confers Resistance to Helicoverpa armigera by Modulating Total Polyphenols and Flavonoids in Transgenic Tobacco.

Pod borer Helicoverpa armigera, a polyphagus herbivorous pest, tremendously incurs crop damage in economically important crops. This necessitates the identification and utility of novel genes for the control of the herbivore. The present study deals with the characterization of a flavonoid 3'5' hydroxylase_2 (F3'5'H_2) from a pigeonpea wild relative Cajanus platycarpus, possessing a robust chemical resistance response to H. armigera. Though F3'5'H_2 displayed a dynamic expression pattern in both C. platycarpus (Cp) and the cultivated pigeonpea, Cajanus cajan (Cc) during continued herbivory, CpF3'5'H_2 showed a 4.6-fold increase vis a vis 3-fold in CcF3'5'H_2. Despite similar gene copy numbers in the two Cajanus spp., interesting genic and promoter sequence changes highlighted the stress responsiveness of CpF3'5'H_2. The relevance of CpF3'5'H_2 in H. armigera resistance was further validated in CpF3'5'H_2-overexpressed transgenic tobacco based on reduced leaf damage and increased larval mortality through an in vitro bioassay. As exciting maiden clues, CpF3'5'H_2 deterred herbivory in transgenic tobacco by increasing total flavonoids, polyphenols and reactive oxygen species (ROS) scavenging capacity. To the best of our knowledge, this is a maiden attempt ascertaining the role of F3'5'H_2 gene in the management of H. armigera. These interesting leads suggest the potential of this pivotal branch-point gene in biotic stress management programs.

Relevance of methionine sulfoxide reductase(s) (MSR) as candidate proteins in redox homeostasis-mediated resistance response to Helicoverpa armigera (Hübner) in the pigeonpea wild relative Cajanus platycarpus (Benth.) Maesen

Pod borer, Helicoverpa armigera, a polyphagus herbivore causes extensive economic losses to crops, including pigeonpea. Exploitation of pod borer resistance in wild relatives is pertinent due to the absence of resistance sources in cultivated pigeonpea and crossing-incompatibility with the resistant wild relatives. We present leads obtained in deeper understanding of pod borer resistance mechanism in Cajanus platycarpus, a pigeonpea wild relative. Surge in cellular ROS during herbivory leads to redox-PTMs (post translational modifications) of methionine-rich proteins including antioxidant enzymes, causing oxidative damage. Plants then officiate methionine sulfoxide reductases (MSRs), that maintain the redox status of methionine and hence homeostasis. We demonstrate functionality of MSRs (MSRA and MSRB) in the resistance response of the wild relative to pod borer. Among 5 MSRA and 3 MSRB genes, CpMSRA2 and CpMSRB1 were herbivore-responsive based on expression during herbivory. Clues about the stress-responsiveness were obtained upon analyses of cis-elements and co-expressing genes. Apparently, the wild relative followed a non-canonical mode of redox management, as divulged by antioxidant enzymes and the scavenging capacity. Differential lipid peroxidation as an early response provided evidences for an effective redox management in the wild relative. This is the first report signifying redox homeostasis in the resistance response towards herbivory.

Reaping the Potential of Wild Cajanus Species through Pre-Breeding for Improving Resistance to Pod Borer, Helicoverpa armigera, in Cultivated Pigeonpea (Cajanus cajan (L.) Millsp.).

Simple SummaryPigeonpea is an important legume crop that is severely affected by various insect pests, especially pod borer. Because there are low resistance levels to pod borers in the cultivated pigeonpea gene pool, it is necessary to introduce resistance-related traits from its wild relatives. In this study, we conducted a series of crosses to introduce traits related to pod borer resistance from two wild relatives of pigeonpea into two popular cultivated varieties. We generated populations from four different crosses and screened these populations for traits related to pod borer resistance: i.e., low levels of insect damage, high concentrations of insect-deterring compounds in the seeds, and the presence of trichomes on the leaves. The most promising lines were tested across seasons and locations. Ultimately, we identified 21 lines with excellent traits related to pod borer resistance. These lines will be useful for breeding new insect-resistant pigeonpea cultivars. The availability of such cultivars will reduce the use of pesticides to control pests on pigeonpea crop.Pod borer (Helicoverpa armigera) causes the highest yield losses in pigeonpea, followed by pod fly (Melanagromyza obtusa). High levels of resistance to pod borer are not available in the cultivated genepool. Several accessions of wild Cajanus species with strong resistance, and different resistance mechanisms (antixenosis and antibiosis) to pod borer have been identified. These accessions can be utilized to improve the pod borer resistance of cultivated pigeonpea. Using pod borer resistant Cajanus scarabaeoides and Cajanus acutifolius as pollen donors and popular pigeonpea varieties as recipients, pre-breeding populations were developed following simple- and complex-cross approaches. Preliminary evaluation of four backcross populations consisting of >2300 introgression lines (ILs) under un-sprayed field conditions resulted in identifying 156 ILs with low visual damage rating scores (5.0–6.0) and low pod borer damage (<50%). Precise re-screening of these ILs over different locations and years resulted in the identification of 21 ILs having improved resistance to pod borer. Because these ILs were derived from wild Cajanus species, they may contain different alleles for different resistance components to pod borer. Hence, these ILs are ready-to-use novel and diverse sources of pod borer resistance that can be utilized for improving the pod borer resistance of cultivated pigeonpea.

