Pepper Cultivars Research Articles

First report of a resistance-breaking strain of tomato spotted wilt orthotospovirus infecting Capsicum annuum with the Tsw resistance gene in Texas.

Since the first report of the 'spotted wilt' disease of tomato published in 1915 in Australia, tomato spotted wilt orthotospovirus (TSWV) has become a pandemic virus with an estimated economic impact of over $1 billion annually (Brittlebank 1919; German et al. 1992). TSWV strains capable of disrupting Tsw-mediated single gene resistance in pepper (i.e., resistance-breaking or RB strains) have been previously reported in multiple countries (Crescenzi et al., 2013; Deligoz et al. 2014; Margaria et al. 2004; Sharman and Persley 2006; Yoon et al. 2021), but only in California (Macedo et al. 2019) and Louisiana (Black et al. 1996) in the US. In August 2021, severe tospovirus-like disease symptoms (stunting; leaf, stem, and petiole necrosis; and concentric rings on leaves and fruits) were documented in TSWV-resistant cultivars of sweet pepper (Capsicum annuum L.) containing the Tsw gene in Bushland, TX. In the next season in August 2022, leaf samples from 214 TSWV-resistant pepper plants (with or without disease symptoms) from seven cultivars were tested with a TaqMan probe-based qPCR assay targeting coat protein (CP) of the TSWV (TSWV-F: AGAGCATAATGAAGGTTATTAAGCAAAGTGA and TSWV-R: GCCTGACCCTGATCAAGCTATC; TaqMan probe: CAGTGGCTCCAATCCT). Across all cultivars, 85 samples tested positive for TSWV. Of these, 39 showed characteristic TSW symptoms with disease incidence ranging from 10-30% depending on the cultivar. The remaining 46 samples were asymptomatic with no apparent hypersensitive response in leaves. To further confirm the RB status of TSWV strain/s in the field samples, leaves from six TSWV resistant plants from three different pepper cultivars were pooled together and used to mechanically inoculate five non-infected three-week-old pepper plants from nine cultivars: seven TSWV resistant (Tsw), one moderately resistant, and one susceptible, with three replications. Tsw expression in two representative plants from each resistant cultivar was confirmed using SYBR Green based one-step qRT-PCR with primers specified in the South Korea Patent # KR102000469B1 were used with two plants from susceptible cultivar as a negative control. Field plants that tested negative for TSWV in PCR analysis were used as a mock inoculation control and tissues from tomato plants infected with wild-type TSWV strain/s (previously isolated from non-resistant tomato plants) were used as a wild-type control. Three weeks post-inoculation, characteristic orthotospovirus symptoms were observed in plants inoculated with the putative RB isolate, in that TSW incidence ranged between 10-50% in seven resistant cultivars, 70% in a moderately resistant cultivar, and 90% in a susceptible cultivar. On the contrary, no disease incidence was observed in resistant and moderately resistant plants, whereas 50% incidence was observed in susceptible plants in the wild-type control. Hypersensitive response was observed in the local leaves of mechanically inoculated resistant plants that tested negative in PCR approximately 5-7 days post inoculation. All symptomatic and 30-100% asymptomatic TSWV-inoculated plants with RB or wild-type strain/s tested positive for TSWV in probe-based qPCR analysis confirming that none of the tested cultivars was immune to TSWV infection. All mock-inoculated plants tested negative in the qPCR analysis. Both nucleotide and amino acid sequences of complete TSWV silencing suppressor protein (NSs) recovered from six plants originally used in the mechanical inoculation (NCBI accession OP548104) and inoculated resistant plants (NCBI accession OP548113) showed 99% homology with the NSs sequences of New Mexico pepper isolates KU179589 and APG79491, respectively. The NSs point mutation T to A at 104 amino acid position responsible for resistance breaking in pepper in Hungarian TSWV isolates (NCBI accessions KJ649609 & KJ649608 (Almasi et al., 2017) was absent in the NSs sequences from all samples. Besides novel point mutations, genetic reassortment as previously reported in S. Korean TSWV RB pepper isolates (Kwon et al., 2021) and in other orthotospoviruses such as tomato chlorotic spot virus and groundnut ringspot virus (Webster et al., 2011) could be a potential RB mechanism in the Bushland TSWV RB isolates. A comprehensive genomic analysis of these isolates is required to determine the fundamental evolutionary mechanisms that enable the disruption of Tsw-mediated gene resistance. Taken together, these results indicate that at least one, but potentially multiple new strains of TSWV capable of disrupting Tsw-mediated resistance and producing moderate to severe symptoms in an array of commercial resistant pepper cultivars have emerged and pose a significant threat to pepper production in Texas.

