CRISPR-Cas9 Gene Editing Research Articles

Advances and Limitations on the Current Treatment for Schizophrenia and its Future Prospect

Schizophrenia is a challenging mental disorder marked by recurring psychosis. This article provides an in-depth overview of the current status of research and treatment techniques for schizophrenia. The introductory part gives a thorough explanation of the illness, including all of its many phases and symptoms. The review analyzes the genes involved in cell signaling and neurotransmission, including NRG1, DTNBP1, DISC1, and RGS4, which are important contributors to schizophrenia susceptibility. The article discusses the limitations and challenges associated with existing treatment modalities, including antipsychotic drugs (both typical and atypical), transcranial magnetic stimulation, deep brain stimulation, virtual reality, electroconvulsive therapy, and the ketogenic diet. These approaches have demonstrated efficacy in managing different aspects of schizophrenia symptoms, but they also come with limitations such as side effects, individual variability in response, and ethical concerns. To overcome these limitations, the study offers CRISPR gene editing as a viable future therapeutic option. To improve the efficacy and safety of schizophrenia therapies, the conclusion underlines the need for tailored treatment planning, continuous research, and creative approaches. The changing landscape of schizophrenia research and therapy gives promise for better results and quality of life for people living with the condition.

Abstract 3032: Generation of a FOXC2-deficient melanoma cell line using CRISPR-Cas9 gene editing

Abstract Melanoma, a cancer derived from pigment-producing melanocytes of the skin, is a highly aggressive cancer characterized by rapid growth and metastasis. FOXC2 is a forkhead box transcription factor family member that is often dysregulated in various cancers, including melanoma, where its expression correlates with metastatic progression and drug resistance. To gain insight into the oncogenic activity of FOXC2 in melanoma, we have employed CRISPR-Cas9 gene editing technology to generate a novel FOXC2-deficient B16-F10 murine melanoma cell line. This model will be a useful tool for studying the tumor-promoting functions of FOXC2. Citation Format: Devanand M. Clark, Patrick D. Conde, Kristian M. Hargadon. Generation of a FOXC2-deficient melanoma cell line using CRISPR-Cas9 gene editing [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 3032.

Abstract 266: The effects of retinoid agents and retinoic acid receptor genotype on proliferation, differentiation, and stem cells in colorectal cancer

Abstract Understanding how to therapeutically target colonic stem cells (SCs) is important because SC overpopulation drives CRC growth and development. Our goal is to therapeutically sensitize cancer SCs (CSCs) to the differentiation-inducing effects of retinoid agents. We previously found that ALDH specifically marks normal and malignant colonic SCs. We also found that retinoic acid (RA) receptors and other RA signaling components are selectively expressed in ALDH+ SCs, indicating that RA signaling occurs through ALDH+ SCs. Because all-trans retinoic acid (ATRA) is a highly effective treatment for acute promyelocytic leukemia, which is caused by a genetic translocation involving retinoic acid receptor alpha (RARA), we conjecture that the response of RA agents may be effective against solid tumors depending on their pathway genotype. Our bioinformatics analysis on mutations and overexpression of RA signaling component genes in CRC showed that most of the RA pathway genes are altered in human CRCs. Therefore, we hypothesize that the ability of retinoid agents and retinoid metabolism blocking agents to induce differentiation of CSCs depends on the RA pathway genotype of CRC cells.Testing the effect of various retinoid drugs on cell proliferation shows that RA pathway genotype affects the response of RA agents in CRC cell lines. HCT116 and SW480 CRC cell lines, which have RA receptor mutations, displayed resistance to ATRA. In contrast, HT29 CRC cells that have wild-type RA receptors are sensitive to ATRA. All three cell lines however showed similar dose responses to the ATRA metabolizing enzyme, CYP26A1 inhibitor Liarozole. This finding indicates that regardless of RA receptor mutations, inhibition of ATRA metabolism can increase intracellular RA levels in a similar manner on all three cell lines to induce anti-proliferative effects. We used CRISPR-Cas9 gene editing to knock out the RARA gene in HT29 cells and evaluated its response to ATRA compared to HT29 cells. The RARA knockout derived lines showed reduced sensitivity to ATRA treatment and a slower rate of cell division compared to HT29 control cells. Additionally, Nanostring mRNA profiling analysis shows that ATRA treatment of HT29 cells increases expression of RARA, CYP26A1, and KRT20 (differentiation marker); and decreased decreases expression of CSC markers LGR5 and ALDH1A1. Altogether, these findings indicate that upregulated RA signaling can reduce cell proliferation, increase differentiation, and decrease CSC numbers in CRCs. Overall, our findings indicate that colon SCs are regulated by RA signaling mechanisms and dysregulation of RA signaling contributes to the SC overpopulation that drives CRC growth. Thus, therapeutically sensitizing CSCs to differentiation-inducing effects of retinoid agents should provide insight into designing new SC-targeted therapies for CRC. Citation Format: Victoria O. Hunsu, Caroline O. Facey, Bruce M. Boman. The effects of retinoid agents and retinoic acid receptor genotype on proliferation, differentiation, and stem cells in colorectal cancer [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 266.