Secondary genepool of Australian Cajanus species contains sources of resistance to Helicoverpa armigera (Hübner)

AbstractA narrow genetic base in cultivated pigeonpea (Cajanus cajan (L.) Millsp.) limits the host plant resistance (HPR) to the devastating pest Helicoverpa armigera (Hübner). Earlier research on pod borer resistance in wild Cajanus relatives has mainly explored the tertiary genepool, making breeding for resistance difficult because of linkage drag. Previous investigations on a wide range of Australian native germplasm from the secondary and tertiary gene pools revealed resistance in the secondary gene pool, associated with total phenolic content (TPC). This study reports the application of the extreme phenotype genome‐wide association (XP‐GWAS) to associate single nucleotide polymorphisms (SNPs) with resistance traits. Mapping of 19 accessions, including 12 wild accessions to a reference pigeonpea genome have identified a total of 16,489 and 16,227 nonsynonymous SNPs for the resistance and TPC traits, respectively. These SNPs were subjected to functional analysis, and KEGG pathway analysis revealed the presence of candidate genes coding for the crucial enzymes in five defence‐related pathways that could be contributing to resistance. These pathways involve ‘Jasmonic acid synthesis’ (palmitoyl‐CoA hydrolase, phospholipase A1 and phospholipase A2), ‘insect hormone biosynthesis’ (aldehyde dehydrogenase) ‘Steroid biosynthesis’ (squalene monooxygenase, farnesyl transferase and lanosterol synthase), ‘Cutin, suberine and wax synthesis’ (O‐acyltransferase) and ‘Brassinosteroid biosynthesis’ (Det2). Analysis of SNPs associated with the TPC trait led to the identification of a divergent pathway of ‘secondary metabolite synthesis’ (flavonoid 3′ hydroxylase, l‐rhamnosyltransferase) in wild Cajanus species consistent with a high concentration of isoorientin and the possible presence of its derivative maysin; a strong insecticidal compound in leaves.

First report of Fusarium equiseti (Corda) Sacc. causing wilt of Cajanus scarabaeoides, a wild relative of pigeonpea in India.

