Cucurbita Research Articles

As a Squash Plant Grows

Researching and designing Internet infrastructure solutions in rural and tribal contexts requires reciprocal relationships between researchers and community partners. Methodologies must be meaningful amid local social textures of life. Achieving transdisciplinarity while relating research impacts to partner communities takes care work, particularly where technical capacity is scarce. The Full Circle Framework is an action research full stack development methodology that foregrounds reciprocity among researchers, communities, and sovereign Native nations as the axis for research purpose and progress. Applying the framework to deploy television white space infrastructure in sovereign Native nations in northern New Mexico reveals challenges for rural computing, including the need to design projects according to the pace of rural and tribal government workflows, cultivate care as a resource for overworked researchers and community partners, and co-create a demand for accurate government data around Internet infrastructures in Indian Country and through rural counties.

Trichoderma and Phosphite Elicited Distinctive Secondary Metabolite Signatures in Zucchini Squash Plants

Plant biostimulants are “green” solutions to improve crop production. Trichoderma spp. and phosphites, ordinarily used as biocontrol agents, can trigger phytostimulation, also promoting endogenous mechanisms involved in plant growth and development. The present study aimed at assessing the efficacy of a phosphite-based formulation (Phosphit-One) and Trichoderma harzianum-T22 on the morpho-physiological response and modulation of the metabolomics profile in zucchini squash plants (Cucurbita pepo L.) cultivated in controlled growth conditions (Fitotron®). The highest values of fresh biomass production (390.9 g plant−1) and root dry weight (5.6 g plant−1) were obtained for Trichoderma-treated plants. This last treatment resulted in an improved physiological performance (SPAD index, CO2 assimilation rate, and Fv/Fm ratio) measured 30 days after transplanting. Both Trichoderma and phosphite treatments induced a broad metabolic reprogramming in leaves, evident also for the phosphite treatment that did not result in a growth promotion. The microbial and the non-microbial treatments showed distinctive signatures in secondary metabolism yet, common responses could be also highlighted. For instance, both Trichoderma and phosphite triggered ROS-mediated signaling processes, together with the accumulation of phenylpropanoids, glucosinolates, and phytoalexins. Furthermore, a significant alteration of phytohormones was observed, with terpenoid gibberellins and brassinosteroids showing the largest differences. The metabolomic signatures induced by Trichoderma and phosphite in zucchini squash provided molecular insights into the processes underlying elicitation of plant defense due to biostimulation. Interestingly, the modulation of plant secondary metabolism by both treatments did not impair plant growth.

Aphid‐borne viruses infecting cultivated watermelon and squash in Spain: Characterization of a variant of cucurbit aphid‐borne yellows virus (CABYV)

AbstractAphid‐borne viruses are responsible for major cucurbit diseases and hamper the sustainability of crop production. Systematic monitoring can reveal the occurrence and distribution of these viruses, in addition to unadvertised viruses, facilitating the control of diseases. For three consecutive (2018–2020) seasons, the presence of aphid‐borne viruses was monitored from a total of 292 samples of watermelon and squash plants that showed yellowing symptoms in three major cucurbit‐producing areas (Castilla La‐Mancha, Alicante, and Murcia) in Spain. We observed that cucurbit aphid‐borne yellows virus (CABYV) was the most common virus found (29%) in the plants from both crops. Likewise, except for squash samples from Castilla La‐Mancha and Alicante, watermelon mosaic virus (WMV) was also found (23%) with a relatively high frequency. Furthermore, we observed the exacerbation of bright yellowing symptoms in watermelon plants that was often accompanied by considerable fruit abortion. CABYV was the only causative agent for this new yellowing disease, and two infectious cDNA clones (one from watermelon, CABYV‐LP63, and another from melon, CABYV‐MEC12.1) were constructed to further compare and characterize this CABYV disease. Based on the full‐length genome, both isolates were grouped phylogenetically together within the Mediterranean clade. However, the Koch's postulates tests were only successfully completed for the LP63 isolate, which also showed several amino acid changes and two potential recombination events, as compared to MEC12.1. Remarkably, the LP63 isolate caused more severe symptoms and showed higher RNA accumulation than MEC12.1 in five cucurbit plant species. These results suggest that a novel CABYV variant that causes severe yellowing symptoms may be causing outbreaks in cucurbit crops.

