Critical Transcriptional Regulator Research Articles

Catching BETs by viruses

Viruses use diverse tactics to hijack host cellular machineries to evade innate immune responses and maintain their life cycles. Being critical transcriptional regulators, human BET proteins are prominent targets of a growing number of viruses. The BET proteins associate with chromatin through the interaction of their bromodomains with acetylated histones, whereas the carboxy-terminal domains of these proteins contain docking sites for various human co-transcriptional regulators. The same docking sites however can be occupied by viral proteins that exploit the BET proteins to anchor their genome components to chromatin in the infected host cell. In this review we highlight the pathological functions of the BET proteins upon viral infection, focusing on the mechanisms underlying their direct interactions with viral proteins, such as the envelope protein from SARS-CoV-2.

Role of the Paf1 complex in the maintenance of stem cell pluripotency and development.

Cell identity is determined by the transcriptional regulation of a cell-type-specific gene group. The Paf1 complex (Paf1C), an RNA polymerase II-associating factor, is an important transcriptional regulator that not only participates in transcription elongation and termination but also affects transcription-coupled histone modifications and chromatin organisation. Recent studies have shown that Paf1C is involved in the expression of genes required for self-renewal and pluripotency in stem cells and tumorigenesis. In this review, we focused on the role of Paf1C as a critical transcriptional regulator in cell fate decisions. Paf1C affects the pluripotency of stem cells by regulating the expression of core transcription factors such as Oct4 and Nanog. In addition, Paf1C directly binds to the promoters or distant elements of target genes, thereby maintaining the pluripotency in embryonic stem cells derived from an early stage of the mammalian embryo. Paf1C is upregulated in cancer stem cells, as compared with that in cancer cells, suggesting that Paf1C may be a target for cancer therapy. Interestingly, Paf1C is involved in multiple developmental stages in Drosophila, zebrafish, mice and even humans, thereby displaying a trend for the correlation between Paf1C and cell fate. Thus, we propose that Paf1C is a critical contributor to cell differentiation, cell specification and its characteristics and could be employed as a therapeutic target in developmental diseases.

722 Repressive epigenetic mechanisms mediated by PRC1 safeguards adult hair follicle stem cell quiescence

Hair follicle stem cells (HFSCs) have the unique capacity to fuel hair growth throughout the lifetime of an organism. During the onset of new hair growth, HFSCs get activated and proliferate to give rise to transit-amplifying cells that fuel the production of a new hair follicle. This activation is transient and HFSCs quickly return to quiescence. The balance between HFSC activation and quiescence is maintained by a specific transcriptional landscape. Epigenetic mechanisms are critical regulators of gene transcription, however, its role in controlling HFSC function in the adult skin remains largely unexplored.

Direct regulation of TCR rearrangement and expression by E proteins during early T cell development.

γδ T cells are widely distributed throughout mucosal and epithelial cell-rich tissues and are an important early source of IL-17 in response to several pathogens. Like αβ T cells, γδ T cells undergo a stepwise process of development in the thymus that requires recombination of genome-encoded segments to assemble mature T cell receptor (TCR) genes. This process is tightly controlled on multiple levels to enable TCR segment assembly while preventing the genomic instability inherent in the double-stranded DNA breaks that occur during this process. Each TCR locus has unique aspects in its structure and requirements, with different types of regulation before and after the αβ/γδ T cell fate choice. It has been known that Runx and Myb are critical transcriptional regulators of TCRγ and TCRδ expression, but the roles of E proteins in TCRγ and TCRδ regulation have been less well explored. Multiple lines of evidence show that E proteins are involved in TCR expression at many different levels, including the regulation of Rag recombinase gene expression and protein stability, induction of germline V segment expression, chromatin remodeling, and restriction of the fetal and adult γδTCR repertoires. Importantly, E proteins interact directly with the cis-regulatory elements of the TCRγ and TCRδ loci, controlling the predisposition of a cell to become an αβ T cell or a γδ T cell, even before the lineage-dictating TCR signaling events. This article is categorized under: Immune System Diseases > Stem Cells and Development Immune System Diseases > Genetics/Genomics/Epigenetics.