Wild species or crop wild relatives (CWRs) provide a unique opportunity to introduce novel traits and expand the genetic base of the cultivated pigeonpea (Bohra et al. 2010, 2020). Among the wild relatives of pigeonpea, Cajanus scarabaeoides is cross-compatible with cultivated pigeonpea (C. cajan). To identify the resistant sources for use in the pigeonpea breeding, the present study was conducted using 79 wild pigeonpea accessions at ICAR-Indian Institute of Pulses Research, Kanpur, India during 2016-17 and 2017-18 (Figures 1 a and b). The pigeonpea accessions belonged to three different genera Cajanus, Rhynchosia and Flemingia. During field scouting, seedlings were observed with foliar chlorosis and wilting (Fig. 2a). Infected stem tissue exhibited brown to black discoloration, followed by gradual plant drying, and ultimately plant death (Fig. 2b). Infected plants were collected from the field and pathological examination was performed in the laboratory conditions. Wilted plant parts were surface-disinfected with 1% sodium hypochlorite for two minutes and 5.0 mm size pieces of stem tissue were transferred to petri-dishes containing 90ml of Fusarium Specific Medium (FSM) (Nash and Snyder 1962) and incubated at 27oC. After 48 hrs of incubation, white to orange aerial mycelial growth was observed (Fig. 2c). The fungus was transferred to fresh FSM and purified by the single-spore technique (Choi et al. 1999). Macroconidia had four to six septa, slightly curved at the apex ranged from 20.0 to 25.0 × 3.0 to 5.5 μm (Fig. 2d). Microconidia were absent. The isolated fungus was putatively identified as belonging to the F. equiseti species complex based on colony morphology and macroconidia characteristics and size (Booth, 1977; Leslie and Summerell 2004). The pathogenicity test was conducted on 15-day old healthy seedlings of wild pigeonpea using 'root dip inoculation' and 'soil inoculation' technique (Haware and Nene 1994). Plant roots were immersed in a conidial suspension (6×106 conidia/ml water as determined by a hemocytometer) for 3-4 minutes (Marley and Hillocks 1996), while the roots of control plant were immersed in sterilized distilled water. A single spore culture of F. equiseti was grown on PDA-containing perti-dishes. Two actively grown mycelia discs (5 mm dia) from the periphery of 7-day old pure culture of F. equiseti were separately inoculated in 500 ml conical flasks containing 100g pigeonpea meal medium. The flasks were incubated at 28±2°C for 10 days. A fungus-soil mixture was prepared by mixing 200 g of inoculums with 2kg of autoclaved sand: soil mixture (3:7). Earthen pots having 15-cm diameter were sterilized by formalin (0.1%). These pots were then filled with fungus-soil mixture. Seeds sterilized with mercuric chloride (1%) were sown in each pot. Seeds sown in uninoculated pots served as control. Five seeds were sown in each pot with three replications. Disease symptoms developed 10 days after inoculation of wild pigeonpea plants in greenhouse. Symptoms were identical to those observed in the field. No symptoms were observed in control. Re-isolating the F. equiseti pathogen from the inoculated wild pigeonpea seedlings corroborated Koch's postulates. Reference cultures of three isolates of F. equiseti were deposited in Indian Type of Culture Collection (ITCC), Division of Plant Pathology, ICAR-Indian Agricultural Research Institute (IARI), New Delhi with the accession numbers ITCC8413, ITCC8414 and ITCC8415. Fungal genomic DNA was extracted through modified CTAB method (Murray and Thompson 1980). The ITS regions 1 and 2, including 5.8S ribosomal DNA (rDNA) region, and part of translation elongation factor 1-α (TEF) were amplified by using the ITS6F (GAAGGTGAAGTCGTAACAGG) and ITS4R (TCCTCCGCTTATTGATATGC) and tef (F: ATGGGTAAGGAAGACAAGAC; R: GGAAGTACCAGTGAATCATGTT) primers. BLASTn analysis of the sequences generated showed a 98.78% homology with F. equiseti. The sequences were deposited at GenBank (Accession numbers of ITS region: MF351849, MF351850, MF351851, and Tef region: MK259963, MK264345, MK264346). Phylogenetic analysis of the ITS and Tef region sequences revealed that all Fusarium isolates belong to the F. equiseti species complex and other available sequences of Fusarium spp. (Fig. 3). Occurrence of F. equiseti on various plant species is reported worldwide by several researchers (Liang et al. 2011; Ramachandra and Bhatt 2012; Prasad et al. 2017). To the best of our knowledge and based on the literature, this is the first report of wilt disease on wild pigeonpea in India, caused by F. equiseti (Corda) Sacc.

Comparative TMT Proteomic Analysis Unveils Unique Insights into Helicoverpa armigera (Hübner) Resistance in Cajanus scarabaeoides (L.) Thouars.

Pigeonpea [Cajanus cajan (L.) Millspaugh] is an economically important legume playing a crucial role in the semi-arid tropics. Pigeonpea is susceptible to Helicoverpa armigera (Hübner), which causes devastating yield losses. This pest is developing resistance to many commercially available insecticides. Therefore, crop wild relatives of pigeonpea, are being considered as potential sources of genes to expand the genetic base of cultivated pigeonpea to improve traits such as host plant resistance to pests and pathogens. Quantitative proteomic analysis was conducted using the tandem mass tag platform to identify differentially abundant proteins between IBS 3471 and ICPL 87 tolerant accession and susceptible variety to H. armigera, respectively. Leaf proteome were analysed at the vegetative and flowering/podding growth stages. H. armigera tolerance in IBS 3471 appeared to be related to enhanced defence responses, such as changes in secondary metabolite precursors, antioxidants, and the phenylpropanoid pathway. The development of larvae fed on an artificial diet with IBS 3471 lyophilised leaves showed similar inhibition with those fed on an artificial diet with quercetin concentrations with 32 mg/25 g of artificial diet. DAB staining (3,3′-diaminobenzidine) revealed a rapid accumulation of reactive oxygen species in IBS 3471. We conclude that IBS 3471 is an ideal candidate for improving the genetic base of cultivated pigeonpea, including traits for host plant resistance.

