CT Method Research Articles

Aspirin attenuates the expression of adhesion molecules, risk of obesity, and adipose tissue inflammation in high-fat diet-induced obese mice

The prevalence of obesity is increasing at an alarming rate and keeps on being one of the significant challenges of this century. Obesity promotes adipose tissue hypertrophy and causes the release of different pro-inflammatory cytokines, playing a significant role in the pathophysiology of metabolic syndrome. Aspirin is known as a potent anti-inflammatory drug, but its role in adipogenesis, adipocyte-specific inflammation, and metabolic syndrome is not well characterized. Thus, in this experiment, we aimed to determine the effect of low-dose aspirin on obesity, obesity-induced inflammation, and metabolic syndrome. High-fat diet-induced obese female mice (Swiss Albino) were used in our study. Mice were fed on a normal diet, a high-fat diet, and a low dose of aspirin (LDA) in the presence of a high-fat diet for 11 weeks. Body weight, lipid profile, adipose tissue size, and inflammatory status were analyzed after that period. The ∆∆CT method was used to calculate the relative mRNA expression of target genes. Treatment with a low dose of aspirin resulted in a significant reduction of body weight, visceral fat mass and serum total cholesterols, serum and adipose tissue triglycerides, and blood glucose levels in high-fat diet-induced obese mice compared to the untreated obese group. Consistent with these biochemical results, a significant reduction in mRNA expression of different genes like PPARγ, GLUT4, IL-6, TNFα, MCP-1, ICAM-I, and VCAM-I associated with adipogenesis and inflammation were noticed. Overall, current study findings indicate that low-dose aspirin reduces obesity, hyperlipidemia, adipocyte-specific inflammation, and metabolic syndrome in high-fat diet-induced obese mice.

Effects of swine microRNA mimics on lipopolysaccharide (LPS) induced inflammatory changes in 3D4/21 cells

There have been limited studies focused on validation of swine microRNAs (miRNA) with mRNA targets. The objective of this study was to validate a defined set of targets using artificial miRNA mimics transfected into cell lines to confirm specific targets of endogenous miRNAs after administration of Escherichia coli lipopolysaccharide (LPS). Sixteen hours after mimic transfection of 3D4/21 cell lines, the cells were stimulated with 1 μg/ml LPS or phosphate-buffered saline (PBS). The cells were harvested and collected at 0, 1, 3, and 8 h post administration. The selected genes DAD1, IL8, and ESR, which are involved in known pathways of inflammation. and are predicted or validated human targets of either miR-146a, let-7a, or miR-22-3p. These were then evaluated by quantitative real-time-PCR (qRT-PCR) to verify microRNA-mRNA interaction in swine. Using the ROX reference dye, mRNA changes in expression were assessed using the comparative CT Method (ΔΔCT method) for normalization against the PBS control group. DAD1 and ESR1 were negatively regulated by miR-22-3p and miR-146a-5p, respectively in 3D4/21 cells after LPS stimulation. However, miR-146a-5p may play an indirect positive regulatory role of both DAD1 and IL8 mRNA expression. Furthermore, we found an inverse relationship between LPS stimulation compared with the let-7a-5p overexpression with DAD1. Our inflammation study provides new evidence on the roles and predicted targets of miR-146a, let-7a, and miR-22-3p in swine.

488 Novel Method Of Deriving Aortic Valve Calcium Score From Contrast Enhanced Computed - Tomography Angiography: Validation And Gender Specific Implication

Introduction: Aortic valve calcium (AVC) score assessed by non contrast computed tomography (NC CT) is a clinical method currently used to define aortic stenosis (AS) severity. AVC assessment on contrast enhanced CT (CE CT) can be helpful when studies are done for other indications. The aim of this study is to validate our previously described method of CE CT based AVC and assess gender specific differences.