EGFR ligands synergistically increase IL-17A-induced expression of psoriasis signature genes in human keratinocytes via IκBζ and Bcl3.

Various epidermal growth factor receptor (EGFR) ligands are highly expressed in the epidermis of psoriasis lesions, and abnormal EGFR activation appears to be involved in the pathogenesis of psoriasis. However, how EGFR signaling contributes to the development of psoriasis is unclear. Interleukin (IL)-17A, a critical effector of the IL-23/IL-17A pathway, increases the expression of psoriasis signature genes in keratinocytes and plays an essential role in the pathogenesis of psoriasis by inducing IκBζ, a critical transcriptional regulator in psoriasis. In this study, we stimulated primary human keratinocytes with IL-17A and various EGFR ligands to investigate whether EGFR ligands regulate the expression of psoriasis signature genes. In cultured normal human keratinocytes and a living skin equivalent, EGFR ligands did not induce psoriasis-related gene expression, but significantly enhanced the IL-17A-mediated induction of various psoriasis signature genes, including antimicrobial peptides, cytokines, and chemokines. This was dependent on an EGFR activation-mediated synergistic increase in IL-17A-induced IκBζ expression and was partially mediated by the EGFR-dependent upregulation of Bcl3. Therefore, EGFR ligands can act as synergistic agents of IL-17A signaling by stimulating the epidermal production of psoriasis signature genes in psoriasis lesions. This study reveals a potential mechanism by which EGFR signaling contributes to the pathogenesis of psoriasis.

In Silico Analysis of Sox2 Gene for Pluripotency Detection at Mouse Embryonic Fibroblast and induced Pluripotent Stem Cell (iPSC)

Stem cells are cells that have not been specialized and have a specific characteristic compared to other cells. There are several transcription factors like Sox2, Oct4, c-Myc, and Nanog to maintain embryonic stem cells. In pluripotent stem cells, sex-determining region Y-box 2 (Sox2) is a critical transcriptional regulator, and for somatic cell reprogramming, which involves returning differentiated cells to a pluripotent embryonic state by reversing their epigenetic arrangement. This study aimed to design primers for detecting the Sox2 gene expressed in Mouse Embryonic Fibroblasts and induced Pluripotency Stem Cell as pluripotency detection in stem cell research. In silico analysis was carried out to detect ofx2gene by using several software such as BLAST to search sequence Sox2 gene from Homo sapiens and Mus musculus, Bioedit for sequence alignment, SnapGene for PCR in silico, and PrimerBlast for online primer design. Primer candidates successfully designed were then analyzed for their secondary structure using NetPrimer. The results showed that forward primer (5'- CTACAGCATGTCCTACTCGCA -3') and reverse primer (5'- ACTTGACCACAGAGCCCA -3') were selected primers for M. musculus. Also, forward primer (5’-CTACAGCATGTCCTACTCGCA-3') and reverse primer (5'- ACTT-GACCACCGAACCCA-3') for Homo sapiens. Detection by PCR in silico using templates from H. sapiens and M. musculus sequences showed that the primers could specifically amplify the Sox2 gene in each species. Nevertheless, laboratory experiments need to be carried out for preliminary validation that has been designed. These primers will be used to measure the gene expression of Sox2 in qRT-PCR to detect the stemness characteristic of stem cells.