Comparative transcriptome analyses revealed different heat stress responses in pigeonpea (Cajanus cajan) and its crop wild relatives.

Comparative transcriptome analyses accompanied by biochemical assays revealed high variability in heat stress response in Cajanus species. Among the studied species, C. scarabaeoides was the most thermotolerant followed by C. cajanifolius, C. cajan, and C. acutifolius. Pigeonpea is one of the climate-resilient grain legumes. Though the optimum temperature for cultivated pigeonpea is ~ 25-35°C, its wild relatives grow in temperatures ranging between 18 and 45°C. To gain insight into molecular mechanisms responsible for the heat stress tolerance in pigeonpea, we conducted time-series transcriptome analysis of one pigeonpea cultivar (Cajanus cajan) and two wild relatives, Cajanus acutifolius, and Cajanus scarabaeoides subjected to heat stress at 42 ± 2ºC for 30min and 3h. A total of 9521, 12,447, and 5282 identified transcripts were differentially expressed in C. cajan, C. acutifolius, and C. scarabaeoides, respectively. In this study, we observed that a significant number of genes undergo alternative splicing in a species-specific pattern during heat stress. Gene expression profiling analysis, histochemical assay, chlorophyll content, and electrolyte leakage assay showed that C. scarabaeoides has adaptive features for heat stress tolerance. The gene set enrichment analyses of differentially expressed genes in these Cajanus species during heat stress revealed that oxidoreductase activity, transcription factor activity, oxygen-evolving complex, photosystem-II, thylakoid, phenylpropanoid biosynthetic process, secondary metabolic process, and flavonoid biosynthetic process were highly affected. The histochemical assay showed more lipid peroxidation in C. acutifolius compared to other Cajanus species inferring the presence of higher quantities of polyunsaturated fatty acids in the plasma membrane which might have led to severe damage of membrane-bound organelles like chloroplast, and high electrolyte leakage during heat stress. This study paves the way for the identification of candidate genes, which can be useful for the development of thermo-tolerant pigeonpea cultivars.

Characterization and in planta validation of a CHI4 chitinase from Cajanus platycarpus (Benth.) Maesen for its efficacy against pod borer, Helicoverpa armigera (Hübner).

Pigeonpea, Cajanus cajan is one of the economically important legume food crops and a major source of dietary proteins. Management of pod borer, Helicoverpa armigera has been prominent among crop improvement programs. Lack of resistance sources in the cultivated germplasm and crossing incompatibility with pod borer-resistant wild relatives have prompted biotechnological interventions. Identification and exploitation of genes from pigeonpea wild relatives in host plant resistance towards the pod borer assumes pertinence. Dynamic transcriptome analysis of the wild relative vis a vis cultivated pigeonpea identified a CHI4 chitinase as one of the putative insect resistance genes. The study presents variations in important amino acids in CHI4 chitinases from C. cajan and its wild relative C. platycarpus. Comparative protein modeling and docking analysis of the two proteins demonstrated differences in substrate binding efficacy of the chitinase from C. platycarpus which resulted in a minimum binding energy of -8.7 kcal mol-1 . Furthermore, we successfully evaluated the insecticidal activity of the chitinase from C. platycarpus against H. armigera challenge through heterologous expression in tobacco. Molecular characterization of transgenic plants confirmed that their efficacy against H. armigera was a result of the integration of CHI4 from C. platycarpus. Docking analysis demonstrated effective substrate interaction as a possible reason for efficacy against pod borer in the chitinase from C. platycarpus. This was authenticated by successful overexpression and bioefficacy assessment against H. armigera in tobacco. The CHI4 gene from C. platycarpus can be useful in the mitigation of H. armegira in pigeonpea as well as in other crops. © 2021 Society of Chemical Industry.

Utilizing Wild Cajanus platycarpus, a Tertiary Genepool Species for Enriching Variability in the Primary Genepool for Pigeonpea Improvement.