Abstract 7478: Unveiling the role of two-pore channel 2 (TPC2) in cancer immunity from monocyte differentiation to cytokine production

Abstract Background: The study of TPC2 is of great interest in the field of cancer and immune diseases, as it plays a crucial role in various cellular processes, and there is substantial evidence that TPC2 sustains several cancer hallmarks (angiogenesis, autophagy, and metastasis). The expression and role of TPC2 and its relevance to cancer in the innate immune system remain unknown. Methods: U937 TPCN2 knockdown (KD) cells were developed by nucleofection-based transfection of CRISPR-Cas9 gene editing tools. sgRNA (single guide RNA): CGUGCUGGUGAGUGAGGAUG was designed to target the fourth exon of the TPCN2 gene (Transcript ID: ENST00000294309). The model was used in tandem with pharmacological modulators of TPC2 channel activity to underpin its function in monocyte differentiation, macrophage development, and IL-8 production. Molecular biology techniques, including Sanger sequencing, qPCR, ELISA, and WB, were utilized. Proteins of murine TPC2 WT and TPC2 KO cells were extracted and sent to the Discovery Proteomics Facility of the Target Discovery Institute for label-free quantification and proteomics analysis using mass spectrometry. Results: We developed TPC2-deficient human monocytes (U937 cells) with a 75% reduction in TPCN2 expression levels, and we demonstrated that TPCN2 genetically modified U937 monocytes were resistant to monocyte differentiation after treatment with increasing concentrations of PMA ranging from 100 ng/mL to 400 ng/mL. TPC2-deficient U937 monocytes were not differentiated into Mϕ. TPC2 acts as a major regulator of monocyte differentiation by modulating PKC-alpha via calpain. In addition, the levels of IL-8 were significantly reduced after treating U937 cells with Ned 19 (an NAADP antagonist) or TPC2 KD. Keratinocyte-derived chemokine (KC) and Macrophage inflammatory protein-2 (MIP-2) are the murine IL-8 homologues. Notably, the levels of MIP-2, but not KC, were significantly reduced in the TPC2 KO murine cells compared to the WT controls. Thus, TPC2 appears to be involved in IL-8 secretion in both humans and mice. In contrast to KC at the protein level, the KC expression level was significantly reduced in TPC2-deficient murine cells. TPC2 in EE/RE is involved in lipopolysaccharide (LPS)-mediated IL-8 production in U937 cells. TPC2 modulates immune targets involving CD38, PKC-alpha, and AKT.We found that 28 different proteins that play roles in cancer immunity showed significant changes in expression in TPC2-deficient murine cells (three overexpressed proteins and 25 down-expressed proteins), compared to WT. Conclusion: Our data provide the first preclinical proof of concept for TPC2 as a potential target for blocking macrophage development and modulating CD38/IL8 levels as therapeutic strategies for cancer patients, raising questions regarding the clinical utility of TPC2 as a biomarker or immunotherapy target to modulate immune responses. Citation Format: Abeer Alharbi, John Parrington. Unveiling the role of two-pore channel 2 (TPC2) in cancer immunity from monocyte differentiation to cytokine production [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 7478.

Abstract 3576: CRISPR Cas9 mediated MADD deletion can induce autophagy via downregulation of MAPK and PI3K/AKT/mTOR signaling in anaplastic thyroid cancer