Gossypin'in farklı kanser hücre dizilerinde HSP60 ve HSP70'in gen ekspresyonu üzerindeki etkisi

Purpose: The aim of this study is to evaluate the impact of gossypin on the expression level of heat shock proteins (HSPs) genes in different cancer cells.
 Materials and Methods: Cells were grown under standard culture conditions. Cancer cells were treated with different concentrations (5-100 µg/ml) of gossypin and cisplatin (50 µM) as positive control. Cell viability and effective dose range (5-100 µg/ml) of gossypin were determined by MTT at 24, 48 and 72 hours. After RNA isolation and cDNA synthesis, HSP60 and HSP70 gene expression levels were analyzed using RT-PCR. For gene expression analysis, the 2-∆∆ct method was used.
 Results: According to the MTT results, 25-50-100 µg/ml of gossypin doses were found effective on HSP60 and HSP70 gene expression levels in the cancer cell lines. Gossypin affected with dose-dependently the expression of HSP60 and HSP70 in the three cell lines. In the three cell lines, 50 µg/ml and 100 µg/ml of gossypin doses significantly reduced the expression of HSP60 and HSP70 compared to control group.
 Conclusion: Our results strongly supported the anticarcinogenic effect of gossypin at various doses in different cell lines. However, we believe that further in vivo research and human studies are needed. Our findings suggest that gossypin could be suitable candidate agent for further investigation to develop new strategies for the prevention and/or treatment of different cancer types.

Multi-Scale Mixed Attention Network for CT and MRI Image Fusion.

Recently, the rapid development of the Internet of Things has contributed to the generation of telemedicine. However, online diagnoses by doctors require the analyses of multiple multi-modal medical images, which are inconvenient and inefficient. Multi-modal medical image fusion is proposed to solve this problem. Due to its outstanding feature extraction and representation capabilities, convolutional neural networks (CNNs) have been widely used in medical image fusion. However, most existing CNN-based medical image fusion methods calculate their weight maps by a simple weighted average strategy, which weakens the quality of fused images due to the effect of inessential information. In this paper, we propose a CNN-based CT and MRI image fusion method (MMAN), which adopts a visual saliency-based strategy to preserve more useful information. Firstly, a multi-scale mixed attention block is designed to extract features. This block can gather more helpful information and refine the extracted features both in the channel and spatial levels. Then, a visual saliency-based fusion strategy is used to fuse the feature maps. Finally, the fused image can be obtained via reconstruction blocks. The experimental results of our method preserve more textual details, clearer edge information and higher contrast when compared to other state-of-the-art methods.

Abstract 1414: Assessment of the Cancer Testis antigen AKAP4, via tumor expression analysis and IHC, as a potential vaccine and immunotherapy target for colorectal cancer

Abstract Introduction: Cancer-Testis antigens (CTA’s) are normally expressed in germline tissue, however, aberrant expression occurs in some cancers. Restricted CTA expression in normal tissues make CTA’s potential vaccine targets. CTA’s have been associated with tumor cell proliferation and invasion. The CTA A-kinase anchor proteins 4 (AKAP 4) plays a role in cancer development and progression. The expression pattern of AKAP4 gene in CRC is not well characterized. This study’s aim was to assess AKAP4 expression in CRC and to assess this CTA’s potential as a vaccine target. Methods: CRC patients (pts) undergoing surgery who donated tissue to an IRB approved tissue/data bank comprise the study group. Demographic and pathologic data were assessed. Tissues were OCT embedded and stored at -800C. Total purified RNA was isolated from tissue samples and cDNA synthesized. AKAP4 expression was analyzed by quantitative PCR (QPCR) using EXPRESS qPCR universal Supermix and Taqman assay. Comparative quantitative analysis was performed based on the delta-delta Ct method with GAPDH as internal control. Tumor and testis AKAP4 expression levels were determined; tumors with levels 0.1% or more than the testis was considered positive. Immunohistochemistry (IHC) was performed on a subset of tumor and normal tissue. The impact of tumor location and cancer stage on AKAP4 expression was determined and assessed (Wilcoxon signed rank test). Results: 70 paired CRC and normal tissue specimens (35 M/36 F, age 67.8±14) were studied (86% colon,14% rectal; cancer stage: 1, 24%; 2,37%; 3, 31.%;stg 4, 7%). The percent of pts with a relative Malignant to Normal tissue AKAP4 expression ratio (MN) over 1 was 17%; the percent with both MN ratio over 1 and expression levels above 0.1% of testis levels was 16%. IHC demonstrated AKAP4 in a subset of CRC tumor samples. No significant difference was noted between colon vs rectal, or cancer stage groups. No expression was found in 21 normal samples. Discussion: In a tumor subset the relative expression of AKAP4 was above that of normal colon and more than 0.1% of testis expression. IHC study demonstrated the antigen in CRC tumors. A larger study is needed determine if AKAP4 expression correlates with T, N, or final tumor stage. AKAP4 holds some promise as a vaccine target. Citation Format: Chandana S. K. Herath Mudiyanselage, Neil Mitra, Otavia L. Caballero, Dasuni N. Gamage, Xiaohong Yan, Vesna Cekic, Joseph Martz, Richard L. Whelan. Assessment of the Cancer Testis antigen AKAP4, via tumor expression analysis and IHC, as a potential vaccine and immunotherapy target for colorectal cancer [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2022; 2022 Apr 8-13. Philadelphia (PA): AACR; Cancer Res 2022;82(12_Suppl):Abstract nr 1414.