Dissipation profile of sulfoxaflor on squash under Egyptian field conditions: a prelude to risk assessment

ABSTRACT The neonicotinoid insecticide sulfoxaflor is widely used in Egypt. This work assessed the safety of using sulfoxaflor in squash to consumers, along with the residue behaviour. Supervised field trials were conducted to investigate the dynamics and terminal residues of sulfoxaflor in squash under Egyptian field conditions for several agricultural practices, including worst-case scenarios. A QuEChERS-based protocol coupled with LC-MS/MS was employed to measure residues in squash fruits; the limit of quantitation was successfully validated at 0.01 mg/kg. Sulfoxaflor residues reduce in squash fruits via a first-order decay process, with a calculated half–life (t1/2) of 6.13 days and significant degradation (88.5%) after 14 days. During harvest, the terminal residues of sulfoxaflor were ranged from 0.365 to 1.611 mg/kg and from 0.576 to 1.865 mg/kg on sampling days of 3, 7 and 14 days when applied 2-3 times at single or double recommended dose, respectively. A consumer risk assessment was performed employing the FAO/WHO approach; the risk quotients (RQs) were ≤0.0102, and hence; no significant health risks associated with consumption of squash treated with sulfoxaflor were identified.

First report of cucurbit chlorotic yellows virus in association with other whitefly-transmitted viruses in squash (Cucurbita pepo) in Georgia.

Viruses transmitted by whiteflies (Bemisia tabaci) cause severe damage to cucurbits in the southern United States. In the fall of 2020, samples of squash plants (Cucurbita pepo) exhibiting symptoms of yellow mottle, interveinal yellowing, and leaf crumple were collected from an insecticide trial in Tifton, Georgia. Total nucleic acid was isolated using the MagMAX 96 Viral RNA Isolation Kit (ThermoFisher Scientific) following the manufacturer's instructions but without DNase treatment. Polymerase chain reaction (PCR) and reverse transcription (RT)-PCR were carried out to determine the presence of whitefly-transmitted viruses. We identified infection by cucurbit chlorotic yellows virus (CCYV) using primers targeting a 953 nt segment of CCYV RNA1 encoding the RNA dependent RNA polymerase gene (RdRp) (CCYV-RDRP-1515F-5'CTCCGAGTAGATCATCCCAAATC3' and CCYV-RDRP-1515R-5'TCACCAGAAACTCCACAATCTC 3') along with other whitefly-transmitted viruses previously reported in Georgia. CCYV was detected from 27 of the 28 samples tested, while cucurbit yellow stunting disorder virus (CYSDV; Polston et al., 2008) and cucurbit leaf crumple virus (CuLCrV; Gadhave et al., 2020) were detected from 23 and 28 squash samples, respectively, with all three viruses regularly occurring as mixed infections. The presence of CCYV was further confirmed by amplification of portions of two different genomic segments from RNA2, including a section of the heat-shock protein (HSP) homolog gene (Bananej et al. 2013) as well as a portion of the coat protein (CP) gene which was amplified using primers CCYV_CPF-5'TCCCGGTGCCAACT GAGACA3' and CCYV_CPR- 5' TACGCGCGGCAGAGGAATTT 3'. The respective 462 bp HSP and 375 bp CP amplicons were cloned and sequenced. The partial coat protein gene sequence (MW251342) was 97.86% identical to a CCYV isolate from Shanghai (KY400633). The partial HSP sequence (MW251341) shared 99.73% identity with the recently identified CCYV isolate from California (MH806868). Criniviruses are an emerging group of whitefly-transmitted viruses responsible for worldwide losses of billions of dollars annually (Tzanetakis et al., 2013). CCYV, a member of the genus Crinivirus, was believed to be restricted to Asia, Africa, and the Mediterranean regions of Europe (Bananej et al., 2013; Orfanidou et al., 2014) until it was recently identified in the Imperial Valley of California (Wintermantel et al., 2019). Southern Georgia has been experiencing high whitefly populations, resulting in the emergence of CuLCrV and CYSDV on vegetables in recent years. Because CCYV can produce symptoms virtually identical to those of CYSDV and occurs in mixed infections in cucurbits with other whitefly-transmitted viruses, its epidemiology, role in disease incidence, severity, and impact on economically important crops in the southeastern United States will require further investigation.