The use of crop wild relatives in the breeding program has been well recognized to diversify the genetic base along with introgression of useful traits. Cajanus platycarpus (Benth.) Maesen, an annual wild relative belonging to the tertiary genepool of pigeonpea, possesses many useful traits such as early maturity, high protein content, photoperiod insensitivity, and pod borer tolerance for the genetic improvement of cultivated pigeonpea. Using this cross incompatible wild Cajanus species, an advanced backcross population was developed following the embryo rescue technique. In the present study, a pre-breeding population consisting of 136 introgression lines (ILs) along with five popular varieties (used as checks) was evaluated for important agronomic traits during 2016 and 2017 rainy seasons and for grain nutrient content during 2016, 2017, and 2018 rainy seasons. Large genetic variation was observed for agronomic traits such as days to 50% flowering, number of pods per plant, pod weight per plant, grain yield per plant, and grain nutrients [protein content, grain iron (Fe), zinc (Zn), calcium (Ca), and magnesium (Mg)] in the pre-breeding population. Significant genotype × environment interaction was also observed for agronomic traits as well as grain nutrients indicating the sensitivity of these traits to the environments. No significant correlations were observed between grain yield and grain nutrients except grain Zn content which was negatively correlated with grain yield. Overall, 28 promising high-yielding ILs with high grain nutrient content were identified. These ILs, in particular, ICPP # 171012, 171004, 171102, 171087, 171006, and 171050 flowered significantly earlier than the popular mega variety, ICPL 87119 (Asha) and thus hold potential in developing new short-duration cultivars. The comprehensive multi-site assessment of these high-yielding, nutrient-rich accessions would be useful in identifying region-specific promising lines for direct release as cultivars. Moreover, these ILs are expected to replace the popular existing cultivars or for use as new and diverse sources of variations in hybridization programs for pigeonpea improvement.

Introgression of productivity enhancing traits, resistance to pod borer and Phytopthora stem blight from Cajanus scarabaeoides to cultivated pigeonpea.

The study aimed at introgression of productivity enhancing traits and resistance to pod borer and Phytophthora stem blight from wild to cultivated pigeonpea through an inter-specific cross between Cajanus scarabaeoides (ICP 15683) and C. cajan (ICPL 20329). Progenies derived from the direct segregating (without backcross) population and backcross population were evaluated for yield and yield contributing traits namely fruiting branches and pods plant-1 and 100-seed weight. Introgressed progenies having higher fruiting branches, pods and yield plant-1 compared to the cultivated parent were identified in both populations. A few progenies with significantly shorter plant height, early flowering and early maturity as compared to both cultivated and wild parents were also recovered in both populations. Progenies from both the populations were identified with higher resistance to pod borer and Phytophthora stem blight. However, some introgressed progenies having lower seed weight and seeds per pod were also recovered. The promising progenies are currently being used in the breeding programme to develop cultivars with improved productivity and resistance to pod borer and Phytophthora stem blight.

A Wild Cajanus scarabaeoides (L.), Thouars, IBS 3471, for Improved Insect-Resistance in Cultivated Pigeonpea

Cajanus scarabaeoides (L.), Thouars, is the closest wild crop relative of cultivated pigeonpea, Cajanus cajan (L.), Millspaugh. This wild pigeonpea has several insect-resistance mechanisms, particularly to Helicoverpa armigera (Hübner). Estimated economic losses in the semi-arid tropics from H. armigera damage in pigeonpea are approximately two billion USD/year. Therefore, it is imperative to improve pest resistance in this crop. In this study, we investigated insect-resistance components in IBS 3471, a C. scarabaeoides accession, and explored the possibility of transferring resistance mechanism/s to cultivated pigeonpea. A detached leaf bioassay revealed that IBS 3471 has more effective antibiosis and antixenosis resistance mechanisms against H. armigera compared to the susceptible C. cajan variety, ICPL 87. To further investigate the antibiosis resistance mechanism, we fed H. armigera larvae a heated and non-heated artificial diet supplemented with lyophilised IBS 3471 leaf powder. Incorporation of IBS 3471 leaf powder inhibited H. armigera larval weight and delayed larval development compared to larvae reared on diet supplemented with ICPL 87 leaf powder. The putative insect-resistance compounds in C. scarabaeoides were heat-labile. Proteomic analysis revealed higher levels of potential insecticidal proteins, namely lectin and cysteine proteinase inhibitor, in wild pigeonpea compared to the cultivated variety. Nutritional analysis and interspecific hybridisation experiments also indicated that IBS 3471 is a potential candidate for improvement of insect-resistance in pigeonpea. This study demonstrates that IBS 3471 has multiple resistance mechanisms against H. armigera, and they are transferable to cultivated pigeonpea.