Macroscopic and microscopic characterization of fluorescence properties of multiple sweet pepper cultivars (Capsicum annuum L.) using excitation-emission matrix and UV induced fluorescence imaging

Sweet peppers are a popular vegetable with various surface colors, such as green, purple, red, or yellow. To characterize the unique fluorescence properties associated with a broad range of sweet peppers of various colors (14 varieties), a fluorescence spectrofluorometer and imaging were used. The results showed that all cultivars in the experiment had blue fluorescence emissions when excited with light in the UV-A region, while chlorophyll fluorescence could be observed in green peppers. The emitted blue fluorescence originated from the epidermis (cuticle layer). The color distribution of these sweet peppers in the a* and b* color space were compared to the image obtained under white LED light. Yellow and red pepper cultivars have thicker, multiple cuticular wax layers and more distinct maturity stages than other sweet pepper varieties observed. With the establishment of this basic fluorescence database, further applications of fluorescence-based techniques and the unification of evaluation methods for pepper quality will be more easily established.

Influence of Varieties and Mulching on the Quality and Quantity of Vegetable Pepper Yield

The influence of the cultivation method on green pepper fruits was investigated. Six pepper cultivars were planted using soil covered by brown mulching foil and in uncovered soil. Cultivation was maintained for two years providing the equivalent conditions of cultivation. The ascorbic acid content, total antioxidant capacity, total polyphenol content, soluble solids content and yield were observed and compared to mulching foil application, year of cultivation, pepper variety and order of harvest. The obtained results proved a statistically significant effect of mulching film in all tested varieties; the effects of year of cultivation and plant variety were also confirmed. The mulching film had a positive effect on pepper yield. The highest yield of peppers was grown on mulching foil in the variety ‘Lungy’. The vitamin C content, total antioxidant capacity, total phenolic content and soluble solids content were demonstrably higher in the variant without mulching film. The highest levels of total polyphenol content and total antioxidant capacity were determined in the ‘Yolo wonder’ variety, the darkest colored cultivar. The highest content of vitamin C and soluble solids content were found in the ‘Semaroh’ variety grown without mulching film, however, this variety achieved the lowest yield growing with mulching foil.

Biological and molecular characterization of Tomato spotted wilt orthotospovirus isolates from pepper cultivars with the resistance gene Tsw from Turkey

Biological and molecular characterization of Tomato spotted wilt orthotospovirus isolates from pepper cultivars with the resistance gene Tsw from Turkey

Comparison of Physiological Traits of Two Sweet Pepper Cultivars under Salinity Stress

Comparison of Physiological Traits of Two Sweet Pepper Cultivars under Salinity Stress

Quantitative Genetic Analysis of Interactions in the Pepper-Phytophthora capsici Pathosystem.

The development of pepper cultivars with durable resistance to the oomycete Phytophthora capsici has been challenging due to differential interactions between the species that allow certain pathogen isolates to cause disease on otherwise resistant host genotypes. Currently, little is known about the pathogen genes involved in these interactions. To investigate the genetic basis of P. capsici virulence on individual pepper genotypes, we inoculated sixteen pepper accessions, representing commercial varieties, sources of resistance, and host differentials, with 117 isolates of P. capsici, for a total of 1,864 host-pathogen combinations. Analysis of disease outcomes revealed a significant effect of inter-species genotype-by-genotype interactions, although these interactions were quantitative rather than qualitative in scale. Isolates were classified into five pathogen subpopulations, as determined by their genotypes at over 60,000 single-nucleotide polymorphisms (SNPs). While absolute virulence levels on certain pepper accessions significantly differed between subpopulations, a multivariate phenotype reflecting relative virulence levels on certain pepper genotypes compared with others showed the strongest association with pathogen subpopulation. A genome-wide association study (GWAS) identified four pathogen loci significantly associated with virulence, two of which colocalized with putative RXLR effector genes and another with a polygalacturonase gene cluster. All four loci appeared to represent broad-spectrum virulence genes, as significant SNPs demonstrated consistent effects regardless of the host genotype tested. Host genotype-specific virulence variants in P. capsici may be difficult to map via GWAS with all but excessively large sample sizes, perhaps controlled by genes of small effect or by multiple allelic variants that have arisen independently. [Formula: see text] Copyright © 2022 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license.