Selection and Validation of Reference Genes for Pan-Cancer in Platelets Based on RNA-Sequence Data.

Many studies in recent years have demonstrated that some messenger RNA (mRNA) in platelets can be used as biomarkers for the diagnosis of pan-cancer. The quantitative real-time polymerase chain reaction (RT-qPCR) molecular technique is most commonly used to determine mRNA expression changes in platelets. Accurate and reliable relative RT-qPCR is highly dependent on reliable reference genes. However, there is no study to validate the reference gene in platelets for pan-cancer. Given that the expression of some commonly used reference genes is altered in certain conditions, selecting and verifying the most suitable reference gene for pan-cancer in platelets is necessary to diagnose early stage cancer. This study performed bioinformatics and functional analysis from the RNA-seq of platelets data set (GSE68086). We generated 95 candidate reference genes after the primary bioinformatics step. Seven reference genes (YWHAZ, GNAS, GAPDH, OAZ1, PTMA, B2M, and ACTB) were screened out among the 95 candidate reference genes from the data set of the platelets’ transcriptome of pan-cancer and 73 commonly known reference genes. These candidate reference genes were verified by another platelets expression data set (GSE89843). Then, we used RT-qPCR to confirm the expression levels of these seven genes in pan-cancer patients and healthy individuals. These RT-qPCR results were analyzed using the internal stability analysis software programs (the comparative Delta CT method, geNorm, NormFinder, and BestKeeper) to rank the candidate genes in the order of decreasing stability. By contrast, the GAPDH gene was stably and constitutively expressed at high levels in all the tested samples. Therefore, GAPDH was recommended as the most suitable reference gene for platelet transcript analysis. In conclusion, our result may play an essential part in establishing a molecular diagnostic platform based on the platelets to diagnose pan-cancer.

Serum miR-21 predicts the prognosis of patients with primary gastrointestinal diffuse large B-cell lymphoma.

Primary gastrointestinal diffuse large B-cell lymphoma (PGI-DLBCL) lacks specific clinical manifestations and its malignancy renders prognostication and choice of treatment strategy difficult. The aim of this study was to evaluate microRNA (miR)-21 as potential non-invasive biomarkers for prognosis in PGI-DLBCL patients. Serum miR-21 expression in de novo PGI-DLBCL patients, consecutively enrolled for this study, was detected by quantitative real-time polymerase chain reaction (qRT-PCR). Relative expression was calculated using the comparative Ct method. Statistical significance was determined using the Mann-Whitney rank sum and Fisher's exact test. Survival analysis was conducted using the Kaplan-Meier method. Compared with healthy controls, serum miR-21 levels were significantly elevated in the PGI-DLBCL patients (n=156). The high expression level of serum miR-21 at diagnosis was associated with worse progression-free survival (PFS) (30 (9-42) vs 42 (12-52) months in high and low miR-21 groups) and overall survival (OS) (35 (15-52) vs 48 (17-61) months in high and low miR-21 groups) and was an independent risk factor for PFS and OS (hazard ratios 4.345 and 3.311, respectively). Furthermore, Bcl-2, Bcl-6 and Ki-67 were independently and positively associated with miR-21 expression. Our results suggest that miR-21 is a potential prognostic marker to predict clinical outcomes in PGI-DLBCL patients and a high miR-21 level is associated with poor outcomes.