Abstract Thyroid cancer is a highly prevalent endocrine malignancy with one of the fastest growing incidences of all cancers in the United States. Anaplastic thyroid cancer (ATC) has an incidence of about 1.7% of all thyroid cancers, but it causes over 40% of thyroid cancer-related deaths with a median survival period of less than one year. This is why agents that inhibit the aberrant signaling pathways which drive ATC aggressiveness are of significant interest. MAPK-activating Death Domain-activating protein (MADD) plays a key role in cancer cell survival and proliferation. MADD is constitutively expressed at higher levels in most tumor tissues and cancer cells relative to normal tissues. Studies using shRNA suggest that MADD prevents apoptosis in ATC cells. For a more definitive and mechanistic analysis of MADD in ATC, we used conditional CRISPR-Cas9 gene editing to target MADD. We observed that MADD deletion in ATC cells induced spontaneous apoptosis and also activated the autophagy pathway in human ATC cells through downregulation of ERK and mTOR signals involving the MAPK and PI3K/Akt/mTOR signaling pathways. Transcriptomic analysis of publicly available TCGA data showed several PI3K/AKT/mTOR pathway genes were positively correlated with MADD levels. RNA sequencing data of ATC lines demonstrated that enhanced activity of the PI3K/AKT/mTOR signaling pathway was correlated with a worse prognosis in ATC. Targeted MADD deletion in ATC cells combined with treatment using ERK/PI3K/Akt/mTOR/autophagy inhibitors resulted in enhanced cell death compared with MADD deletion alone. Further, MADD deleted 8505C-ATC cells showed significantly delayed tumor formation in an orthotopic nude mouse model. These findings suggest that combining MADD deletion with inhibitors of PI3K/Akt/mTOR pathway could provide an attractive new therapeutic option for ATC. Citation Format: Velavan Bakthavachalam, Manikannan Madhayan, Mark Sanborn, Jalees Rehman, Prabhakar Bellur. CRISPR Cas9 mediated MADD deletion can induce autophagy via downregulation of MAPK and PI3K/AKT/mTOR signaling in anaplastic thyroid cancer [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 3576.

Abstract 258: An organoid model for investigating Lynch syndrome tumorigenesis

Abstract Lynch syndrome (LS) is the most common inherited predisposition for developing colon cancer and is caused by germline variants in mismatch repair (MMR) genes. Still, the mechanism of tumorigenesis in these patients is unknown. An LS patient inherits one defective copy of an MMR gene. At some point in their lifetime, the remaining wild-type allele is lost in a cell rendering it entirely MMR deficient. MMR deficiency increases mutational rate and the chance of acquiring mutations in an oncogene or tumor suppressor that drive tumor initiation. However, loss of MMR in cells also leads to increased resistance to certain forms of DNA damage. Thus, our question is whether this phenotype imparts a selective advantage in colonic cells that may lead to clonal expansion of MMR-deficient cells as a first step towards tumorigenesis in LS patients. To test this, we are using stem cell-derived human colonic organoids and CRISPR gene editing to examine competition between MMR-deficient (MMRd) and MMR-proficient (MMRp) colonic cells over time. We have initially observed that MMRd stem cells are much more efficient at generating colonic organoids that grow larger and survive longer, consistent with our hypothesis of a selective advantage. To mimic the spontaneous loss of heterozygosity that occurs in LS patients’ colonic crypts, we are forming organoids from differentially labeled MMRd and MMRp stem cells. Live fluorescent imaging of individual organoids is used to quantify changes in cell population over time. Preliminary data indicate that MMRd cells can outgrow MMRp cells resulting in a shift in the ratio of green to red cells over a two-week time period while challenged with a DNA-damaging agent. These results suggest that loss of MMR function imparts an immediate selective advantage in colonic cells in response to DNA damage. Citation Format: Caroline Guild, Christopher Heinen, Samantha Nadeau. An organoid model for investigating Lynch syndrome tumorigenesis [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 258.

Abstract 5615: Functional analysis of variants of uncertain significance in the MSH6 mismatch repair gene

Abstract Lynch syndrome (LS) is a hereditary condition that increases patients’ lifetime risk of cancer, primarily colorectal cancer. LS is caused by germline mutations in mismatch repair (MMR) genes, MLH1, MSH2, MSH6, and PMS2. Identification and classification of these mutations is important in LS diagnosis for guiding treatment plans and preventative care for patients’ and their families. However, the consequences of some variants in these genes are not immediately obvious, granting them classification as variants of uncertain significance (VUS). Laboratory functional analysis to determine whether these variants disrupt MMR function in human cells can provide important evidence for understanding the pathogenicity of VUS and reclassifying them. Half of known variants in the MMR gene MSH6 are VUS and, thus, the goal of my project is to provide evidence for a subset of these variants to help provide evidence for reclassification for these variants. We are calibrating and validating functional assays for MSH6 variants, using known MSH6 pathogenic and benign controls. We will then test MSH6 VUS identified in patients as reported in the InSiGHT database, ClinVar database, and current literature. We are using CRISPR gene editing to recreate these variants in the endogenous MSH6 loci in human embryonic stem cells (hESC). Using these edited hESC lines we are examining the impact of the variants on RNA and protein stability, repair of DNA microsatellites, which is a hallmark of normal MMR function, and induction of the MMR-dependent DNA damage response. With this compilation of data, we will convert the results into a quantitative Odds of Pathogenicity value. This Odds of Pathogenicity score can be used by expert variant interpretation committees to help readily reclassify these variants and provide a clearer diagnosis for these suspected Lynch syndrome patients. Citation Format: Elizabeth Szabo, Emily Blackburn, Alexander Radecki, Abhijit Rath, Christopher Heinen. Functional analysis of variants of uncertain significance in the MSH6 mismatch repair gene [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 5615.