Fruit Quality of Some Hot Peppers Cultivars from Vegetable Research Development Station Buzau

The aim of this study was to assess phenotypic diversity in terms of fruit quality traits and yield, and also to establish valuable genotypes for breeding purpose suitable for different direction of use. Ten cultivars of hot peppers bred at VRDS Buzau were collected and fruit quality (dry matter content, fruit firmness, the total soluble solids, titratable acidity and ascorbic acid content) was evaluated at different ripening stages. A very highly significant difference (p<0.01) was found for the studied quantitative parameters, showing a great variability among the studied accessions. During ripening, the dry matter content, the firmness, the TSS content and the titratable acidity increase for all studied cultivars and there were significant differences between them. A broad range of variation was noted in Vitamin C content in both stages of maturity. In the present research work, a great variability among the studied accessions was found. Fully ripe fruits were found considerably richer in the bioactive factor than unripe fruits. Our results have selected two important genotypes: A12A, an accession suitable for obtaining chili powder, due to the his low content in dry matter and total soluble solids and accession A135 suited for fresh consumption and for long shelf life because it has a high firmness.

Production of clonal seedlings of black pepper cv. Bragantina under doses of controlled-release fertilizer

Commercial substrates and their fertilization are essential for the morphophysiological, nutritional, and sanitary quality of seedlings. In this perspective, this study aimed to evaluate the quality of clonal seedlings of the black pepper cultivar Bragantina under doses of controlled-release fertilizers (CLF) in a commercial substrate. The treatments were constituted by five doses of the CLF Osmocote® 19-06-10 Mini Prill (3-4 months) (0, 2, 4, 6, and 8 kg m-3), with four replications of 16 cuttings. The CLF Osmocote®, especially in doses close to 4.16 kg m-3, showed to be promising for the production of clonal seedlings of the black pepper cultivar Bragantina.

Can raw zeolite be used for post harvest pepper seed drying?

This study was carried out to test the use of raw zeolite material in drying freshly harvested pepper seeds. Seeds of three pepper cultivars (Carliston, Kandil Dolma, and Yalova Yağlık) were harvested at maturity (65-70 days after anthesis) in two runs (run 1 and 2) in 2019 and dried at 45°C (machine-drying), in the sun (sun-dried) and with zeolite (1:1, seed, zeolite, rate) until seed moisture was reduced to lower than 10%. The time to safe drying was about 20, 40 and 60-100 hours for machine, sun and zeolite drying, respectively. Germination percentages were not significantly different between the drying methods (P<0.05) for all three cultivars. Mean germination time was not affected by drying methods in Yalova Yağlık, but was in both runs for Kandil Dolma and in the second run for Carliston. Drying methods showed insignificant differences (P>0.05) in seedling emergence for Carliston and Yalova Yağlık, but were significant (P<0.05) for Kandil Dolma in both runs. Mean seedling emergence time (d) also changed among the cultivars. Results indicated that raw zeolite has the potential to be used for safe drying of freshly harvested pepper seeds.

Heat-shock and methyl-jasmonate: The cultivar-specific responses of pepper plants.

Frequency, intensity and duration heat-related events have profound implications for future food supply through effects on plant growth and development. This concern needs effective and urgent mitigation tools. However, the effectiveness of potential solutions may decrease according to the specific cultivar response rather consider at specie level. The metyl-jasmonates are essential cellular regulators which are involved in pivotal plant development processes and related to confer protection to heat shock. Thus, our aim was to study the response of three pepper cultivars, Agio (Hungarian type), Basque (Chilli type), and Loreto (Lamuyo type), subjected to heat shock (40°C/72 h) and foliarly-sprayed with methyl-jasmonate (MeJA; 100 µmol), and the effects on several physiological traits. Our results show that despite the important differential impact of heat shock caused on each cultivar, MeJA application did not affect gas exchange, chlorophyll A concentration or efficiency of the photosystem in these cultivars. However, P concentration was reduced when MeJA was applied to Basque chilli, and a significant effect on leaf carbohydrates concentration was observed for Agio and Loreto. Moreover, Agio was the only cultivar in which the amino-acid profile was affected by MeJA under heat shock. Under that condition, putrescine increased for all cultivars, whist the effect of MeJA was only observed for spermine and histamine for Agio and Loreto. Thus, the results indicated that the ameliorative impact of MeJA on this stressor was clearly influenced by cultivar, revealing specific traits. Thus, these results could be used as valuable tools for the characterization of this intraspecific tolerance to heat shock during the vegetative growth stage of pepper.