Genetic diversity and population structure in Beninese pigeon pea [Cajanus cajan (L.) Huth] landraces collection revealed by SSR and genome wide SNP markers

Pigeon pea [Cajanus cajan (L.) Huth] is a valuable multipurpose crop locally used for household food security as well in traditional medicine in Benin. However, due to the neglected status of the crop, its genetic resources are not well evaluated and its agronomic potential remains undetermined. For breeding purpose, a total of 77 landraces from Benin and three breeding lines were simultaneously genotyped with 30 preselected SSRs and 794 GBS derived SNPs in order to estimate the genetic diversity and infer the population structure within the collection. Both marker types were found informative in polymorphism analysis revealing all high genetic variability. The 30 SSR markers led to a total of 209 alleles with an average of 6.97 alleles per locus, whereas only biallelic SNPs were extracted from GBS data according to specific filter criteria. The polymorphism information content value was 0.57 and 0.25 for SSR and SNP, respectively. The genetic diversity calculated as expected heterozygosity was higher for SSR (0.62) than for SNP (0.35). The inference of the genetic structure subdivided the entire collection into three major groups independent of the marker type. However, the resolving power in population structure analysis was higher for SNP than for SSR. AMOVA and PCoA analyses showed clearer population structure with SNP than SSR. The present study provides a clear insight on the genetic diversity in Beninese pigeon pea and represents the first report comparing the performance of SSR and SNP markers for population genetics analysis in cultivated pigeon pea. It provides useful information for further pigeon pea conservation and breeding in Benin.

Evaluation and Identification of Promising Introgression Lines Derived From Wild Cajanus Species for Broadening the Genetic Base of Cultivated Pigeonpea [Cajanus cajan (L.) Millsp.

Pigeonpea [Cajanus cajan (L.) Millsp.], a multipurpose and nutritious grain legume crop, is cultivated for its protein-rich seeds mainly in South Asia and Eastern and Southern Africa. In spite of large breeding efforts for pigeonpea improvement in India and elsewhere, genetic enhancement is inadequate largely due to its narrow genetic base and crop susceptibility to stresses. Wild Cajanus species are novel source of genetic variations for the genetic upgradation of pigeonpea cultivars. In the present study, 75 introgression lines (ILs), derived from crosses involving cultivated pigeonpea variety ICPL 87119 and wild Cajanus cajanifolius and Cajanus acutifolius from the secondary gene pool, were evaluated for yield and yield-attributing traits in diverse environments across locations and years. Restricted maximum likelihood (REML) analysis revealed large genetic variations for days to 50% flower, days to maturity, plant height, primary branches per plant, pods per plant, pod weight per plant, 100-seed weight, and grain yield per plant. Superior ILs with mid-early to medium maturity duration identified in this study are useful genetic resources for use in pigeonpea breeding. Additive main effects and multiplicative interaction (AMMI) analysis unfolded large influence of environment and genotype × environment interaction for variations in yield. A few lines such as ICPL 15023 and ICPL 15072 with yield stability were identified, while a number of lines were completely resistant (0%) to sterility mosaic diseases and/or Fusarium wilt. These lines are novel genetic resources for broadening the genetic base of pigeonpea and bring yield stability and stress tolerance. High-yielding lines ICPL 15010, ICPL 15062, and ICPL 15072 have been included in the initial varietal trials (IVTs) of the All India Coordinated Research Project (AICRP) on pigeonpea for wider evaluation across different agro-ecological zones in India for possible release as variety(ies).

Comparative transcriptome analysis of pigeonpea, Cajanus cajan (L.) and one of its wild relatives Cajanus platycarpus (Benth.) Maesen.

Pigeonpea is a major source of dietary protein to the vegetarian population of the Indian sub-continent. Crop improvement to mitigate biotic and abiotic stresses for realization of its potential yield and bridging yield gap is the need of the hour. Availability of limited genomic resources in the cultivated germplasm, however, is a serious bottleneck towards successful molecular breeding for the development of superior genotypes in pigeonpea. In view of this, improvement of pigeonpea can be attempted through transgenesis or by exploiting genetic resources from its wild relatives. Pigeonpea wild relatives are known to be bestowed with agronomic traits of importance; discovery and deployment of genes from them can provide a lucrative option for crop improvement. Understanding molecular signatures of wild relatives would not only provide information about the mechanism behind desired traits but also enable us to extrapolate the information to cultivated pigeonpea. The present study deals with the characterization of leaf transcriptomes of Cajanus cajan and one of its wild relatives, Cajanus platycarpus. Illumina sequencing revealed 0.11 million transcripts in both the species with an annotation of 0.09 million (82%) transcripts using BLASTX. Comparative transcriptome analyses on the whole, divulged cues about the wild relative being vigilant and agile. Gene ontology and Mapman analysis depicted higher number of transcripts in the wild relative pertaining to signaling, transcription factors and stress responsive genes. Further, networking between the differentially expressed MapMan bins demonstrated conspicuous interactions between different bins through 535 nodes (512 Genes and 23 Pathways) and 1857 edges. The authenticity of RNA-seq analysis was confirmed by qRT-PCR. The information emanating from this study can provide valuable information and resource for future translational research including genome editing to alleviate varied stresses. Further, this learning can be a platform for in-depth investigations to decipher molecular mechanisms for mitigation of various stresses in the wild relative.

