Cucumber Chloroplast Research Articles

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCA-DAGCGCAψUUGUUUUGGNψFACAAAAUmsu7GUCACGGGTψCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNAPro (UGG), the other two known plant organellar tRNAsPro.

N,N'-Dibutylurea from n-Butyl Isocyanate, a Degradation Product of Benomyl. 2. Effects on Plant Growth and Physiology

Experiments were conducted to determine the effects of N,N'-dibutylurea (DBU) on plants. DBU is a product of the reaction between water and n-butyl isocyanate, which is in turn an elimination product of methyl 1-(butylcarbamoyl)-2-benzimidazole (the fungicide benomyl). Corn was unaffected by DBU regardless of rate or time of application. DBU did not affect respiration by hydrilla, seed germination, or seedling emergence of cucumber. At a rate of 2.8 kg ha -1 , DBU reduced cucumber root and shoot biomass between 59 and 63%, regardless of time of application. DBU caused dilation of grana and irregularities in the lamellae of cucumber chloroplasts and completely inhibited photosynthesis (measured as decreased oxygen evolution) of hydrilla after 1 h of expoure

On protochlorophyllide as the photoreceptor responsible for resumption of its own synthesis in etiolated cucumber cotyledons

A 30-s or 60-s pulse of red or blue light given to intact etiolated cucumber cotyledons triggers the resumption of protochlorophyllide (Pchlide) accumulation under redarkening. Simultaneous far red irradiation displays no influence on the effect of red light if the rates of Pchlide accumulation are determined shortly after the lag phase of this process. There is a linear correlation between the rate of Pchlide accumulation and the degree of Pchlide phototransformation in intact etiolated cotyledons under light of various wavelengths. This indicates that the cessation of Pchlide accumulation in darkness is due to feedback inhibition of its synthesis. Comparison of the data obtained with the results from the literature on ALA synthesis in isolated cucumber chloroplasts showed that the state of control of Pchlide synthesis, which arises in cotyledons, is maintained in the isolated chloroplasts. It is suggested that feedback inhibition is a ubiquitous principle of chlorophyll biosynthesis regulation.

In vitro assay of the chlorophyll biosynthetic enzyme Mg-chelatase: resolution of the activity into soluble and membrane-bound fractions.

The first committed step in chlorophyll synthesis is the Mg-chelatase-catalyzed insertion of magnesium into protoporphyrin IX. Since iron insertion into protoporphyrin leads to heme formation, Mg-chelastase lies at the branch point of heme and chlorophyll synthesis in chloroplasts. Little is known about the enzymology or regulation of Mg-chelatase, as it has been assayed only in intact cucumber chloroplasts. In this report we describe an in vitro assay for Mg-chelatase. Mg-chelatase activity in intact pea chloroplasts was 3- to 4-fold higher than in cucumber chloroplasts. This activity survived chloroplast lysis and could be fractionated by centrifugation into supernatant and pellet components. Both of these fractions were required to reconstitute Mg-chelatase activity, and both were inactivated by boiling indicating that the enzyme is composed of soluble and membrane-bound protein(s). The product of the reaction was confirmed fluorometrically as the magnesium chelate of the porphyrin substrate. The specific activity of the reconstituted system was typically 1 nmol of Mg-deuteroporphyrin per h per mg of protein, and activity was linear for at least 60 min under our assay conditions. ATP and magnesium were required for Mg-chelatase activity and the enzyme was sensitive to the sulfhydryl reagent N-ethylmaleimide (I50, 20 microM). Broken and reconstituted cucumber chloroplasts were unable to maintain Mg-chelatase activity. However, the cucumber supernatant fraction was active when combined with the pellet fraction of peas; the converse was not true, which suggested that the cucumber pellet was the component that lost activity during lysis.

Further Characterization of the Magnesium Chelatase in Isolated Developing Cucumber Chloroplasts