Influence of tomato waste compost ratios on plant growth and fruit quality of cucumber and summer squash

ABSTRACT Peat-moss (Sphagnum spp.), is currently an expensive material and a nonrenewable resource with variable properties. Therefore, its use should be gradually reduced. Hence, there are numerous attempts aiming to reduce the use of peat-moss as a bulk substrate and to search for high-quality, locally available and low-cost alternatives to peat-moss. Therefore, the main objective of this research is to investigate the effect of partial replacing of peat-moss with tomato waste compost (TWC) on plant growth, productivity, fruit quality, and morphological features of two types of economic cucurbits species under greenhouse conditions. The plants were planted into pots containing different proportions of TWC (0%, 5%, 10%, 15%, 20% and 30%) with peat-moss, sand and clay as growing substrates. The results indicated that the plant height and the leaves number of both plants were significantly influenced by different substrate treatments. TWC ratios of 15% and 20% increased the amount of cucumber and summer squash fruit yield more than the commercial peat media but they had insignificant differences. Also, they were significantly improved fruit quality characteristics, particularly total soluble solid (TSS) and titratable acidity (TA) of crop fruits more than commercial peat-moss treatment. Implications: Because of the high price of peat-moss and that it is a non-renewable material, farmers resorted to using other alternatives, including green residue compost. Thus, the aim of this work is to reduce the use of peat-moss by replacing it with the use of lokw percentages of TWC. When tomato plant residues return to the soil by converting them into compost, this is a valuable agricultural practice to improve soil fertility and increase the organic matter of the soil as well as increase the source of nitrogen (N) that supports the growth of beneficial microorganisms.

Fitness and Competitive Ability of Field Isolates of Phytophthora capsici Resistant or Sensitive to Fluopicolide.

Phytophthora blight, caused by Phytophthora capsici, is one of the most destructive diseases in the production of solanaceous and cucurbitaceous vegetable crops. Fluopicolide has been used to control the disease; however, reduced efficacy of the fungicide was observed in Georgia. P. capsici isolates were collected from commercial vegetable fields in Georgia in 2018 and 2019 to determine sensitivity to fluopicolide, which were phenotyped to have 43.1% of the isolates as resistant. The fitness of resistant (R) and sensitive (S) isolates was assessed through mycelial growth and sporulation assays exposed to the fungicide (0 or 50 µg/ml). Fluopicolide did not reduce mycelial growth, sporangial production, and zoospore germination of the R isolates. In the absence of fluopicolide, there was no significant difference between the R and S isolates in sporangial production but mycelial growth and zoospore germination of the R isolates was greater than the S isolates (P = 0.01 and 0.001, respectively). The R isolates had an ability similar to that of the S isolates to induce disease on Aristotle bell pepper, and most of the R and S isolates caused the same level of disease on Paladin. Inoculating squash fruit using different R:S ratios and recovering R and S isolates after five cycles of inoculation resulted in similar trends in changes of R versus S isolate ratios. Overall, it appeared that fitness and competitive ability of the R isolates were not reduced compared with the S isolates. This is the first report of the occurrence of field isolates of P. capsici resistant to fluopicolide in the world. The results have significant implications in providing guidance for growers to avoid or limit use of this fungicide in vegetable production.

Honey bee hives decrease wild bee abundance, species richness, and fruit count on farms regardless of wildflower strips

Pollinator refuges such as wildflower strips are planted on farms with the goals of mitigating wild pollinator declines and promoting crop pollination services. It is unclear, however, whether or how these goals are impacted by managed honey bee (Apis mellifera L.) hives on farms. We examined how wildflower strips and honey bee hives and/or their interaction influence wild bee communities and the fruit count of two pollinator-dependent crops across 21 farms in the Mid-Atlantic U.S. Although wild bee species richness increased with bloom density within wildflower strips, populations did not differ significantly between farms with and without them whereas fruit counts in both crops increased on farms with wildflower strips during one of 2 years. By contrast, wild bee abundance decreased by 48%, species richness by 20%, and strawberry fruit count by 18% across all farm with honey bee hives regardless of wildflower strip presence, and winter squash fruit count was consistently lower on farms with wildflower strips with hives as well. This work demonstrates that honey bee hives could detrimentally affect fruit count and wild bee populations on farms, and that benefits conferred by wildflower strips might not offset these negative impacts. Keeping honey bee hives on farms with wildflower strips could reduce conservation and pollination services.