Abstract 141: A human induced pluripotent stem cell model of KMT2A rearranged leukemia

Abstract Acute lymphoblastic leukemia in infants (iALL) is a high-risk subtype of childhood leukemia with poor survival outcomes despite intensive therapies. Rearrangement of KMT2A (KMT2A-r) occurs in 70% of cases and is associated with refractoriness to therapy, early relapse, and rapid leukemia progression. KMT2A-r generates a driver fusion oncogene, most commonly KMT2A::AFF1 in iALL, which leads to epigenetic dysregulation of target gene transcription. iALL with KMT2A::AFF1 is an unusual cancer in that other somatic mutations are uncommon, there are no known genetic risk factors, and phenotypic switch from lymphoid to myeloid, mixed, or undifferentiated phenotype is common during treatment and particularly resistant to therapies. The cell of origin is thought to be a very early hematopoietic precursor, with transcriptomic studies of iALL blasts showing similarities to hematopoietic stem and progenitor cells (HSPCs), multipotent progenitors and early lymphoid progenitors (ELPs). Unfortunately, research into this rare but devastating disease has been hindered by a lack of appropriate, representative models. Interestingly, KMT2A-r originates in HSPCs in utero and the age of onset of iALL is a strong prognostic factor, with age younger than six months associated with the highest risk of relapse. However, little is known regarding how KMT2A-r subverts early hematopoiesis or drives the severe disease phenotype. In an effort to understand the role of the developmental state of the cell of origin in iALL, we have created a highly controlled induced pluripotent stem (iPS) cell model system of KMT2A::AFF1 leukemia. Specifically, we engineered human iPS cell lines with doxycycline regulatable expression of KMT2A::AFF1 fusion and we are employing CRISPR gene editing technology to introduce clinically identified variants of interest. Utilizing directed differentiation, we have produced functional HSPCs from iPS cells. Notably, this model recapitulates hematopoietic ontogeny, with the ability to control iALL induction at specific developmental stages. Following doxycycline treatment, we demonstrate that the cells express KMT2A::AFF1 fusion transcripts. We are utilizing single cell genomics to investigate transcriptomic changes during hematopoietic differentiation of our KMT2A::AFF1 iPS cells. We will compare these results to published data sets of single cell RNA sequencing data from healthy fetal HSPCs and to our existing iALL and pediatric KMT2A-r ALL single cell sequencing data sets. Our iPS cell based iALL model system provides the opportunity to investigate a range of critical and outstanding questions of iALL disease initiation, progression, and treatment. Citation Format: Erin Guest, Meagan Vacek, Jacqelyn Nemechek, Irina Pushel, Bradley T. Thornton, Molly Leyda, Midhat S. Farooqi, John M. Perry, Jay L. Vivian. A human induced pluripotent stem cell model of KMT2A rearranged leukemia [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 141.

Abstract 5241: Generation of allogeneic CAR-T circumvents functional deficits in patient-derived autologous product for glioblastoma

Abstract Glioblastoma (GBM) is the most common malignant primary brain tumor in adults. Despite an aggressive standard of care that includes maximally safe surgical resection, chemo-radiotherapy, median overall survival remains stagnant at 15 months. However, immunotherapeutic strategies have provided an exciting avenue of exploration to meet clinical need. Chimeric antigen receptor T-cell (CAR-T) therapy has shown promising results in liquid malignancies, but clinical trials in GBM targeting various tumor antigens have not shown durable clinical benefit. While this may be attributable to various tumor-intrinsic immune evasion strategies characteristic of GBM, little work has assessed whether the issue is due to the quality of the CAR-T treatment itself. Currently, CAR-Ts for clinical studies are manufactured in an autologous setting wherein T-cells are extracted from patients, engineered ex-vivo, and subsequently re-infused back. However, peripheral T-cells taken from untreated GBM patients have demonstrated qualitative and functional deficits, which may contribute to suboptimal treatment outcomes. Thus, we aimed to establish whether CAR-Ts generated from GBM patients would show reduced efficacy in comparison to healthy donors using our previously validated CD133 CAR-T. In this work, we show that in-spite of no inherent phenotypic differences, patient derived CAR-Ts shows pre-treatment exhaustion and upon preclinical evaluation using an orthotopic xenograft model of human GBM reduced survival advantage in autologous, patient-derived CD133-targeting CAR-T cell products was observed as compared to the controls. Transcriptomic analysis highlighted a decreased panel-wide enrichment in genes related to T cell and lymphocyte activation, lower prevalence of T cells (including Th1 and CD8+) and higher prevalence of exhausted CD8+ cells in T-cells products derived from GBM donors as compared to healthy donors. To overcome the functional and logistical considerations of autologous therapy, we additionally aimed to generate an “off-the-shelf” allogeneic CD133 CAR-T. Using CRISPR gene editing technology, we generated TCR-knockout CAR-T cells with comparable pre-clinical efficacy to our autologous models. In conclusion, this work highlights the need to reassess autologous CAR-T therapy for GBM and considers allogeneic approaches as promising alternatives. By addressing the inherent deficits in patient-derived CAR-Ts, allogeneic CD133 CAR-Ts may offer a more effective and logistically feasible therapeutic option for treating GBM. Citation Format: Muhammad Vaseem Shaikh, Sabra K. Salim, Jeffrey Wei, William T. Maich, Alisha A. Anand, Oliver Young Tang, Minomi K. Subapanditha, Yujin Suk, Manoj Singh, Zahra Alizada, Benjamin Brakel, Vassil Dimitrov, Zoya Tabunshchyk, Kevin Brown, Parvez Vora, Zev Binder, Chitra Venugopal, Jason Moffat, Sheila K. Singh. Generation of allogeneic CAR-T circumvents functional deficits in patient-derived autologous product for glioblastoma [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 5241.