Nitrogen Effect on Fruit Quality and Yield of Muskmelon and Sweet Pepper Cultivars

Yield and fruit quality are two of the most important parameters for the profitability of vegetable crops. In commercial vegetable production, nitrogen (N) is commonly applied in excess, which is associated with nitrate (NO3−) leaching loss. In addition, excess N application may affect yield and fruit quality. The aim of this study was to evaluate the effect of N applications of very deficient N (N1, 2 mmol L−1), deficient N (N2, 8 mmol L−1), and conventional N (N3, 14 mmol L−1), according to local fertigation practices, in soil-grown muskmelon and sweet pepper crops in Almeria, South-Eastern Spain. The evaluation was conducted in three cultivars of each species. The yield and the fruit quality parameters of firmness, colour, total soluble solids (TSS) and morphometric variables were evaluated in two years for each species. For most parameters in both species, the effects of N, when significant, occurred regardless of cultivar. In muskmelon and sweet pepper, application of 8.2 mmol N L−1 (i.e., N2) was sufficient to achieve a maximum yield of 6.7 and 7.4 kg m−2, respectively. In muskmelon, very deficient N application led to an increase of 58% in the percentage of fruit discarded, mostly due to malformed and undersized fruits. Fruit firmness and red–green axis coordinate (a*) were not consistently affected by N in any of the crops. However, the fruit lightness (L*) increased with N addition in both species, likely because of increased chlorophyll pigments. With N addition, fruit TSS slightly decreased in muskmelon and slightly increased in sweet pepper. However, fruit TSS of both species were within reference values for commercialisation in the three N treatments. There were differences in yield between cultivars in muskmelon but not in sweet pepper, likely due to differences in fruit number in muskmelon. There were differences between cultivars in TSS and colour a* coordinate in both muskmelon and sweet pepper. Cultivars with higher TSS and a* coordinate will likely be more desirable for consumers because of the sweeter taste and more intense orange colour in muskmelon and reddish colour in sweet pepper. Overall, our manuscript showed that N application can be reduced, relative to the conventional N application, without reducing yield or fruit quality in muskmelon, yet additional studies should be conducted in sweet pepper to complement the results of the 2020 crop.

Pepper Plants Harboring L Resistance Alleles Showed Tolerance toward Manifestations of Tomato Brown Rugose Fruit Virus Disease.

The tobamovirus tomato brown rugose fruit virus (ToBRFV) infects tomato plants harboring the Tm-22 resistance allele, which corresponds with tobamoviruses’ avirulence (Avr) gene encoding the movement protein to activate a resistance-associated hypersensitive response (HR). ToBRFV has caused severe damage to tomato crops worldwide. Unlike tomato plants, pepper plants harboring the L resistance alleles, which correspond with the tobamovirus Avr gene encoding the coat protein, have shown HR manifestations upon ToBRFV infection. We have found that ToBRFV inoculation of a wide range of undefined pepper plant varieties could cause a “hypersensitive-like cell death” response, which was associated with ToBRFV transient systemic infection dissociated from disease symptom manifestations on fruits. Susceptibility of pepper plants harboring L1, L3, or L4 resistance alleles to ToBRFV infection following HRs was similarly transient and dissociated from disease symptom manifestations on fruits. Interestingly, ToBRFV stable infection of a pepper cultivar not harboring the L gene was also not associated with disease symptoms on fruits, although ToBRFV was localized in the seed epidermis, parenchyma, and endothelium, which borders the endosperm, indicating that a stable infection of maternal origin of these tissues occurred. Pepper plants with systemic ToBRFV infection could constitute an inoculum source for adjacently grown tomato plants.

Viromes of 15 Pepper (Capsicum annuum L.) Cultivars.