Application of 3D printing in assessment and demonstration of stab injuries

In stabbing related fatalities, the forensic pathologist has to assess the direction of wound track (thus, the direction of the stabbing) and the weapon’s possible characteristics by examining the stab wound. The determination of these characteristics can be made only with a high level of uncertainty, and the precise direction of the stabbing is often difficult to assess if only soft tissues are injured. Previously reported techniques used for the assessment of these wound characteristics have substantial limitations. This manuscript presents a method using today’s easily accessible three-dimensional (3D) printing technology for blade-wound comparison and wound track determination. Scanning and 3D printing of knives is a useful method to identify weapons and determine the precise stabbing direction in a stabbing incident without compromising the trace evidence or the autopsy results. Ballistic gel experiment, and dynamic stabbing test experiments prove the method can be applied in safety, without compromising the autopsy results. Identification of the exact knife is not possible with complete certainty but excluding certain knives will decrease the number of necessary DNA examinations, hence it can lower the burden on forensic genetic laboratories. The method addresses many of the shortcomings of previously used methods of probe insertion or post-mortem CT. Insertion of the printed knife into the wound gives a good visual demonstration of the stabbing direction, thus easing the forensic reconstruction of the stabbing incident. After combining the 3D printing with photogrammetry, the achieved 3D visualization is useful for courtroom demonstration and educational purposes.

A Comparison Study Between CNN-Based Deformed Planning CT and CycleGAN-Based Synthetic CT Methods for Improving iCBCT Image Quality.

PurposeThe aim of this study is to compare two methods for improving the image quality of the Varian Halcyon cone-beam CT (iCBCT) system through the deformed planning CT (dpCT) based on the convolutional neural network (CNN) and the synthetic CT (sCT) generation based on the cycle-consistent generative adversarial network (CycleGAN).MethodsA total of 190 paired pelvic CT and iCBCT image datasets were included in the study, out of which 150 were used for model training and the remaining 40 were used for model testing. For the registration network, we proposed a 3D multi-stage registration network (MSnet) to deform planning CT images to agree with iCBCT images, and the contours from CT images were propagated to the corresponding iCBCT images through a deformation matrix. The overlap between the deformed contours (dpCT) and the fixed contours (iCBCT) was calculated for purposes of evaluating the registration accuracy. For the sCT generation, we trained the 2D CycleGAN using the deformation-registered CT-iCBCT slicers and generated the sCT with corresponding iCBCT image data. Then, on sCT images, physicians re-delineated the contours that were compared with contours of manually delineated iCBCT images. The organs for contour comparison included the bladder, spinal cord, femoral head left, femoral head right, and bone marrow. The dice similarity coefficient (DSC) was used to evaluate the accuracy of registration and the accuracy of sCT generation.ResultsThe DSC values of the registration and sCT generation were found to be 0.769 and 0.884 for the bladder (p < 0.05), 0.765 and 0.850 for the spinal cord (p < 0.05), 0.918 and 0.923 for the femoral head left (p > 0.05), 0.916 and 0.921 for the femoral head right (p > 0.05), and 0.878 and 0.916 for the bone marrow (p < 0.05), respectively. When the bladder volume difference in planning CT and iCBCT scans was more than double, the accuracy of sCT generation was significantly better than that of registration (DSC of bladder: 0.859 vs. 0.596, p < 0.05).ConclusionThe registration and sCT generation could both improve the iCBCT image quality effectively, and the sCT generation could achieve higher accuracy when the difference in planning CT and iCBCT was large.

Photon Counting CT Angiography of the Head and Neck: Image Quality Assessment of Polyenergetic and Virtual Monoenergetic Reconstructions.

Background: The purpose of the present study was the evaluation of the image quality of polyenergetic and monoenergetic reconstructions (PERs and MERs) of CT angiographies (CTAs) of the head and neck acquired with the novel photon counting CT (PCCT) method in clinical routine. Methods: Thirty-seven patients were enrolled in this retrospective study. Quantitative image parameters of the extracranial, intracranial and cerebral arteries were evaluated for the PER and MER (40–120 keV). Additionally, two radiologists rated the perceived image quality. Results: The mean CTDIvol used in the PCCT was 8.31 ± 1.19 mGy. The highest signal within the vessels was detected in the 40 keV MER, whereas the lowest noise was detected in the 115 keV MER. The most favorable contrast-to-noise-ratio (CNR) and signal-to-noise-ratio (SNR) were detected in the PER and low keV MER. In the qualitative image analysis, the PER was superior to the MER in all rated criteria. For MER, 60–65 keV was rated as best image quality. Conclusion: Overall, PCCT offers excellent image quality for CTAs of the head and neck. At the current state, the PER of the PCCT seems to be the most favorable reconstruction for diagnostic reporting.