Heterozygous missense variant in GLI2 impairs human endocrine pancreas development

Missense variants are the most common type of coding genetic variants. Their functional assessment is fundamental for defining any implication in human diseases and may also uncover genes that are essential for human organ development. Here, we apply CRISPR-Cas9 gene editing on human iPSCs to study a heterozygous missense variant in GLI2 identified in two siblings with early-onset and insulin-dependent diabetes of unknown cause. GLI2 is a primary mediator of the Hedgehog pathway, which regulates pancreatic β-cell development in mice. However, neither mutations in GLI2 nor Hedgehog dysregulation have been reported as cause or predisposition to diabetes. We establish and study a set of isogenic iPSC lines harbouring the missense variant for their ability to differentiate into pancreatic β-like cells. Interestingly, iPSCs carrying the missense variant show altered GLI2 transcriptional activity and impaired differentiation of pancreatic progenitors into endocrine cells. RNASeq and network analyses unveil a crosstalk between Hedgehog and WNT pathways, with the dysregulation of non-canonical WNT signaling in pancreatic progenitors carrying the GLI2 missense variant. Collectively, our findings underscore an essential role for GLI2 in human endocrine development and identify a gene variant that may lead to diabetes.

Droplets for Gene Editing Using CRISPR-Cas9 and Clonal Selection Improvement Using Hydrogels.

Gene editing tools have triggered a revolutionary transformation in the realms of cellular and molecular physiology, serving as a fundamental cornerstone for the evolution of disease models and assays in cell culture reactions, marked by various enhancements. Concurrently, microfluidics has emerged over recent decades as a versatile technology capable of elevating performance and reducing costs in daily experiments across diverse scientific disciplines, with a pronounced impact on cell biology. The amalgamation of these groundbreaking techniques holds the potential to amplify the generation of stable cell lines and the production of extracellular matrix hydrogels. These hydrogels, assuming a pivotal role in isolating cells at the single-cell level, facilitate a myriad of analyses. This study presents a novel method that seamlessly integrates CRISPR-Cas9 gene editing techniques with single-cell isolation methods in induced pluripotent stem cell (hiPSC) lines, utilizing the combined power of droplets and hydrogels. This innovative approach is designed to optimize clonal selection, thereby concurrently reducing costs and the time required for generating a stable genetically modified cell line. By bridging the advancements in gene editing and microfluidic technologies, our approach not only holds significant promise for the development of disease models and assays but also addresses the crucial need for efficient single-cell isolation. This integration contributes to streamlining processes, making it a transformative method with implications for enhancing the efficiency and cost-effectiveness of stable cell line generation. As we navigate the intersection of gene editing and microfluidics, our study marks a significant stride toward innovative methodologies in the dynamic landscape of cellular and molecular physiology research.