Antifungal activity in winter squash fruit peel in relation to age related resistance to Phytophthora capsici

Age-related resistance (ARR), or ontogenic resistance, is associated with host developmental stages. Winter squash fruit (Cucurbita moschata) develops resistance to the oomycete plant pathogen, Phytophthora capsici, as they mature. ARR in winter squash to P. capsici could be exploited to assist growers in limiting crop loss due to fruit rot. The objective of this study was to determine whether preformed or pathogen-induced antifungal activity during fruit development is correlated with ARR. We examined fruit peel methanol/ethanol extracts of three cultivars of C. moschata at different developmental stages with and without P. capsici inoculation. Results indicated the presence of compounds with antifungal activity in all fruit ages tested, but the antifungal activity decreased with age indicating a lack of association between preformed antifungal activity and ARR in winter squash. In addition, no significant change was detected in the antifungal activity among fruit ages that were inoculated with P. capsici and examined at different times post inoculation, suggesting no association between the induced antifungal activity and ARR in winter squash.

Effect of Foliar Application with some Organic Acids on Growth and Productivity of summer squash Plants (Cucurbita pepo L.)

Effect of Foliar Application with some Organic Acids on Growth and Productivity of summer squash Plants (Cucurbita pepo L.)

Nematicidal Properties of Some Yeast Culture Filtrates against Meloidogyne javanica Infecting Squash Plants (In Vitro and In Vivo)

Nematicidal Properties of Some Yeast Culture Filtrates against Meloidogyne javanica Infecting Squash Plants (In Vitro and In Vivo)

Physiological Responses of Squash (Cucurbita pepo L.) to Humic Acid Treatment under NaCl Stress Conditions

Squash plants (Cucurbita pepo L. cv. Alexandria F1) were subjected to different levels of humus as source of humic acid (HA) and NaCl as source of salinity with irrigation to investigate the effect of HA on growth and physiological processes under salinity condition. Three levels of HA: 0, 200 and 400 ppm were used with four levels of salinity: 500 (fresh water), 1000, 2000 and 3000 ppm were prepared by adding 0, 500, 1500 and 2500 ppm of NaCl in fresh water. Fresh weight (FWL), dry weight (DWL), specific leaf weight (SLW), midday water content (WC) and relative water content (RWC) of leaves were measured for each treatment at the end of experimentation. Leaf contents of nitrogen (N), phosphorus (P), potassium (K+), sodium (Na+) and chloride (Cl−), as well as percentage of protein and content of chlorophyll a, b and total in leaves were determined. The treatment with HA at a concentration of 400 ppm led to maintaining the FWL and DWL, also prevented the decrease in WC of the leaves under the condition of NaCl stress. While there was no apparent effect of treatments on the values of the SLW and RWC. HA reduced the negative effect of salinity on the leaf content of N and P, whereas increasing the content of K+ and K:Na ratio. HA has maintained the concentration of Na+ ions, and there was a noticeable increase in the leaf content of Cl- ions with an increase in the applied NaCl concentration, without any effect of HA treatment reported in this regard. HA led to enhance the severity of NaCl reduced effect on leaf content of chlorophyll a, b and the total and percentage of protein. HA has increased the ability of squash to maintain the WC percentage and improving the nutrients uptake as well as stopped the increase in Na+ ions in the plant tissue. On the other hand, HA treatment was unsuccessful in preventing the increase in Cl-, consequence a decrease in the content of chlorophyll and protein in leaf tissue has been registered, thus there will be a general reduction in overall growth and development of the plant.