Variability in Morpho-biochemical Traits Associated with Pod Borer (Helicoverpa armigera) Resistance in Pigeonpea Pods

Pigeonpea contributes to food and nutrition security among poor households in urban and rural areas. Globally it is characterized by stagnant and unstable yield due to its susceptibility to various stresses including the pod borer (Helicoverpa armigera) which causes substantial damage to the crop and may result in absolute economic yield loss. The existing cultivated pigeonpea are susceptible to pod borer with only a few genotypes reported to be tolerant based on pod and seed damage. Limited information is available on morphological and biochemical traits associated with pod borer resistance among the existing genotypes. This study was therefore carried out to identify diversified sources of resistance against pod borer damage. The study was set up to assess traits that may contribute to pod borer resistance among 12 selected elite pigeonpea genotypes in three replicates and means were separated based on LSD test using Genstat software. The field study was carried out in Kerio Valley during the long rains of April-September of 2017. The genotypes varied significantly for all the parameters measured at P≤0.05 with a mean of 608.33 g/100 g (crude protein), 175.61 mg/100 g (total phenol), 19.85 mg/100 g (total flavonoid), 0.448 mm (trichome length), 210.6 / 4 mm2(trichome density) and 0.353 mm(depth of locules). Significant negative correlation was also observed between total phenol, total flavonoid, depth of locules, trichome length and trichome density with pod damage. However, a positive correlation was recorded between crude proteins with pod damage. These results reveal that, host plant resistance is an association of several morphological and biochemical traits. Therefore, these genotypes with elevated levels can be selected and utilized in breeding towards improving resistance to pod borer in pigeonpea.

Interspecific hybridization to introduce useful genetic variability for pigeonpea improvement

Pigeonpea (Cajanus cajan (L.) Millspaugh) is an important grain legume grown in tropical and subtropical regions of the world. Narrow genetic base coupled with low levels of resistance against important biotic/abiotic stresses in cultivated pigeonpea is the major constraint affecting its production and productivity globally. Wild Cajanus species are the reservoir of many important genes including resistance/tolerance to diseases, insect-pests and drought, and good agronomic traits and can be utilized to improve the crop cultivars, enrich variability, and broaden the genetic base. Utilization of wild Cajanus species has contributed for the development of cytoplasmic male sterility (CMS) systems for pigeonpea improvement. Prebreeding populations involving promising wild Cajanus accessions belonging to secondary and tertiary gene pools as donors and popular pigeonpea cultivars as recipients were developed for enriching variability for pigeonpea improvement. Considerable variability was observed in these populations for morpho-agronomic traits and for biotic stresses. Two advanced backcross populations derived from wild Cajanus species are being genotyped to identify QTLs associated with agronomic traits for further deployment in pigeonpea improvement programs. Agronomically desirable and disease resistant introgression lines have been identified and shared with breeding programs for developing new high-yielding and climateresilient pigeonpea cultivars with a broad genetic base.

Development of a new CMS system in pigeonpea utilizing crosses with Cajanus lanceolatus (WV Fitgz) van der Maesen

Cytoplasmic male sterility is an important biological tool which is now available to pigeonpea breeders to exploit heterosis/hybrid vigor. A variety of CMS systems have been developed when wild relatives of pigeonpea from different gene pools were crossed as the female parent with cultivated types as the male parent. This paper reports a second source of CMS developed by using the cultivated pigeonpea as the female parent and one of its wild relative Cajanus lanceolatus (WV Fitgz) van der Maesen as the pollen donor, as such the A5 CMS system derived from C. acutifolius. All the F1 hybrids were evaluated to confirm hybridity using 27 simple sequence repeat (SSR) markers. SSR marker analysis of parents provided 17 polymorphic markers from a total of 27 SSR markers used. Subsequently polymorphic SSRs were used to confirm the hybridity of the F1 plants. F1 hybrid plants were crossed with a range of pigeonpea cultivars to identify maintainers of male sterility. Morphology of the F1 and backcross generations, cytology of the sterile as well as fertile floral buds derived from the crosses between sterile F1 hybrids and unrelated pigeonpea cultivars were studied. An important observation made was that male sterility was a post meiotic process. Microsporogenesis was normal until the tetrad stage, but none of them formed pollen grains. Instead, they grouped together within the pollen mother cell wall and the tetrads did not separate into individual pollen grains.