Decoding marfanoid syndrome: Breakthroughs in genetic understanding

Marfanoid Syndrome (MFS), a rare and complex genetic disorder, has long eluded a complete understanding of its intricate web of manifestations and underlying genetic factors. This review navigates the recent landscape of genetic research, offering an in-depth exploration of breakthroughs that have reshaped our comprehension of MFS. Focusing on pivotal genetic markers such as FBN1, TGFBR1, and TGFBR2, it unveils the specific mutations integral to the syndrome's clinical tapestry. Advancements in genomic technologies, notably next-generation sequencing and CRISPR-Cas9 gene editing, have propelled the field forward, accelerating the identification and analysis of genetic mutations with unprecedented precision. The review sheds light on how these technological strides have not only uncovered new genetic markers but also illuminated the intricate interplay of genes influencing the pathogenesis of MFS. Precision medicine takes center stage in the therapeutic frontiers, as understanding specific genetic mutations enables tailored interventions. This review provides a holistic perspective, encompassing genetic landscapes, technological revolutions, and emerging therapeutic paradigms, aiming to contribute to the ongoing discourse, foster a proactive approach to patient care, and inspire further research in the dynamic realm of MFS.

A novel class of insecticidal alkylsulfones are potent inhibitors of vesicular acetylcholine transport

Pyridine alkylsulfone derivatives typified by oxazosulfyl (Sumitomo Chemical Company Ltd.) and compound A2 (Syngenta) represent a new class of insecticides, with potent activity against several insect orders. Whilst the MOA of this class has been attributed to interaction with the voltage-gated sodium channel (VGSC), here we present strong evidence that their toxicity to insects is mediated primarily through inhibition of the vesicular acetylcholine transporter (VAChT). Alkylsulfone intoxication in insects is characterised by (i) a reduction in cholinergic synaptic transmission efficiency demonstrated by a depression of cercal afferent activity in giant-interneurone preparations of American cockroach (Periplaneta americana), (ii) selective block of cholinergic-transmission dependent post-synaptic potentials in the Drosophila giant-fibre pathway and (iii) abolition of miniature excitatory post-synaptic currents (mEPSCs) in an identified synapse in Drosophila larvae.Ligand-binding studies using a tritiated example compound ([3H]-A1) revealed a single saturable binding-site, with low nanomolar Kd value, in membrane fractions of green bottle fly (Lucilia sericata). Binding is inhibited by vesamicol and by several examples of a previously identified class of insecticidal compounds known to target VAChT, the spiroindolines. Displacement of this binding by analogues of the radioligand reveals a strong correlation with insecticidal potency. No specific binding was detected in untransformed PC12 cells but a PC12 line stably expressing Drosophila VAChT showed similar affinity for [3H]-A1 as that seen in fly head membrane preparations. Previously identified VAChT point mutations confer resistance to the spiroindoline class of insecticides in Drosophila by Gal-4/UAS directed expression in cholinergic neurones and by CRISPR gene-editing of VAChT, but none of these flies show detectable cross-resistance to this new chemical class.Oxazosulfyl was previously shown to stabilise voltage-gated sodium channels in their slow-inactivated conformation with an IC50 value of 12.3μM but inhibits binding of [3H]-A1 with approximately 5000 times greater potency. We believe this chemistry class represents a novel mode-of-action with high potential for invertebrate selectivity.

A Review on Propelling Agricultural Practices with Biotechnology into a New Era

The profound impact of biotechnological advancements on Indian agriculture, highlighting the transformative potential of integrating cutting-edge biotechnologies to propel agricultural practices into a new era. It meticulously examines the historical evolution of agricultural biotechnology in India, identifying key technological milestones that have significantly enhanced crop yield, nutrition, and stress resistance. Special emphasis is placed on the revolutionary roles of genetic modification, CRISPR-Cas9 gene editing, and the application of biopesticides and biofertilizers, showcasing their contribution to sustainable farming practices. The analysis further explores the socio-economic implications of these biotechnological interventions, including their effects on food security, employment opportunities, and rural development, while also addressing public concerns and ethical considerations surrounding genetically modified organisms (GMOs). Challenges and limitations, such as technical hurdles, regulatory frameworks, and public perception, are critically assessed to provide a comprehensive understanding of the current landscape. The article concludes with a forward-looking perspective on future advancements, emphasizing the potential of novel technologies like gene drives, synthetic biology, and nanotechnology, along with the integration of big data and artificial intelligence, to further enhance precision agriculture. Collaborative efforts and policy recommendations are proposed to navigate the challenges and harness the opportunities presented by biotechnology for sustainable agricultural advancements. Through this review, the article aims to contribute to the discourse on biotechnology's pivotal role in ensuring food security, adapting to climate change, and fostering sustainable development in India's agricultural sector, thereby supporting the global quest for sustainable food systems.

Generation of two patient specific GABRD variants and their isogenic controls for modeling epilepsy

Developmental and epileptic encephalopathies (DEEs) are early-onset conditions that cause intractable seizures and developmental delays. Missense variants in Gamma-aminobutyric acid type A receptor (GABAAR) subunits commonly cause DEEs. Ahring et al. (2022) showed a variant in the gene that encodes the delta subunit (GABRD) is strongly associated with the gain-of-function of extrasynaptic GABAAR. Here, we report the generation of two patient-specific human induced pluripotent stem cells (hiPSC) lines with (i) a de novo variant and (ii) a maternal variant, both for the pathogenic GABRD c.872 C>T, (p.T291I). The variants in the generated cell line were corrected using the CRISPR-Cas9 gene editing technique (respective isogenic control lines).