Pepper (Capsicum annuum L.) plants produce berry fruits that are used as spices. Here, we examined the viromes of 15 pepper cultivars through RNA sequencing. We obtained 1,325 virus-associated contigs derived from 8 virus species. Bean broad wilt virus 2 (BBWV2) and cucumber mosaic virus (CMV) were identified as the major viruses infecting pepper plants, followed by potato virus Y, bell pepper endornavirus, and hot pepper endornavirus. The proportion of viral reads in each transcriptome ranged from 0.04% to 24.5%. BBWV2 was the dominant virus in seven cultivars, whereas CMV was dominant in five cultivars. All the bell pepper cultivars showed severe viral disease symptoms, whereas the commercially developed hot pepper cultivars were asymptomatic or had mild symptoms. In addition, 111 complete viral segments were obtained from 7 viruses. Based on the obtained viral genomes, the genetic relationship between the identified viruses and quasispecies of BBWV2 and CMV in each pepper plant was determined. Newly designed primers for nine viruses confirmed the results of RNA sequencing. Taken together, this study, for the first time, provides a comprehensive overview of viromes in 15 major pepper cultivars through RNA sequencing.

Genome-Wide Identification of Polyamine Oxidase (PAO) Family Genes: Roles of CaPAO2 and CaPAO4 in the Cold Tolerance of Pepper (Capsicum annuum L.).

Polyamine oxidases (PAOs), which are flavin adenine dinucleotide-dependent enzymes, catalyze polyamine (PA) catabolism, producing hydrogen peroxide (H2O2). Several PAO family members have been identified in plants, but their expression in pepper plants remains unclear. Here, six PAO genes were identified in the ‘Zunla-1’ pepper genome (named CaPAO1–CaPAO6 according to their chromosomal positions). The PAO proteins were divided into four subfamilies according to phylogenetics: CaPAO1 belongs to subfamily I; CaPAO3 and CaPAO5 belong to subfamily III; and CaPAO2, CaPAO4, and CaPAO6 belong to subfamily IV (none belong to subfamily II). CaPAO2, CaPAO4, and CaPAO6 were ubiquitously and highly expressed in all tissues, CaPAO1 was mainly expressed in flowers, whereas CaPAO3 and CaPAO5 were expressed at very low levels in all tissues. RNA-seq analysis revealed that CaPAO2 and CaPAO4 were notably upregulated by cold stress. CaPAO2 and CaPAO4 were localized in the peroxisome, and spermine was the preferred substrate for PA catabolism. CaPAO2 and CaPAO4 overexpression in Arabidopsis thaliana significantly enhanced freezing-stress tolerance by increasing antioxidant enzyme activity and decreasing malondialdehyde, H2O2, and superoxide accumulation, accompanied by the upregulation of cold-responsive genes (AtCOR15A, AtRD29A, AtCOR47, and AtKIN1). Thus, we identified candidate PAO genes for breeding cold-stress-tolerant transgenic pepper cultivars.

Reducing Water Salinity at Flowering Stage Decreases Days to Flowering and Promotes Plant Growth and Yield in Chile Pepper

Water scarcity is a major problem for crop production around the world including Southwestern United States and growers are increasingly using groundwater for agriculture in Southern New Mexico. Most of the groundwater in New Mexico is brackish and continuous long-term use could lead to salt accumulation in the soil. Reverse osmosis (RO) can desalinate brackish groundwater (BGW), however, environmentally safe disposal of RO concentrate is costly. This greenhouse study evaluated the effects of BGW and RO concentrate at various growth stages of two chile pepper cultivars, NuMex Joe E. Parker and NuMex Sandia Select. Five salinity treatments were applied to plants, three of them used saline waters of 0.6 (control), 4.0 (BGW), and 8.0 dS/m (RO) throughout the growing season, whereas the other two changed waters of 4.0 and 8.0 dS/m to waters of 2.0 and 6.0 dS/m from the beginning of the flowering stage. Number of flowers, days to flowering, relative plant heights, relative fresh biomass, fruit yields, photosynthetic rate (Pn), stomatal conductivity (gS), and actual evapotranspiration (ETa) significantly decreased with increasing irrigation water salinity levels. Concentrations of Mg2+, Na+, and Cl− in plants increased with increasing water salinity levels. Changing to irrigation with reduced salinity waters of 2.0 and 6.0 dS/m at the flowering stage initiated reproductive development more rapidly and alleviated the adverse influence of salinity on the number of flowers of chile pepper, plant height, Pn, as well as fresh shoot and fruit weight than that with continuous irrigation with electrical conductivity (EC) of 4.0 dS/m and 8.0 dS/m beyond the flowering stage. Irrigation that practices a change from high salinity to lower salinity at the flowering stage can optimize the use of saline irrigation water for growing chile peppers.