CD90 is regulated by notch1 and hallmarks a more aggressive intrahepatic cholangiocarcinoma phenotype

BackgroundIntrahepatic Cholangiocarcinoma (iCCA) is characterized by a strong stromal reaction playing a role in tumor progression. Thymus cell antigen 1 (THY1), also called Cluster of Differentiation 90 (CD90), is a key regulator of cell–cell and cell–matrix interaction. In iCCA, CD90 has been reported to be associated with a poor prognosis. In an iCCA PDX model, we recently found that CD90 was downregulated in mice treated with the Notch γ-secretase inhibitor Crenigacestat. The study aims to investigate the role of CD90 in relation to the NOTCH pathway.MethodsTHY1/CD90 gene and protein expression was evaluated in human iCCA tissues and xenograft models by qRT-PCR, immunohistochemistry, and immunofluorescence. Notch1 inhibition was achieved by siRNA. THY1/CD90 functions were investigated in xenograft models built with HuCCT1 and KKU-M213 cell lines, engineered to overexpress or knockdown THY1, respectively.ResultsCD90 co-localized with EPCAM, showing its epithelial origin. In vitro, NOTCH1 silencing triggered HES1 and THY1 down-regulation. RBPJ, a critical transcriptional regulator of NOTCH signaling, exhibited putative binding sites on the THY1 promoter and bound to the latter, implying CD90 as a downstream NOTCH pathway effector. In vivo, Crenigacestat suppressed iCCA growth and reduced CD90 expression in the PDX model. In the xenograft model, Crenigacestat inhibited tumor growth of HuCCT1 cells transfected to overexpress CD90 and KKU-M213 cells constitutively expressing high levels of CD90, while not affecting the growth of HuCCT1 control cells and KKU-M213 depleted of CD90. In an iCCA cohort, patients with higher expression levels of NOTCH1/HES1/THY1 displayed a significantly shorter survival.ConclusionsiCCA patients with higher NOTCH1/HES1/THY1 expression have the worst prognosis, but they are more likely to benefit from Notch signaling inhibition. These findings represent the scientific rationale for testing NOTCH1 inhibitors in clinical trials, taking the first step toward precision medicine for iCCA.

FoxO4 controls sGCβ transcription in vascular smooth muscle.

Nitric oxide (NO) binds soluble guanylyl cyclase β (sGCβ) to produce cGMP and relax vascular smooth muscle cells (SMCs) needed for vasodilation. Although the regulation of NO-stimulated sGC activity has been well characterized at the posttranslational level, the mechanisms that govern sGC transcription remain incompletely understood. Recently, we identified Forkhead box subclass O (FoxO) transcription factors as essential for expression of sGC; however, the specific FoxO family member responsible for the expression of sGCβ in SMC remains unknown. Using FoxO shRNA knockdown adenovirus treatment in rat aortic SMCs, we show that FoxO1 or FoxO3 knockdown causes greater than twofold increases in Gucy1a3 and Gucy1b3 mRNA expression, without changes in NO-dependent cGMP production or cGMP-dependent phosphorylation. FoxO4 knockdown produced a 50% decrease in Gucy1a3 and Gucy1b3 mRNA with 70% loss of sGCα and 50% loss of sGCβ protein expression. Knockdown of FoxO4 expression decreased cGMP production and downstream protein kinase G-dependent phosphorylation more than 50%. Triple FoxO knockdown exacerbated loss of sGC-dependent function, phenocopying previous FoxO inhibition studies. Using promoter luciferase and chromatin immunoprecipitation assays, we find that FoxO4 acts as a transcriptional activator by directly binding several FoxO DNA motifs in the promoter regions of GUCY1B3 in human aortic SMCs. Collectively, our data show FoxO4 is a critical transcriptional regulator of sGCβ expression in SMC.NEW & NOTEWORTHY One of the key mechanisms of vascular smooth muscle cell (SMC) dilation occurs through nitric oxide (NO)-dependent induction of soluble guanylyl cyclase (sGC) by means of its β-subunit. Herein, we are the first to identify Forkhead box subclass O protein 4 (FoxO4) as a key transcriptional regulator of GUCY1B3 expression, which codes for sGCβ protein in human and animal SMCs. This discovery will likely have important implications for the future usage of antihypertensive and vasodilatory therapies which target NO production, sGC, or FoxO transcription factors.