Mg-chelatase catalyzes the first step unique to the chlorophyll branch of tetrapyrrole biosynthesis, namely the insertion of Mg into protoporphyrin IX (Proto). Mg-chelatase was assayed in intact chloroplasts from semi-green cucumber (Cucumis sativus, cv Sumter) cotyledons. In the presence of Proto and MgATP, enzyme activity was linear for 50 minutes. Plastid intactness was directly related to (and necessary for) Mg-chelatase activity. Uncouplers and ionophores did not inhibit Mg-Chelatase in the presence of ATP. The nonhydrolyzable ATP analogs, beta,gamma-methylene ATP and adenylylimidodiphosphate, could not sustain Mg-chelatase activity alone and were inhibitory in the presence of ATP (I(50) 10 and 3 millimolar, respectively). Mg-chelatase was also inhibited by N-ethylmaleimide (I(50), 50 micromolar) and the metal ion chelators 2,2'-dipyridyl and 1, 10 phenanthroline (but not to the same degree by their nonchelating analogs). In addition to Proto, the following porphyrins acted as Mg-chelatase substrates, giving comparable specific activities: deuteroporphyrin, mesoporphyrin, 2-ethyl, 4-vinyl Proto and 2-vinyl, 4-ethyl Proto. Mg-chelatase activity and freely exchangeable heme levels increased steadily with greening, reaching a maximum and leveling off after 15 hours in the light. Exogenous protochlorophyllide, chlorophyllide, heme, and Mg-Proto had no measurable effect on Mg-chelatase activity. The potent ferrochelatase inhibitors, N-methylmesoporphyrin and N-methylprotoporphyrin, inhibited Mg-chelatase at micromolar concentrations.

Regulation of 5-Aminolevulinic Acid (ALA) Synthesis in Developing Chloroplasts

Gabaculine and 4-amino-5-hexynoic acid (AHA) up to 3.0 millimolar concentration strongly inhibited 5-aminolevulinic acid (ALA) synthesis in developing cucumber (Cucumis sativus L. var Beit Alpha) chloroplasts, while they hardly affected protochlorophyllide (Pchlide) synthesis. Exogenous protoheme up to 1.0 micromolar had a similar effect. Exogenous glutathione also exhibited a strong inhibitory effect on ALA synthesis in organello but hardly inhibited Pchlide synthesis. Pchlide synthesis in organello was highly sensitive to inhibition by levulinic acid, both in the presence and in the absence of gabaculine, indicating that the Pchlide was indeed formed from precursor(s) before the ALA dehydratase step. The synthesis of Pchlide in the presence of saturating concentrations of glutamate was stimulated by exogenous ALA, confirming that Pchlide synthesis was limited at the formation of ALA. The gabaculine inhibition of ALA accumulation occurred whether levulinic acid or 4,6-dioxohepatonic acid was used in the ALA assay system. ALA overproduction was also observed in the absence of added glutamate and was noticeable after 10-minute incubation. These observations suggest that although Pchlide synthesis in organello is limited by ALA formation, it does not utilize all the ALA that is made in the in organello assay system. Gabaculine, AHA, and probably also protoheme, inhibit preferentially the formation of that portion of ALA that is not destined for Pchlide. A model proposing a heterogenous ALA pool is described.

Inhibition of Chloroplast-Mediated Reactions by Quizalofop Herbicide

A mechanism of action of the ethyl ester of quizalofop was determined in monocotyledonous and dicotyledonous plants. Quizalofop inhibited electron transport in both cucumber and corn chloroplasts. In corn, inhibition of electron transport was more pronounced under phosphorylating conditions. Half-maximal inhibition (I50) of ATP synthesis was achieved with a 75-μM concentration of quizalofop in coupled corn chloroplasts. Cucumber chloroplast ATP synthesis was not inhibited at herbicide concentrations up to 100 μM. Corn chloroplast fractions contained greater quantities of bound [U-14C] quizalofop ester following incubation in light and dark assays. Thin-layer radiochromatograms of14C-labeled quizalofop showed no metabolism or degradation of parent ester incubated in light and dark chloroplast-mediated reactions. In our studies, it is apparent that the inhibitory action of quizalofop was due to the parent ester. The ester formulation of quizalofop appears to exhibit multiple activity in susceptible plant chloroplasts.

Chilling-Enhanced Photooxidation

Chilling-induced photooxidation was studied in detached leaves of chilling-sensitive (CS) cucumber (Cucumis sativus L.) and chilling resistant (CR) pea (Pisum sativum L.). The rates of photosynthesis and respiration, measured as O(2) exchange, were found to be comparable in the two species over a temperature range of 5 to 35 degrees C. Chilling at 5 degrees C for 12 hours in high light (1000 microeinsteins per square meter per second) decreased CO(2) uptake 75% in detached pea leaves whereas CO(2) uptake by cucumber was reduced to zero within 2 hours. Respiration was unaffected in either species by the chilling and light treatment. Although ultrastructural alterations were apparent in chloroplasts of both species, cucumber's were affected sooner and more severely. The mechanism of photooxidative lipid peroxidation was investigated by following the production of ethane gas under a variety of conditions. Maximum ethane production occurred in the CS cucumber at low temperature (5 degrees C) and high light (1000 microeinsteins per square meter per second). Atrazine, an inhibitor of photosynthetic electron transport, almost completely halted this chilling- and light-induced ethane production. These data, taken with those reported in an accompanying article (RR Wise, AW Naylor 1986 Plant Physiol 83: 278-282) suggest that the superoxide anion radical is generated in cucumber chloroplasts (probably via a Mehler-type reaction) during chilling-enhanced photooxidation. Parallel experiments were conducted on pea, a CR species. Detached pea leaves could only be made to generate ethane in the cold and light if they were pretreated with the herbicide parquat, a known effector of O(2) (-) production. Even so, pea showed no lipid peroxidation for 6 hours, at which time ethane production began and was at a rate equal to that for the chilled and irradiated cucumber leaves. The results indicate that pea has an endogenous mechanism(s) for the removal of toxic oxygen species prior to lipid peroxidation. This mechanism breaks down in pea after 6 hours in the cold, light, and the presence of paraquat.