Gene-edited Mtsoc1 triple mutant Medicago plants do not flower.

Optimized flowering time is an important trait that ensures successful plant adaptation and crop productivity. SOC1-like genes encode MADS transcription factors, which are known to play important roles in flowering control in many plants. This includes the best-characterized eudicot model Arabidopsis thaliana (Arabidopsis), where SOC1 promotes flowering and functions as a floral integrator gene integrating signals from different flowering-time regulatory pathways. Medicago truncatula (Medicago) is a temperate reference legume with strong genomic and genetic resources used to study flowering pathways in legumes. Interestingly, despite responding to similar floral-inductive cues of extended cold (vernalization) followed by warm long days (VLD), such as in winter annual Arabidopsis, Medicago lacks FLC and CO which are key regulators of flowering in Arabidopsis. Unlike Arabidopsis with one SOC1 gene, multiple gene duplication events have given rise to three MtSOC1 paralogs within the Medicago genus in legumes: one Fabaceae group A SOC1 gene, MtSOC1a, and two tandemly repeated Fabaceae group B SOC1 genes, MtSOC1b and MtSOC1c. Previously, we showed that MtSOC1a has unique functions in floral promotion in Medicago. The Mtsoc1a Tnt1 retroelement insertion single mutant showed moderately delayed flowering in long- and short-day photoperiods, with and without prior vernalization, compared to the wild-type. In contrast, Mtsoc1b Tnt1 single mutants did not have altered flowering time or flower development, indicating that it was redundant in an otherwise wild-type background. Here, we describe the generation of Mtsoc1a Mtsoc1b Mtsoc1c triple mutant lines using CRISPR-Cas9 gene editing. We studied two independent triple mutant lines that segregated plants that did not flower and were bushy under floral inductive VLD. Genotyping indicated that these non-flowering plants were homozygous for the predicted strong mutant alleles of the three MtSOC1 genes. Gene expression analyses using RNA-seq and RT-qPCR indicated that these plants remained vegetative. Overall, the non-flowering triple mutants were dramatically different from the single Mtsoc1a mutant and the Arabidopsis soc1 mutant; implicating multiple MtSOC1 genes in critical overlapping roles in the transition to flowering in Medicago.

CRKL dictates anti-PD-1 resistance by mediating tumor-associated neutrophil infiltration in hepatocellular carcinoma

The effectiveness of immune checkpoint inhibitor (ICI) therapy for hepatocellular carcinoma (HCC) is limited by treatment resistance. However, the mechanisms underlying immunotherapy resistance remain elusive. We aimed to identify the role of CT10 regulator of kinase-like (CRKL) in resistance to anti-PD-1 therapy in HCC. Gene expression in HCC specimens from 10 patients receiving anti-PD-1 therapy was identified by RNA-sequencing. A total of 404 HCC samples from tissue microarrays were analyzed by immunohistochemistry. Transgenic mice (Alb-Cre/Trp53fl/fl) received hydrodynamic tail vein injections of a CRKL-overexpressing vector. Mass cytometry by time of flight was used to profile the proportion and status of different immune cell lineages in the mouse tumor tissues. CRKL was identified as a candidate anti-PD-1-resistance gene using a pooled genetic screen. CRKL overexpression nullifies anti-PD-1 treatment efficacy by mobilizing tumor-associated neutrophils (TANs), which block the infiltration and function of CD8+ T cells. PD-L1+ TANs were found to be an essential subset of TANs that were regulated by CRKL expression and display an immunosuppressive phenotype. Mechanistically, CRKL inhibits APC (adenomatous polyposis coli)-mediated proteasomal degradation of β-catenin by competitively decreasing Axin1 binding, and thus promotes VEGFα and CXCL1 expression. Using human HCC samples, we verified the positive correlations of CRKL/β-catenin/VEGFα and CXCL1. Targeting CRKL using CRISPR-Cas9 gene editing (CRKL knockout) or its downstream regulators effectively restored the efficacy of anti-PD-1 therapy in an orthotopic mouse model and a patient-derived organotypic tumor spheroid model. Activation of the CRKL/β-catenin/VEGFα and CXCL1 axis is a critical obstacle to successful anti-PD-1 therapy. Therefore, CRKL inhibitors combined with anti-PD-1 could be useful for the treatment of HCC. Here, we found that CRKL was overexpressed in anti-PD-1-resistant hepatocellular carcinoma (HCC) and that CRKL upregulation promotes anti-PD-1 resistance in HCC. We identified that upregulation of the CRKL/β-catenin/VEGFα and CXCL1 axis contributes to anti-PD-1 tolerance by promoting infiltration of tumor-associated neutrophils. These findings support the strategy of bevacizumab-based immune checkpoint inhibitor combination therapy, and CRKL inhibitors combined with anti-PD-1 therapy may be developed for the treatment of HCC.