Knockout of Cia5 gene using CRISPR/Cas9 technique in Chlamydomonas reinhardtii and evaluating CO2 sequestration in control and mutant isolates

CRISPR/Cas9 technology is one of the common methods of genome editing and targeted gene mutation, which has recently been used for manipulating microalgae such as Chlamydomonas reinhardtii. Besides, this technology can play a role in the fight against greenhouse gases (e.g., carbon dioxide) production by studying genetic pathways to improve algal strains. Among several genes in algae that respond to CO2 and regulators control the expression of each; Cia5 is one of the most critical transcriptional regulators. In this research, we knocked out the Cia5 gene using the CRISPR/Cas9 technique and analysed the ability of C. reinhardtii to perform CO2 sequestration. Our results showed that C. reinhardtii has better performance (i.e., response to CO2 treatment) in both control and mutant species at 0.5% CO2 concentration than other concentrations. However, the difference between the control microalgae species and the mutant species was in the CO2 removal efficiency. Additionally, our findings revealed that the control type isolate in CO2 concentrations of 0.04%, 0.5% and 1% had removal efficiencies of 27%, 37% and 21%, respectively. Nevertheless, for mutant species in the same concentrations, the observed removal efficiencies were 16%, 23% and 9%.

Therapeutic targeting of SPIB/SPI1-facilitated interplay of cancer cells and neutrophils inhibits aerobic glycolysis and cancer progression.

BackgroundAs a metabolic reprogramming feature, cancer cells derive most of their energy from aerobic glycolysis, while its regulatory mechanisms and therapeutic strategies continue to be illusive.MethodsIntegrative analysis of publically available expression profile datasets was used to identify critical transcriptional regulators and their target glycolytic enzymes. The functions and acting mechanisms of transcriptional regulators in cancer cells were investigated by using in vitro and in vivo assays. The Kaplan–Meier curve and log‐rank assay were used to conduct the survival study.ResultsSalmonella pathogenicity island 1 (SPI1/PU.1), a haematopoietic transcription factor, was identified to facilitate glycolytic process, tumourigenesis, invasiveness, as well as metastasis of colon cancer cells, which was interplayed by tumour‐associated neutrophils. Mechanistically, neutrophils delivered SPI1 mRNA via extracellular vesicles, resulting in enhanced SPI1 expression of cancer cells. Through physical interaction with SPI1‐related protein (SPIB), SPI1 drove expression of glycolytic genes within cancer cells, which in turn induced polarization of neutrophils via glycolytic metabolite lactate. Depletion of neutrophils or SPIB–SPI1 interaction in cancer cells significantly inhibited glycolytic process, tumourigenesis and aggressiveness. Upregulation of SPI1 or SPIB was found to be associated with poor prognosis in patients suffering from colon cancer.ConclusionsTherapeutic targeting of SPIB/SPI1‐facilitated interplay of cancerous cells and neutrophils suppresses aerobic glycolysis and progression of cancer.

Novel Oncogenic Transcription Factor Cooperation in RB-Deficient Cancer.

The retinoblastoma tumor suppressor (RB) is a critical regulator of E2F-dependent transcription, controlling a multitude of protumorigenic networks including but not limited to cell-cycle control. Here, genome-wide assessment of E2F1 function after RB loss in isogenic models of prostate cancer revealed unexpected repositioning and cooperation with oncogenic transcription factors, including the major driver of disease progression, the androgen receptor (AR). Further investigation revealed that observed AR/E2F1 cooperation elicited novel transcriptional networks that promote cancer phenotypes, especially as related to evasion of cell death. These observations were reflected in assessment of human disease, indicating the clinical relevance of the AR/E2F1 cooperome in prostate cancer. Together, these studies reveal new mechanisms by which RB loss induces cancer progression and highlight the importance of understanding the targets of E2F1 function. SIGNIFICANCE: This study identifies that RB loss in prostate cancer drives cooperation between AR and E2F1 as coregulators of transcription, which is linked to the progression of advanced disease.