Ultrasound /Computed tomography Guided Fine Needle Aspiration Cytology of Abdominal Lesions

Abstract Background:Abdominal masses always are mystery in clinical practice. Improvements have taken place in fine needle aspiration cytology with technical advances in imaging methods of ultrasound and CT. Aims:To study the utility of guided FNAC in the diagnosis of abdominal lesions and categories the abdominal lesions. To study cytological features of abdominal lesions and correlate with histopathological features wherever possible. Materials and methods: The study included 82 abdominal lesions. History, clinical features, radiological investigations were obtained in each case. USG or CT guidance was used and the FNA procedure was done. Smears were stained with Giemsa and viewed under the microscope for diagnosis. Diagnostic yield was 95%. Extra material obtained was given for cell block. Results: The age was from 14 years old to 82 years and majority of them were in the age group of 40 – 60 years. Male to female ratio is 1:1.1. Among 82 cases, 45 cases (54.87%) were malignant, followed by 17 cases (20.74%) benign, 14 cases (17.08%) inflammatory, 04 cases (4.87%) suspicious of malignancy and 02 cases (2.44%) unsatisfactory for evaluation. Majority of the cases are in liver and hepatocellular carcinoma was the most common malignant lesion. In 60 cases histopathological correlation was available and for these cases the diagnostic accuracy is 95%, sensitivity is 92.1%, specificity is 100% and p value is &lt;0.001 which is highly significant. Conclusion:Abdominal fine needle aspiration cytology is simple, cost effective, rapid and repeatable procedure which helps in categorizing the abdominal lesions.

What is the most accurate substitute for an invisible T1 slope in cervical radiographs? A comparative study of a novel method with previously reported substitutes.

The ability to utilize the T1 slope is often limited by poor visibility on cervical radiographs. The C7 slope has been proposed as a reliable substitute but may have similar limitations of visibility. Herein, the authors propose a novel method that takes advantage of the superior visibility on CT to accurately substitute for the radiographic T1 slope and compare the accuracy of this method with previously reported substitutes. Lateral neutral standing cervical radiographs and cervical CT scans were examined. When the T1 slope was clearly visible on radiographs, the C3-7 slopes and T1 slope were measured. In CT method 1, a direct method, the T1 slope was measured from the upper endplate of T1 to the bottom edge of the CT image, assuming the edge was parallel to the horizontal plane. In CT method 2, an overlaying method, the T1 slope was calculated by superimposing the C7 slope angle measured on a radiograph onto the CT scan and measuring the angle formed by the upper endplate of T1 and the superimposed horizontal line of the C7 slope. A Pearson correlation with linear regression modeling was performed for potential substitutes for the actual T1 slope. Among 160 patients with available noninstrumented lateral neutral cervical radiographs, the T1 slope was visible in only 54 patients (33.8%). A total of 52 patients met the inclusion criteria for final analysis. The Pearson correlation coefficients between the T1 slope and the C3-7 slopes, CT method 1, and CT method 2 were 0.243 (p = 0.083), 0.292 (p = 0.035), 0.609 (p < 0.001), 0.806 (p < 0.001), 0.898 (p < 0.001), 0.426 (p = 0.002), and 0.942 (p < 0.001), respectively. Linear regression modeling showed R2 = 0.807 for the correlation between C7 slope and T1 slope and R2 = 0.888 for the correlation between T1 slope with the CT method 2 and actual T1 slope. The C7 slope can be a reliable predictor of the T1 slope and is more accurate than more rostral cervical slopes. However, this study disclosed that the novel CT method 2, an overlaying method, was the most reliable estimate of true T1 slope with a greater positive correlation than C7 slope. When CT studies are available in patients with an invisible T1 slope on cervical radiographs, CT method 2 should be used as a substitute for the T1 slope.

Clinical value of routine contrast esophagram in the diagnosis of anastomotic leakage for three-incision esophagectomy with cervical anastomosis