Root Architectures of Hybrid Pepper Variety Candidates with Low Temperature Stress Tolerance

Düşük sıcaklık stresine dayanıklılık yönünden bitki türleri arasında genotipik düzeyde farklılıklar bulunmaktadır. Son yıllarda düşük sıcaklığa tolerant yeni çeşitler geliştirilmektedir. Bu çalışmada, hibrit çeşit ıslahı ile düşük sıcaklığa tolerant olarak geliştirilen 28 F1 hibrit dolmalık biber çeşit adayının kök yapıları ve köklenme düzeylerinin karşılaştırılması amaçlanmıştır. Hibrit dolmalık biber çeşit adaylarının hem serada ve hem de açıkta birçok kök parametresi yönünden, kontrol çeşide (Benino F1) göre daha iyi bir köklenme yapısına sahip olduğu tespit edilmiştir. Ayrıca biber genotiplerinin kök mimarileri yönünden fenotipik çeşitliliğin oldukça yüksek olduğu belirlenmiştir. Çalışmada; ortalama toplam kök uzunluğu, 764.48 cm (HD-6) ile 1120.40 cm (HD-16), kök yüzey alanı 619.47 cm2 (HD-9) ile 963.14 cm2 (HD-26), kök çapı 2.50 (HD-3) ile 4.98 mm (HD27) ve kök hacmi ise 47.77 cm3 (HD-3) ile 147.54 cm3 (HD-27) arasında değişim göstermiştir. Tüm kök parametreleri birlikte değerlendirildiğinde; toplam kök uzunluğu yönünden HD-16, kök çapı ve kök hacmi değerleri yönünden HD-27, kök yüzey alanı yönünden HD-26 ve kök kuru ağırlığı yönünden ise HD-22 genotipinin ümit var oldukları saptanmıştır.

Antioxidant activation, cell wall reinforcement, and reactive oxygen species regulation promote resistance to waterlogging stress in hot pepper (Capsicum annuum L.)

BackgroundHot pepper (Capsicum annuum L.) is one of the world’s oldest domesticated crops. It has poor waterlogging tolerance, and flooding frequently results in plant death and yield reduction. Therefore, understanding the molecular mechanisms associated with pepper waterlogging tolerance is essential to grow new varieties with stronger tolerance.ResultsIn this study, we discovered that after 5 days of flooding, the growth rate of waterlogging-tolerant pepper cultivars did not reduce to a large extent. Physiological data revealed that chlorophyll concentration was not significantly affected by flooding; however, stomatal conductance was altered considerably 0–5 days after flooding, and the net photosynthesis rate changed substantially 5–10 days after flooding. In addition, the root activity of waterlogging-tolerant varieties was substantially higher after flooding for 10 days than that of the control. This implies that the effect of flooding is associated with changes in the root environment, which ultimately affects photosynthesis. We evaluated changes in gene expression levels between two pepper types at the same time point and the same pepper variety at different time points after flooding stress treatment and performed a screening for multiple potential genes. These differentially expressed genes (DEGs) were further analyzed for functional enrichment, and the results revealed that antioxidase genes, cell wall synthesis pathway genes, and calcium ion regulation pathway genes might be associated with waterlogging tolerance. Other genes identified in peppers with waterlogging tolerance included those associated with lignin synthesis regulation, reactive oxygen species (ROS) regulation pathways, and others associated with stress resistance. Considerable changes in the expression levels of these genes were recorded 5 days after waterlogging, which was consistent with a considerable increase in oxidase content that was also noted on the fifth day after flooding. The quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) findings revealed that among the 20 selected DEGs, including genes such as mitogen-activated protein kinase 3 (MPK3) and calcium-binding protein 4 (CML4), approximately 80% of the gene expression patterns were consistent with our RNA-seq dataset.ConclusionsThe findings of this study suggest that ROS modulation, increased antioxidase activity, lignin formation, and the expression of stress resistance genes help peppers with waterlogging tolerance resist flooding stress in the early stages. These findings provide a basis for further investigation of the molecular mechanisms responsible for waterlogging tolerance in pepper and may be a critical reference for the breeding of hot pepper.

Repellence or attraction: secondary metabolites in pepper mediate attraction and defense against Spodoptera litura.