The Unfolded Protein Response Is a Major Driver of LCN2 Expression in BCR-ABL- and JAK2V617F-Positive MPN.

Simple SummaryLipocalin 2 (LCN2) is a proinflammatory mediator increased in the blood of patients with myeloproliferative neoplasms (MPN) and other hematologic malignancies, significantly contributing to MPN disease initiation and progression. Here, we investigated the underlying mechanisms of LCN2 overexpression in MPN. We found a strong correlation between BCR–ABL and JAK2V617F driver oncogenes and LCN2 expression. Furthermore, LCN2 expression is strongly induced by endoplasmic reticulum (ER) stress, independent of oncogenic kinase activity. We identified the IRE1–JNK–NF-κB–C/EBP axis as a major mediator of ER stress-induced LCN2 expression. Our findings provide novel insights into the regulation of LCN2 and present a basis for innovative, targeted treatment approaches in MPN.Lipocalin 2 (LCN2), a proinflammatory mediator, is involved in the pathogenesis of myeloproliferative neoplasms (MPN). Here, we investigated the molecular mechanisms of LCN2 overexpression in MPN. LCN2 mRNA expression was 20-fold upregulated in peripheral blood (PB) mononuclear cells of chronic myeloid leukemia (CML) and myelofibrosis (MF) patients vs. healthy controls. In addition, LCN2 serum levels were significantly increased in polycythemia vera (PV) and MF and positively correlated with JAK2V617F and mutated CALR allele burden and neutrophil counts. Mechanistically, we identified endoplasmic reticulum (ER) stress and the unfolded protein response (UPR) as a main driver of LCN2 expression in BCR-ABL- and JAK2V617F-positive 32D cells. The UPR inducer thapsigargin increased LCN2 expression >100-fold, and this was not affected by kinase inhibition of BCR-ABL or JAK2V617F. Interestingly, inhibition of the UPR regulators inositol-requiring enzyme 1 (IRE1) and c-Jun N-terminal kinase (JNK) significantly reduced thapsigargin-induced LCN2 RNA and protein expression, and luciferase promoter assays identified nuclear factor kappa B (NF-κB) and CCAAT binding protein (C/EBP) as critical regulators of mLCN2 transcription. In conclusion, the IRE1–JNK-NF-κB–C/EBP axis is a major driver of LCN2 expression in MPN, and targeting UPR and LCN2 may represent a promising novel therapeutic approach in MPN.

Differentiation of exhausted CD8+ T cells after termination of chronic antigen stimulation stops short of achieving functional T cell memory.

T cell exhaustion is associated with failure to clear chronic infections and malignant cells. Defining the molecular mechanisms of T cell exhaustion and reinvigoration is essential to improving immunotherapeutic modalities. Here we confirmed pervasive phenotypic, functional, and transcriptional differences between memory and exhausted antigen-specific CD8+ T cells in human hepatitis C virus (HCV) infection before and after treatment. After viral cure, phenotypic changes in clonally stable exhausted T cell populations suggested differentiation towards a memory-like profile. However, functionally, the cells showed little improvement and critical transcriptional regulators remained in the exhaustion state. Notably, T cells from chronic HCV infection that were exposed to antigen for less time because of viral escape mutations were functionally and transcriptionally more similar to memory T cells from spontaneously resolved HCV infection. Thus, T cell stimulation duration impacts exhaustion recovery, with antigen removal after long-term exhaustion being insufficient for development of functional T cell memory.