Objective: To examine the clinical value of routine contrast esophagram (RCE) for the diagnosis of anastomotic leakage (AL) after three-incision esophagectomy with cervical anastomosis. Methods: Clinical data of 1 022 patients with esophageal cancer who underwent McKeown three-incision esophagectomy with cervical anastomosis from January 2015 to December 2019 at Department of Minimally Invasive Esophageal Surgery, Tianjin Medical University Cancer Hospital and Institute were analyzed retrospectively. There were 876 males and 146 females, aging(M(IQR)) 48(16) years (range: 36 to 84 years). There were 253 patients (24.8%) with neoadjuvant therapy, and 817 patients (79.9%) with minimally invasive esophagectomy. According to the diagnosis and treatment habits of the attending surgeons, 333 patients were included in the RCE group, and RCE was performed on the 7th day postoperative, while 689 patients were included in the non-RCE group, and RCE was performed when the patients had suspicious symptoms. Taking clinical symptoms, RCE, CT, endoscopy and other methods as reference to the diagnosis of AL, the sensitivity and specificity were used to analyze and evaluate the efficacy of RCE for the diagnosis of AL. The data were compared by U test or χ² test between groups. Results: The incidence rate of AL after three-incision esophagectomy was 7.34% (75/1 022), including 30 cases in the RCE group and 45 cases in the non-RCE group (9.0%(30/333) vs. 6.5%(45/689), χ²=2.027, P=0.155). The diagnostic time of AL was 9(5) days postoperative (range: 4 to 30 days). Among them, 23 cases showed cervical leakages, 50 cases showed intro-thoracic leakages, and 2 cases both cervical and intro-thoracic leakages. The diagnostic time of patients with intro-thoracic leakages was longer than that of cervical leakages (10(4) days vs. 6(3) days, Z=-2.517, P=0.012). Among the 333 patients in the RCE group, 16 cases of RCE indicated leakages including 11 cases of true positive and 5 cases determined to be false positive, while 317 cases indicated no abnormalities including 19 cases developed leakages. The sensitivity and specificity of RCE to detect AL were 36.7%(11/30) and 98.3%(298/333), respectively. The Youden-index was 0.35, and the diagnostic accuracy was 92.8%(309/333). The positive and negative predictive value were 11/16 and 94.0%(298/317), respectively. Conclusions: Routine contrast esophagram after three-incision esophagectomy with cervical anastomosis has low sensitivity and high specificity in the diagnosis of AL. The diagnostic time of AL is the 9th day after surgery. It is necessary to prolong the observation time clinically, and combine RCE with CT, endoscopy and other inspection methods for diagnosis.

Transcriptomic analysis of the genes for lactate dehydrogenase isomers in the reindeer' rumen of the Nenets Autonomous District in summer

Reindeer are unique arctic ruminants. They exist in conditions of extremely poor nutrition; therefore, the processes occurring in the rumen are of great scientific interest. It is known that the formation of lactate in the rumen is a key mechanism of metabolic disorders in the body of ruminants. Therefore, the aim of our study was to study the difference in the expression of two isomers of lactate dehydrogenases in the rumen of reindeer and to assess the level of enzymes depending on the sex and age of the animals.To assess the differences in the formation of lactate by microorganisms of the rumen community of reindeer in the summer‐autumn period, we carried out a transcriptomic analysis of the D and L genes of lactate dehydrogenases. For this, 12 samples were taken to isolate RNA from females (vazhenki), males (choirs), and calves of rumen fluid from deer in the summer‐autumn period in the Nenets Autonomous District. Relative expression was calculated using the 2 ‐∆∆Ct method. The 16SrRNA gene was chosen as a reference gene. Primers for L‐lactate dehydrogenase: F: CATCAAAAAGTTGTGTTAGTCGGCG, R: TCAGCTAAACCGTCGTTAAGCACTT. Primers for D‐lactate dehydrogenase: F: CTGGGATCCGTTGAGGGAGATGCTTAAG, R: CCGAAGCTTTTAGTTGACCCGGTTGAC.As a result of our work, we identified differences in the expression of lactate dehydrogenase genes between male and female reindeer. In males, a lower level of expression of genes of lactate dehydrogenases L and D types in the rumen was noted in comparison with females. It was 10 times less than that in the female rumen (p = 0.002 for L‐ldh, p = 0.001 for D‐ldh). Calves also showed higher levels of expression of these two genes compared to adult animals. The expression level of L‐ldh in the rumen of calves was 3 times higher than in adult animals (p = 0.03), and D‐ldh was two times less than in adult animals (p = 0.04). Lactic acid is formed as a result of lactic acid fermentation under the action of two different forms of lactate dehydrogenases: one of them (EC 1.1.1.27) produces the isomer L (+) ‐ lactate L‐lactate dehydrogenase, and the other (EC 1.1.1.28) produces the isomer D (‐) ‐ lactate D‐lactate dehydrogenase. The synthesized optical isomers have significant differences. These differences are essential for the normal physiological state of the animal, since the isomers differ in their ability to be excreted by the kidneys. D‐lactate has a lower excretion capacity and this determines its role in provoking metabolic acidosis. In addition, the genes of two isomers of lactate dehydrogenases are capable of performing the function of biological markers for the activity of the processes of lactic acid synthesis in the rumen of ruminants. In our study, females had a higher level of expression of both types of lactate dehydrogenases compared to males. Consequently, females may be more susceptible to associated metabolic disorders such as acidosis.