Estudio de dieta en poblaciones arqueológicas del centro de Argentina a través del análisis de microrrestos vegetales e isótopos estables

Se presentan los resultados obtenidos a partir del análisis de isótopos estables (δ13Ccol y δ15N) y de los microrrestos vegetales hallados en el cálculo dental de 43 individuos adultos (28 masculinos – 15 femeninos) y un individuo juvenil (masculino), datados por AMS entre 387 ± 41 y 4058 ± 89 14C años AP, con el objetivo de abordar, desde una perspectiva bioarqueológica, el estudio de la dieta de los grupos humanos que ocuparon la región central del país. Los individuos provienen de 22 sitios arqueológicos, ubicados en dos regiones geográficas diferentes de la provincia de Córdoba: Sierras y Llanuras. Las prevalencias se calcularon considerando sexo, cronología y procedencia geográfica de cada individuo. Los resultados sugieren el consumo principalmente de plantas silvestres con patrón fotosintético C3, tales como Prosopis sp., Geoffroea decorticans y Trithrinax campestris a lo largo de todo el Holoceno tardío, y la incorporación de recursos vegetales cultivados de tipo C4, como Zea mays, y C3 como Phaseolus sp. a partir de los 1192 ± 40 14C años AP en la región Llanuras, con la posterior incorporación de Cucurbita sp. y Solanum tuberosum, ambos con patrón fotosintético C3, hacia los 954 ± 85 14C años AP exclusivamente en Sierras.

Preliminary Evaluation of a Granite Rock Dust Product for Pest Herbivore Management in Field Conditions

Simple SummaryRock dusts, including granite rock dust, are a rich source of silicon, one of the most abundant elements in the earth’s crust. Silicon exerts repellent, insecticidal and anti-ovipositional activities against agricultural pests. When accumulated on plant tissue, it can also form a mechanical barrier that increases resistance to pest attack. In the present work, we examined the effect of granite dust in managing herbivores under field conditions, evaluating the repellent and insecticidal activity against pests in lily, cabbage, and squash plants. Rock dust provided significant protection against specialist lily leaf beetles but was not effective in reducing general herbivore damage to field-grown cabbage and squash plants. Interestingly, rock dust also improved squash plant yield, increasing fruit size 2.5-fold. Overall, these results suggest granite as a beneficial alternative to synthetic pesticides with potential to manage pest herbivores, and to boost plant health.The effects of granite rock dust in dry and aqueous formulations were evaluated under field conditions for control of insect pests in different crop systems and ornamental plants. We tested efficacy of crop protection following foliar applications on lily, squash, and cabbage plants by evaluating subsequent pest damage, overall plant health, and quantity of crops produced over one season. Lily plants treated with dry and aqueous formulations of rock dust were subject to lower herbivore damage (>1% and 11% herbivory damage, respectively) when compared to the controls (30% herbivory damage). Treatment on cabbage was less effective to protect plants against herbivory damage, and no statistically significant differences were reported within treatments. The foliar applications (dry and aqueous formulations) had positive impacts on growth of squash fruit resulting in a 2.5-fold increase in size relative to the control squash fruit. These results support the potential field application of granite dust to protect ornamental plants against herbivory attack, and reveal an alternative positive effect of the silica-based product on plant growth and development.

Survey of The Main Pests Infesting Squash Plants and Its Relation with The Planting Dates at Assiut Governorate

Field experiments were conducted in Assiut Governorate during two successive seasons 2018 and 2019; to survey the phytophagous pests inhabiting squash plants, in addition, to study the relationship between the main pests namely; melon aphid, Aphis gossypii (Glover); whitefly, Bemisia tabaci (Genn.); two-spotted spider mite, Tetranychus urticae Koch; Onion thrips, Trhips tabaci (Lind.) and green leafhopper, Empoasca decipiens (Paoli) and its infestation of the winter, summer and nili squash plantations during 2018 and 2019 growing seasons. The results revealed clearly twenty species of phytophagous pests belonging to twelve families and seven orders inhibiting winter, summer, and nili squash plantations were encountered by using the plant samples method. Data also, revealed that the summer squash plantation received a higher average number with the aforementioned main pests, followed by nili and winter squash plantations; also, the whitefly, B. tabaci ranked first in the highest average number of individuals followed by a two-spotted spider mite, T. urticae; green leafhopper, E. decipiens; melon aphid, A. gossypii, and onion thrips, T. tabaci infestation to winter, summer and nili squash plantations during 2018 and 2019 growing seasons. It can be concluded that severe injury of the main pests; A. gossypii, B. tabaci, T. urticae, T. tabaci and E. decipiens to the squash plants can be avoided by using the winter plantation date followed by nili and summer plantation dates.