Gene-Targeted, CREB-Mediated Induction of ΔFosB Controls Distinct Downstream Transcriptional Patterns Within D1 and D2 Medium Spiny Neurons

BackgroundThe onset and persistence of addiction phenotypes are, in part, mediated by transcriptional mechanisms in the brain that affect gene expression and, subsequently, neural circuitry. ΔFosB is a transcription factor that accumulates in the nucleus accumbens (NAc)—a brain region responsible for coordinating reward and motivation—after exposure to virtually every known rewarding substance, including cocaine and opioids. ΔFosB has also been shown to directly control gene transcription and behavior downstream of both cocaine and opioid exposure, but with potentially different roles in D1 and D2 medium spiny neurons (MSNs) in NAc. MethodsTo clarify MSN subtype-specific roles for ΔFosB and investigate how these coordinate the actions of distinct classes of addictive drugs in NAc, we developed a CRISPR (clustered regularly interspaced short palindromic repeats)/Cas9-based epigenome editing tool to induce endogenous ΔFosB expression in vivo in the absence of drug exposure. After inducing ΔFosB in D1- or D2-MSNs or both, we performed RNA sequencing on bulk male and female NAc tissue (n = 6–8/group). ResultsWe found that ΔFosB induction elicits distinct transcriptional profiles in NAc by MSN subtype and by sex, establishing for the first time that ΔFosB mediates different transcriptional effects in males versus females. We also demonstrated that changes in D1-MSNs, but not those in D2-MSNs or both, significantly recapitulate changes in gene expression induced by cocaine self-administration. ConclusionsTogether, these findings demonstrate the efficacy of a novel molecular tool for studying cell type–specific transcriptional mechanisms and shed new light on the activity of ΔFosB, a critical transcriptional regulator of drug addiction.

Abstract 1295: SJP1901, a small molecule inhibitor targeting hippo pathway by directly inhibiting TEAD palmitoylation in hippo pathway-dependent cancer

Abstract The hippo pathway is a critical transcriptional regulator of cell growth, proliferation, and migration in cancer, furthermore,YAP-TEAD complexes act as a major role in the pathway. S-palmitoylation of cysteine residues in TEAD proteins is required for their stability and function in hippo pathway signaling. Recently, it has become manifested that the dysregulation of hippo pathway effectors (MST1/2 and LATS1/2) is involved in oncogenesis. These effectors inactivate translocation of YAP and TAZ into the nucleus. The translocation of YAP/TAZ is responsible for acting as transcriptional coactivators by binding to the transcription factor, TEADs resulting in the transcription of cancer-related genes that drive tumor growth. Since YAP/TAZ are considered to be natively unfolded and can be difficult to handle as a drug target, TEAD is regarded as an excellent therapeutic target for intervention of the hippo pathway. SJP1901 is a small molecule of TEAD inhibitor with potential as drug candidates in malignant mesothelioma and other types of cancer. Based on the results of structure-based drug design, hit compounds were synthesized and their efficacy was evaluated.The compounds effectively inhibited palmitoylation of TEAD proteins and showed remarkable efficacy in reporter gene assay using TEAD responsive element (TRE)-integrated MCF7 with nano molar IC50 concentrations. The excellent anti-tumor effect of SJP1901 was revealed via cell proliferation inhibition assay (nano molar IC50 concentrations) andanalysis of inhibited transcription activity for target genes (CTGF and CYR61) usingmalignant mesothelia cell lines (NCI-H226, NCI-H2052 and MSTO-211H) known to display hippo pathway-dependent cell growth. In addition, these compounds showed lower toxicities in normal cells such as Fa2N4, CCD-18co and WI38 (IC50>10 μM). In conclusion, we obtained potent small molecules which inactivate TEAD proteins by directly inhibiting their palmitoylation. SJP1901 showed outstanding anti-cancer effects through regulating hippo pathway-mediated target genes and lower toxicitiy in normal cells. In vivo efficacy study and research to expand the indications are currently ongoing. Citation Format: Jihyun Um, Janghyun Lee, Kwangwoo Hwang, Sujin Park, Jooyoung Hyun, Dohyeong Lee, Jeongmin Lee, Li-Kyung Kim, Moon Jung Back, Seong Jun Park, Hwan Jung Lim, You-Keun Shin, Hei-Cheul Jeung, Jaewoong Lee, Hyun Tae Kim, Yongbin Park, Hoseok Kwon, Min-Hyo Ki. SJP1901, a small molecule inhibitor targeting hippo pathway by directly inhibiting TEAD palmitoylation in hippo pathway-dependent cancer [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2021; 2021 Apr 10-15 and May 17-21. Philadelphia (PA): AACR; Cancer Res 2021;81(13_Suppl):Abstract nr 1295.