A Comparison of the Effects of ABA and an Antitranspirant on Chilling Injury of Coleus, Cucumbers, and Dieffenbachia

Abstract Coleus blumei Benth ‘Buckley Supreme’, Cucumis sativus L. ‘Victory’, and Dieffenbachia picta Schott ‘Rudolph Roehrs’ plants were exposed to 5°C for 48 and 72 hr following pretreatment with abscisic acid (ABA) or an antitranspirant (ENVY). Foliar injury of untreated leaves occurred after 48 hr of exposure at 5°. Application of 200 mg.liter−1 ABA as a foliar spray provided protection against chilling symptoms in coleus and cucumber, but foliar application of ENVY had no protective effect. Dieffenbachia was not protected by either ABA or ENVY. Measurements of refreshed delayed light emission (RDLE) from excited chlorophyll molecules in intact leaves confirmed that ABA protected chilled cucumber chloroplasts; however, there was no difference between ABA-treated and untreated chilled dieffenbachia. Chemical names used: [S-(Z,E)]-5-(l-hydroxy-2,6,6-trimethyl-4-oxo-2-cyclohexen-l-yl)-3-methyl-2,4-pentadienoic acid [abscisic acid (ABA)].

Localization of Mg-Chelatase and Mg-Protoporphyrin IX Monomethyl Ester (Oxidative) Cyclase Activities within Isolated, Developing Cucumber Chloroplasts

Magnesium chelatase and magnesium protoporphyrin IX monomethyl ester (oxidative) cyclase activities were both sensitive to inhibition by p-chloromercuribenzoate in intact, developing cucumber (Cucumis sativus L. var Beit Alpha) chloroplasts. Magnesium chelatase was also sensitive to the membrane-impermeable mercurial p-chloromercuribenzene sulfonate (PCMBS), while cyclase activity was only slightly sensitive. When the plastids were pretreated with PCMBS, triosephosphate dehydrogenase activity was inhibited very slightly, indicating that PCMBS does not readily penetrate through the chloroplast envelope. These results suggest that magnesium chelatase is located in the chloroplast envelope, while the cyclase is located deeper within the chloroplast.

Resolution and Reconstitution of Mg-Protoporphyrin IX Monomethyl Ester (Oxidative) Cyclase, the Enzyme System Responsible for the Formation of the Chlorophyll Isocyclic Ring

Mg-protoporphyrin IX monomethyl ester (oxidative) cyclase, the system responsible for the formation of the chlorophyll isocyclic ring in developing cucumber (Cucumis sativus L. cv Beit Alpha) chloroplasts, was resolved into two enzymic components: a high-speed supernatant and a membrane pellet. This reconstituted enzyme system required reduced pyridine nucleotide for activity.

Synthetic deoxyoligonucleotides as general probes for chloroplast transfer RNA genes.

The utility of chemically synthesized deoxyoligonucleotides as hybridization probes for the detection of tRNA genes has been examined. Chloroplast tRNA genes were chosen for this study. Deoxyoligonucleotides complementary to highly conserved regions of chloroplast tRNA genes of both higher plants and Euglena gracilis were chemically synthesized. These synthetic probes have been used to detect tRNA genes by Southern hybridizations to restriction fragments of chloroplast DNAs. This new method of tRNA gene mapping and the oligonucleotides synthesized may be of general application to many chloroplast genomes. This is illustrated by the detection of known and unknown tRNA genes of Euglena gracilis and spinach, and unknown tRNA genes of maize and cucumber chloroplast DNAs. The precise locus and polarity of the Euglena gracilis chloroplast tRNAPhe gene has been determined. We also describe experiments which relate to the effects of the time of hybridization, the stringency of washing, and of base pair mismatches on the hybridization signal.