A Study on Comparative Fertility Restoration in A2 and A4 Cytoplasms and Its Implication in Breeding Hybrid Pigeonpea [Cajanus cajan (L.) Millspaugh

Exploitation of hybrid vigour has been visualized as the most efficient option for increasing productivity in pigeonpea [Cajanus cajan (L.) Millspaugh]. Cytoplasms from various wild relatives of pigeonpea have been transferred to develop CMS lines in the background of cultivated pigeonpea. However, A2 (Cajanus scarabaeoides) and A4 (Cajanus cajanifolius) cytoplasms have been utilized most frequently. In order to study fertility restoration efficiency in F1 hybrids having either A2 or A4 cytoplasms, an experiment was conducted at the Indian Institute of Pulses Research (IIPR), Kanpur during 2008-2012. Four CMS lines namely Hy4A, H28A (each with A2 cytoplasm), ICP 2039A and ICP 2043A (both with A4 cytoplasm) were crossed with ten genotypes/restorers of long duration pigeonpea for two years. The F1 hybrids so-obtained were assessed in the succeeding years for pollen fertility and pod setting. All the pollinators except IPA 203 restored fertility in F1 hybrids derived from ICP 2039A and ICP 2043A (both having A4 cytoplasm). However, none of the restorers were effective in restoring fertility in hybrids derived from Hy4A and H28A (each with A2 cytoplasm). This could be ascribed to undesirable linkage drag still present in these two CMS lines having A2 cytoplasm. The F2 progenies derived from 4 hybrids (ICP 2039A × NA-1, ICP 2039A × Bahar, ICP 2043A × NA-1 and ICP 2043A × Bahar) segregated approximately into 3 fertile: 1 sterile plants. However, 2 F2 progenies having Pusa 9 as the restorer revealed approximately 15 fertile:1 sterile ratio. Thus monogenic and digenic duplicate gene action with complete dominance for fertility restoration was observed in F1 hybrids derived from CMS lines having A4 cytoplasm. F3 progenies from individual F2 plants of these crosses also confirmed the same pattern of fertility restoration. This study indicated that CMS lines based on A4 cytoplasm would be more desirable as these might have more number of restorers compared to those having A2 cytoplasm.

Interspecific hybridization betweenCajanus cajan(L.) Millsp. andC. lanceolatus(WV Fitgz) van der Maesen

Cultivated pigeonpea has a narrow genetic base. Wild relatives play an important role in the efforts to broaden its genetic base. In this report, we present a successful wide-cross between the cultivated pigeonpea andCajanus lanceolatus, a wild relative from the secondary gene pool, native to Australia, with desirable traits such as frost and drought resistance. A range of F1progeny were obtained and the resultant F1hybrid plants set mature pods and seeds. The hybrids had intermediate morphology, sharing the traits of both the parents. All the F1hybrids flowered profusely. Some of the hybrids were completely male sterile and some were partially fertile with pollen fertility ranging from 35 to 50 %. Meiotic analysis of the fertile F1hybrids revealed a high degree of meiotic chromosome pairing between the two parental genomes. Meiotic analysis of the sterile F1hybrids revealed that the breakdown of microsporogenesis occurred at the post-meiotic stage after the formation of tetrads. Fertile plants formed regular bivalents with normal disjunction, except for occasional asynchrony at meiotic II division.

Genetic diversity studies and identification of SSR markers associated with Fusarium wilt (Fusarium udum) resistance in cultivated pigeonpea (Cajanus cajan)

Genetic diversity and identification of simple sequence repeat markers correlated with Fusarium wilt resistance was performed in a set of 36 elite cultivated pigeonpea genotypes differing in levels of resistance to Fusarium wilt. Twenty-four polymorphic sequence repeat markers were screened across these genotypes, and amplified a total of 59 alleles with an average high polymorphic information content value of 0.52. Cluster analysis, done by UPGMA and PCA, grouped the 36 pigeonpea genotypes into two main clusters according to their Fusarium wilt reaction. Based on the Kruskal-Wallis ANOVA and simple regression analysis, six simple sequence repeat markers were found to be significantly associated with Fusarium wilt resistance. The phenotypic variation explained by these markers ranged from 23.7 to 56.4%. The present study helps in finding out feasibility of prescreened SSR markers to be used in genetic diversity analysis and their potential association with disease resistance.