Gene Regulation and Suppression of Type I Interferon Signaling By STAT3 in Diffuse Large B-Cell Lymphoma

The Janus kinas (JAK)/signal transducer and activator of transcription (STAT) pathway is central to signaling by receptors of diverse cytokines, growth factors and related molecules, which is critical for normal hematopoiesis and immune response. However, this signaling pathway is deregulated in several B cell lymphomas. In activated B-cell-like diffuse large B cell lymphoma (ABC DLBCL), autocrine production of IL-6 and IL-10 can result from high NF-κB activity caused by a variety of genetic alterations, such as mutations in MYD88 and CARD11. Our recent work has demonstrated that JAK1 is an active kinase downstream of IL-6 and IL-10 signaling that activates STAT3. Interestingly, JAK1 can function in the nucleus to regulate gene expression through phosphorylating histone H3 on tyrosine 41. There are nearly 3,000 JAK1 epigenetic target genes including MYD88, IRF4 and MYC, of which expression is essential for cancer cell survival and proliferation.Here we have investigated the canonical gene regulatory mechanism by STAT3 in ABC DLBCL cells. We performed genome-wide analysis and identified 2,251 STAT3 direct target genes, all of which involve B cell activation, survival, proliferation, differentiation and migration. Whole transcriptome profiling revealed that STAT3 acts as both a transcriptional activator and suppressor, with a comparable number of up- and down-regulated genes. STAT3 regulates multiple oncogenic signaling pathways, including NF-κB, cell cycle checkpoint, PI3K/AKT/mTORC1 and STAT3 itself. These results suggest that STAT3 is involved in the positive feedback regulation of IL-6/IL-10 signaling and shows crosstalk with NF-κB signaling pathways in ABC DLBCL cells. In addition, STAT3 negatively regulates the lethal type I interferon signaling pathway by inhibiting expression of IRF7, IRF9, STAT1 and STAT2, all of which are critical transcription factors in the type I interferon pathway. Inhibition of STAT3 activity by ruxolitinib synergizes with the type I interferon inducer lenalidomide in growth inhibition of ABC DLBCL cells in vitro . In an ABC DLBCL xenograft mouse model, combination treatment using ruxolitinib and lenalidomide completely inhibits the tumor growth during the period of treatment.In summary, we demonstrate that STAT3 is a critical transcriptional regulator of ABC DLBCL. Gene regulation by STAT3 in ABC DLBCL accentuates survival signaling pathways while dampening the lethal type I interferon pathway. Knowledge of these STAT3 regulated genes has led to our demonstration that a small molecule inhibitor in the JAK1-STAT3 signaling pathway synergizes with lenalidomide, suggesting a new therapeutic strategy for ABC DLBCL, a subtype that is particularly difficult to treat and has poor prognosis. DisclosuresNo relevant conflicts of interest to declare.

SIRT6 transcriptionally regulates fatty acid transport by suppressing PPARγ.

SUMMARYPathological lipid accumulation is often associated with enhanced uptake of free fatty acids via specific transporters in cardiomyocytes. Here, we identify SIRT6 as a critical transcriptional regulator of fatty acid transporters in cardiomyocytes. We find that SIRT6 deficiency enhances the expression of fatty acid transporters, leading to enhanced fatty acid uptake and lipid accumulation. Interestingly, the haploinsufficiency of SIRT6 is sufficient to induce the expression of fatty acid transporters and cause lipid accumulation in murine hearts. Mechanistically, SIRT6 depletion enhances the occupancy of the transcription factor PPARγ on the promoters of critical fatty acid transporters without modulating the acetylation of histone 3 at Lys 9 and Lys 56. Notably, the binding of SIRT6 to the DNA-binding domain of PPARγ is critical for regulating the expression of fatty acid transporters in cardiomyocytes. Our data suggest exploiting SIRT6 as a potential therapeutic target for protecting the heart from metabolic diseases.