Epithelial Sodium Channels in Monocyte‐Macrophage Migration and Regulation by Pro‐inflammatory Cytokines TNFα and IFNγ

Migration of monocytes‐macrophages play an important role in phagocytosis of pathogens and cellular debris in a variety of pathophysiological conditions. While Epithelial Na+ Channels (ENaC) are required for normal migratory responses in glial, trophoblast, and vascular smooth muscle cells, their role in monocyte‐macrophage migration signaling is unknown. The Human Protein Atlas data base (www.proteinatlas.org) shows ENaC message in peripheral blood mononuclear cells and tissue resident macrophages in human populations. We used an in vitro model to determine the importance of ENaC in chemotactic migration of monocytes‐macrophages using a standard Boyden chamber assay. Cells were suspended in 0.4% FBS ± amiloride (0.1‐10 µM) or benzamil (0.01‐1 µM) to inhibit ENaC channels, then migrated for 4 hr towards a 10% FBS gradient. In mouse RAW cells, migration responses were inhibited by amiloride (65±6 – 46±4% of control at 0.1 and 10 µM, p=0.0001) and benzamil (55±6 – 55±5% of control at 0.01 and 1.0 µM, p&lt;0.0001). In human THP‐1 cells, migration responses were similarly inhibited by amiloride (73±5 ‐ 40±6% of control at 0.1 and 10 µM, p&lt;0.0001) and benzamil (68±7 – 53±4% of control at 0.01 and 1.0 µM, p&lt;0.0001). Since benzamil and amiloride are selective for ENaC at sub and low micromolar concentrations, respectively, our findings indicate ENaC signaling is required for migration of unstimulated monocyte‐macrophage cells. To determine if pro‐inflammatory cytokines, such as tumor necrosis factor alpha (TNFα) and interferon gamma (INFγ), regulate ENaC expression and function, we used TaqMan quantitative PCR, western blotting and chemotactic migration. Cells were exposed to a standard protocol to activate macrophages: INFγ for 48 hr plus TNFα (10 ng/mL each) during the last 24 hr. Expression of α and βENaC and GAPDH was calculated as fold change using the delta delta CT method (2‐∆∆CT). INFγ48hr + TNFα24hr increased α and βENaC message (9±2 and 5±1, n=4‐6, p=0.01). γENaC was undetectable. Despite increased message, whole cell αENaC protein expression was inhibited 50% by western blotting. The mechanism underlying message stimulation and protein inhibition remains to be determined. A similar effect on message upregulation and migration inhibition also occurred with 18 hr INFγ or TNFα alone (0‐10 ng/mL). Activation with INFγ/TNFα inhibited migration up to 70% and abolished the amiloride (1 µM) sensitive component. In unstimulated cells, amiloride (1 µM) coculture induced a rebound increase in migration following withdrawal, which was abolished by INFγ/TNFα treatment. This finding suggests cytokine induced ENaC loss mediates the migration inhibition. In summary, ENaC mediates monocyte migration, however, monocyte activation by INFγ/TNFα inhibits migration by inhibiting ENaC. Since pro‐inflammatory cytokines initiate monocyte differentiation and polarization to the phagocytic M1 phenotype, future studies will determine if ENaC is required for the phenotypic switch.

PO-1599 Comparison of Deep Learning synthetic CT methods for CBCT-guided adaptive prostate radiotherapy

PO-1599 Comparison of Deep Learning synthetic CT methods for CBCT-guided adaptive prostate radiotherapy

The Effect of Irisin on Proliferation, Apoptosis, and Expression of Metastasis Markers in Prostate Cancer Cell Lines.