Resistance to insect pests is an important self-defense characteristic of pepper plants. However, the resistance of different pepper cultivars to Spodoptera litura larvae, one of the main insect pest species on pepper, is not well understood. Among seven pepper cultivars evaluated, cayenne pepper 'FXBX' showed the highest repellency to third instar S. litura larvae, Chao tian chili pepper 'BLTY2' showed the lowest repellency. Plant volatiles (1-hexene, hexanal, β-ionone, (E,E)-2,6-nonadienal, and methyl salicylate) affected host selection by S. litura. Among these, 1-hexene, hexanal, and β-ionone at concentrations naturally-released by pepper leaves were found to repel S. litura. Interestingly, S. litura larvae fed on the larva-attracting pepper cultivar, (BLTY2) had an extended developmental period, which was about 13 days longer than larvae fed on FXBX. Besides, the survival rate of larvae fed on BLTY2 was 22.5 ± 0.0%, indicating that the leaves of BLTY2 can kill S. litura larvae. Correlation analysis showed that larval survival rate, emergence rate, female adult longevity, and pupal weight were positively correlated with the vitamin C, amino acids, protein, cellulose, and soluble sugar contents, but were negatively correlated with wax and flavonoids contents. We identified two different modes of direct defense exhibited by pepper cultivars against S. litura. One involves the release of repellent volatiles to avoid been fed on (FXBX cultivar). The other involves the inhibition of the growth and development or the direct killing of S. litura larvae which feeds on it (BLTY2 cultivar). © 2022 Society of Chemical Industry.

Phenotypic and genotypic characterisation of pepper genotypes for Tomato Spotted Wilt Orthotospovirus reaction and resistance

In order to determine the effects of Tomato spotted wilt orthotospovirus (TSWV) on the yield and fruit quality parameters of some common local and commercial pepper (Capsicum annuum L.) genotypes under greenhouse conditions, mechanical inoculations were performed, and virus infections were tested by DAS-ELISA and RT-PCR after the inoculations. Based on the DAS-ELISA results, 95% of the inoculated plants were found to be positive for TSWV, in accordance with the expected amplicon size (276 bp) obtained by RT-PCR results. Infection of TSWV caused significant (p≤0.05) reduction in fruit number (45.97-100%), fruit weight (66.38-98.77%), fruit width (63.77-96.52%), fruit length (31.97-93.514%), flesh thickness (28.64-82.41%), fruit firmness (5.82-94.43%), fruit colour (1.62-7.79%), and total yield (68.62-100%) in infected plants. The best performance against TSWV was observed on cv. Yalova Çarliston 341, while the lowest was observed on cv. Bora 77 among the tested pepper cultivars Yalova Çarliston 341, Yalova Tatlı Kıl, Yalova Yağlık 28, Mazamort, Sera Demre 8, Üçburun, Geyikboynuzu, Bor Biberi, Bora 77 and 153-227. Moreover, the incidence of Tsw resistance gene was investigated by molecular analysis using CAPS marker SCAC568 with TaqI restriction enzyme digestion; however, Tsw gene could not be detected in any of the tested cultivars except wild type C. chinense and resistant genotype cv.153-227. This study reveals the effects of TSWV in common pepper genotypes and will be important for virus resistant breeding studies.

SPAD values, as well as sugar- and capsaicin content in different varieties of outdoor peppers

The marketability of the sweet peppers is determined by their quality in Class I, which must also meet the highest standards in terms of the color, shape of the variety and the characteristics of the various flavors. However, the determinants of quality may vary from one pepper type to another. During of our research, we examined the utilization of nitrogen, magnesium and potassium in different types of domestic peppers in the context of the relative chlorophyll content of the foliage and the amount of sugar and total capsaicin in the fruits. We determined that the nutrient solution prepared by Duna-r Ltd. is suitable for achieving the highest sugar and capsaicin content, but their levels can differ significantly. The uptake and utilization of nitrogen, magnesium and potassium of nutrient solution can be checked with the SPAD (Soil Plant Analysis Development) index data of the foliage. We found that there are periods in the phenophase of the pepper cultivars studied when both sugar content and capsaicin content increase significantly. Another major result is that sugar content is a basic determinant of capsaicin content in hot peppers and cherry peppers, while it is not an important factor of capsaicin content for Bogyiszló-type peppers.