Disruption of RFX family transcription factors causes autism, attention-deficit/hyperactivity disorder, intellectual disability, and dysregulated behavior

PurposeWe describe a novel neurobehavioral phenotype of autism spectrum disorder (ASD), intellectual disability, and/or attention-deficit/hyperactivity disorder (ADHD) associated with de novo or inherited deleterious variants in members of the RFX family of genes. RFX genes are evolutionarily conserved transcription factors that act as master regulators of central nervous system development and ciliogenesis. MethodsWe assembled a cohort of 38 individuals (from 33 unrelated families) with de novo variants in RFX3, RFX4, and RFX7. We describe their common clinical phenotypes and present bioinformatic analyses of expression patterns and downstream targets of these genes as they relate to other neurodevelopmental risk genes. ResultsThese individuals share neurobehavioral features including ASD, intellectual disability, and/or ADHD; other frequent features include hypersensitivity to sensory stimuli and sleep problems. RFX3, RFX4, and RFX7 are strongly expressed in developing and adult human brain, and X-box binding motifs as well as RFX ChIP-seq peaks are enriched in the cis-regulatory regions of known ASD risk genes. ConclusionThese results establish a likely role of deleterious variation in RFX3, RFX4, and RFX7 in cases of monogenic intellectual disability, ADHD and ASD, and position these genes as potentially critical transcriptional regulators of neurobiological pathways associated with neurodevelopmental disease pathogenesis.

Keeping the balance: The noncoding RNA 7SK as a master regulator for neuron development and function.

The noncoding RNA 7SK is a critical regulator of transcription by adjusting the activity of the kinase complex P-TEFb. Release of P-TEFb from 7SK stimulates transcription at many genes by promoting productive elongation. Conversely, P-TEFb sequestration by 7SK inhibits transcription. Recent studies have shown that 7SK functions are particularly important for neuron development and maintenance and it can thus be hypothesized that 7SK is at the center of many signaling pathways contributing to neuron function. 7SK activates neuronal gene expression programs that are key for terminal differentiation of neurons. Proteomics studies revealed a complex protein interactome of 7SK that includes several RNA-binding proteins. Some of these novel 7SK subcomplexes exert non-canonical cytosolic functions in neurons by regulating axonal mRNA transport and fine-tuning spliceosome production in response to transcription alterations. Thus, a picture emerges according to which 7SK acts as a multi-functional RNA scaffold that is integral for neuron homeostasis.

Global profiling of O-GlcNAcylated c-Rel-dependent gene expression

Abstract NF-κB c-Rel is a critical regulator of transcription in T cells. We previously showed that c-Rel is O-GlcNAcylated at a single residue, serine 350, and this posttranslational modification has a dual role in positive and negative regulation of c-Rel-dependent transcription. Here we performed a targeted RNA expression study to examine how c-Rel O-GlcNAcylation influences the transcriptional landscape of known NF-κB-dependent genes in T cells. We found groups of genes that were upregulated, downregulated or unregulated upon increased O-GlcNAcylation, and several of these genes were dependent on c-Rel serine 350 as analyzed by mutational studies. We also developed a novel site-specific antibody targeting serine 350 O-GlcNAcylated c-Rel. Our functional studies show that this novel antibody is capable of detecting hyperglycemia-induced c-Rel O-GlcNAcylation in cells isolated from diabetes patients and identify O-GlcNAcylation-dependent DNA binding of c-Rel by chromatin immunoprecipitation. Knowledge gained from the gene expression study and the use of S350 site-specific anti-O-GlcNAcylated c-Rel antibody have the potential to reveal the role of c-Rel O-GlcNAcylation in regulating T cell function in autoimmune diabetes.