Genetic manipulation of an Ixodes scapularis cell line.

Although genetic manipulation is one of the hallmarks of model organisms, its applicability to non-model species has remained difficult due to our limited understanding of their fundamental biology. For instance, manipulation of a cell line originated from the black-legged tick Ixodes scapularis, an arthropod that serves as a vector for several human pathogens, has yet to be established. Here, we demonstrate the successful genetic modification of the commonly used tick ISE6 line through ectopic expression and clustered regularly interspaced palindromic repeats [(CRISPR)/CRISPR-associated protein 9 (Cas9)] genome editing. We performed ectopic expression using nucleofection and attained CRISPR-Cas9 editing via homology-dependent recombination. Targeting the E3 ubiquitin ligase x-linked inhibitor of apoptosis (xiap) and its substrate p47 led to an alteration in molecular signaling within the immune deficiency network and increased infection of the rickettsial agent Anaplasma phagocytophilum in I. scapularis ISE6 cells. Collectively, our findings complement techniques for the genetic engineering of I. scapularis ticks, which currently limit efficient and scalable molecular genetic screens in vivo.IMPORTANCEGenetic engineering in arachnids has lagged compared to insects, largely because of substantial differences in their biology. This study unveils the implementation of ectopic expression and CRISPR-Cas9 gene editing in a tick cell line. We introduced fluorescently tagged proteins in ISE6 cells and edited its genome via homology-dependent recombination. We ablated the expression of xiap and p47, two signaling molecules present in the immune deficiency (IMD) pathway of Ixodes scapularis. Impairment of the tick IMD pathway, an analogous network of the tumor necrosis factor receptor in mammals, led to enhanced infection of the rickettsial agent Anaplasma phagocytophilum. Altogether, our findings provide a critical technical resource to the scientific community to enable a deeper understanding of biological circuits in the black-legged tick I. scapularis.

Unlocking the future of medicine: CRISPR-Cas9 gene editing holds the key to transformation

The Biochemical Society identifies and celebrates outstanding science communication talent in molecular biosciences with its annual Science Communication Prize. Cansu Kizilkaya, from Turkey, won the second prize in the written category for students studying for A-level/T-level/BTEC National/Scottish Highers or equivalent qualifications. Cansu’s piece is titled ‘Unlocking the Future of Medicine: CRISPR-Cas9 Gene Editing Holds the Key to Transformation’.

Phylogenetic and functional analysis of tiller angle control homeologs in allotetraploid cotton.

Plants can adapt their growth to optimize light capture in competitive environments, with branch angle being a crucial factor influencing plant phenotype and physiology. Decreased branch angles in cereal crops have been shown to enhance productivity in high-density plantings. The Tiller Angle Control (TAC1) gene, known for regulating tiller inclination in rice and corn, has been found to control branch angle in eudicots. Manipulating TAC1 in field crops like cotton offers the potential for improving crop productivity. Using a homolog-based methodology, we examined the distribution of TAC1-related genes in cotton compared to other angiosperms. Furthermore, tissue-specific qPCR analysis unveiled distinct expression patterns of TAC1 genes in various cotton tissues. To silence highly expressed specific TAC1 homeologs in the stem, we applied CRISPR-Cas9 gene editing and Agrobacterium-mediated transformation, followed by genotyping and subsequent phenotypic validation of the mutants. Gene duplication events of TAC1 specific to the Gossypium lineage were identified, with 3 copies in diploid progenitors and 6 copies in allotetraploid cottons. Sequence analysis of the TAC1 homeologs in Gossypium hirsutum revealed divergence from other angiosperms with 1-2 copies, suggesting possible neo- or sub-functionalization for the duplicated copies. These TAC1 homeologs exhibited distinct gene expression patterns in various tissues over developmental time, with elevated expression of A11G109300 and D11G112200, specifically in flowers and stems, respectively. CRISPR-mediated loss of these TAC1 homeologous genes resulted in a reduction in branch angle and altered petiole angles, and a 5 to 10-fold reduction in TAC1 expression in the mutants, confirming their role in controlling branch and petiole angles. This research provides a promising strategy for genetically engineering branch and petiole angles in commercial cotton varieties, potentially leading to increased productivity.