Response of Squash Plants (Cucurbita pepo L.) to Foliar Spray with Methylotrophic Bacteria, Methanol and their Combination under Protected Cultivation

Two field experiments were carried out during the two successive seasons of 2017/2018 and 2018/2019 at the experimental Farm at Kaha Vegetable Research Farm, El-Kaluobia Governorate Horticulture Research Institute, Agriculture Research Center (ARC), Egypt, under greenhouse. The study aimed to investigate the response of squash to foliar spray with methylotrophic bacteria (10 cm3/l), methanol (20%) and the combination between the them addition to the control treatment on vegetative growth, productivity and chemical composition of Pera squash cultivar. A complete randomized block design with three replicates was used. The foliar spray treatments were carried out six times during the growing seasons. The first spray was followed after 20 days after transplanting, then others were applied each two weeks. The obtained results indicated that, foliar spraying of the plants with methylotrophic bacteria plus methanol reflected the greatest values of vegetative growth, fruit yield and its components as well as the physical fruit quality.

Analysis of Nutritional Components and Physiological Activity of Butternut Squash (Cucurbita moschata) by Drying Methods

Analysis of Nutritional Components and Physiological Activity of Butternut Squash (Cucurbita moschata) by Drying Methods

Evaluation of fluazaindolizine, a new nematicide for management of Meloidogyne incognita in squash in calcareous soils

The southern root-knot nematode (Meloidogyne incognita) is one of the major problems affecting squash production in Florida and worldwide. Calcareous soils exist in south Florida, and squash in Miami-Dade County is grown in this type of soil. Environmentally friendly and low-toxic non-fumigant nematicides for managing M. incognita are urgently needed. Fluazaindolizine is a new compound that has been evaluated on vegetable crops and proven to be a highly effective non-fumigant nematicide. However, its efficacy against M. incognita in squash and its effect on squash fruit yield in calcareous soils are not documented. Field trials were conducted in 2019 and 2020 to evaluate the effect of fluazaindolizine on root galling and populations of M. incognita in the soil, plant vigor, and fruit yield of squash grown in calcareous soils in south Florida. In both field experiments, all treatments containing fluazaindolizine significantly (p < 0.05) reduced root galling index of squash caused by M. incognita, compared to the untreated control. Fluazaindolizine at 2.24 L/ha (FI 2x) applied at seeding and fluazaindolizine at 1.12 L/ha applied at seeding and again 14 days after seeding (FI 1x + FI 1x) was most effective in reducing root galling index. M. incognita populations were consistently significantly (p < 0.05) reduced by FI 1x + FI 1x in both trials, compared to the untreated control (1054 and 3344 per 100 mL of soil, respectively) with a suppression of 58.4% and 63.6%, respectively. In the 2019 experiment 1, all treatments significantly (p < 0.05) increased squash plant vigor and yield of fruit (except F1 x). In the 2020 experiment 2, there were no significant differences in squash plant vigor and yield between treatments and the untreated control. Results from the field trials indicated that fluazaindolizine was an effective non-fumigant nematicide that could aid in management of M. incognita in squash in calcareous soils of south Florida.

Influence of Trap Crops on Tomato and Squash Insect Pests

Influence of Trap Crops on Tomato and Squash Insect Pests

Mycorrhizae can support squash plant growth in Phosphorus deficient calcareous soil

This work was aimed to select the proper Arbuscular Mycorrhizal (AM) inocula strain to enhance the growth of squash plants in calcareous P-deficient soil. Three treatments of phosphorus fertilizer of calcium triple phosphate, 15.5% P2O5 were tested at different rates. In parallel, pots were inoculated with 4 AM strains (Rhizoglomus irregulare) namely M49; M139; M301 and M 510. Treatments were repeated 5 times and arranged in the greenhouse in a randomized completely block design (RCBD) and plants were harvested after 57 days. In conclusion, from the results and under the same conditions of this experiment, we recommended that all mycorrhizal strains were effective in improving plant growth. The strain M301 enhanced squash plants growth and P uptake. Also, inoculation with this strain could improve P availability in soil. The two mycorrhizal strains (M49 and M139) can be used for improving the growth of squash plants under low P level and in calcareous soil conditions. This study is one of the few studies that indicate the specialization of mycorrhizal fungi strains on the host plant and this study must be followed by many other studies in different climatic conditions, different soil properties and on different genus and strains of AM fungi on different plants family to confirm or deny this hypothesis.