Irisin is a newly discovered myokine released from skeletal muscle during exercise. The matrix metalloproteinases (MMPs) are a family of proteolytic enzymes that play a key role in the metastatic process via degrading extracellular matrix. The aim of this study was to investigate the effect of irisin on expression of metastatic markers MMP2 and MMP9 and induced apoptosis in human prostate cancer cells. In this study, we examined the effect of different concentrations of irisin on induced apoptosis and cell viability of two cell lines, LNCaP and DU-145, by using flow cytometry and MTT assay, respectively. The expression of MMP2 and MMP9 genes was also analyzed by real-time PCR after irisin treatment. Data were analyzed usingthecomparative cycle threshold2-∆∆Ct method. Cell viability was reduced in both LNCaP and DU-145 cell lines at different concentrations of irisin. However, this decreased cell viability was strongly significant (p < 0.05) only at 5 and 10nM concentrations of irisin in the LNCaP cell line. Furthermore, irisin could induce apoptosis in both cell lines at a concentration of 10nM compared to 5nM. Real-time PCR results also demonstrated a decreased expression in MMP2 and MMP9 genes in a concentration-dependent manner in both cell lines. These results showed the anticancer effects of irisin on cell viability of both LNCaP and DU-145 cell lines and also on the expression of MMP2 and MMP9 genes occurred in a dose- and time-dependent manner.

Deep learning-based fully automated body composition analysis of thigh CT: comparison with DXA measurement.

To compare volumetric CT with DL-based fully automated segmentation and dual-energy X-ray absorptiometry (DXA) in the measurement of thigh tissue composition. This prospective study was performed from January 2019 to December 2020. The participants underwent DXA to determine the body composition of the whole body and thigh. CT was performed in the thigh region; the images were automatically segmented into three muscle groups and adipose tissue by custom-developed DL-based automated segmentation software. Subsequently, the program reported the tissue composition of the thigh. The correlation and agreement between variables measured by DXA and CT were assessed. Then, CT thigh tissue volume prediction equations based on DXA-derived thigh tissue mass were developed using a general linear model. In total, 100 patients (mean age, 44.9 years; 60 women) were evaluated. There was a strong correlation between the CT and DXA measurements (R = 0.813~0.98, p < 0.001). There was no significant difference in total soft tissue mass between DXA and CT measurement (p = 0.183). However, DXA overestimated thigh lean (muscle) mass and underestimated thigh total fat mass (p < 0.001). The DXA-derived lean mass was an average of 10% higher than the CT-derived lean mass and 47% higher than the CT-derived lean muscle mass. The DXA-derived total fat mass was approximately 20% lower than the CT-derived total fat mass. The predicted CT tissue volume using DXA-derived data was highly correlated with actual CT-measured tissue volume in the validation group (R2 = 0.96~0.97, p < 0.001). Volumetric CT measurements with DL-based fully automated segmentation are a rapid and more accurate method for measuring thigh tissue composition. • There was a positive correlation between CT and DXA measurements in both the whole body and thigh. • DXA overestimated thigh lean mass by 10%, lean muscle mass by 47%, but underestimated total fat mass by 20% compared to the CT method. • The equations for predicting CT volume (cm3) were developed using DXA data (g), age, height (cm), and body weight (kg) and good model performance was proven in the validation study.

Selection and Evaluation of Candidate Reference Genes for Quantitative Real-Time PCR in Aboveground Tissues and Drought Conditions in Rhododendron Delavayi.

There has been no systematic identification and screening of candidate reference genes for normalization of quantitative real-time PCR (qRT-PCR) results in Rhododendron delavayi to date. Therefore, the present study used GAPDH, Act, EF1, Tub-, Tub-5, UEC1, TATA, TATA-2, UEP, TIP41, and Ubiquitin to predict their stabilities on different aboveground tissues (matured leaves (ML), stem tips (STM), and flower buds (FB)) at different developmental stages (young and adult plants) using five statistical algorithms: Delta Ct method, BestKeeper, geNorm, Normfinder, and RefFinder. The findings were confirmed using ML obtained from plants that had been stressed by drought. By using RefFinder with ML samples collected under drought conditions, it was determined that the top five most stable reference genes were GAPDH > UEC1 > Actin > Tubulin- > Tubulin—5, whereas the least stable reference gene was Ubiquitin. In addition, under control conditions, UEC1, UEC2, Actin, and GAPDH were selected as the highest stable potential reference genes at the juvenile stage of R. delavayi with ML and STM. When ML and STM were combined with drought-stressed samples, TIP41, GAPDH, or their combination proved to be the most effective qRT-PCR primers. The findings will aid in the improvement of the precision and reliability of qRT-PCR data and laying the groundwork for future gene functional studies in R. delavayi.