CRE-like Sequence Research Articles

The absence of a functional nuclear receptor element A (NREA) in the promoter II of the aromatase P450 gene in rabbit granulosa cells

Aromatase protein is synthesized in response to gonadotropins that activate expression of their target genes via the cAMP second messenger system. The −882/+103 bp region of the rabbit ovarian promoter (PII) was ligated to a luciferase vector and transfected into granulosa cells to elucidated the mechanism by which cAMP stimulates transcription. Deletions and mutational experiments indicate that (i) a cAMP-response element-like sequence (CLS) present at −208 to −200 bp is the main element required for the activation of the rabbit PII by cAMP and that (ii) both nuclear receptor element sites; NREA (−133/−126 bp) and NREB (−188/−181 bp) do not participate to the cAMP-dependent activity of the PII. The replacement of the specific rabbit NREA site by the human NREA site increases two-fold the cAMP response and indicates that trans-activating factors are present in rabbit granulosa cells. This study shows for the first time an efficient aromatase transcription occurs in granulosa cells in absence of a consensus NREA site. In addition a comparative study has been performed on the sheep aromatase promoter where sites deviate from rabbit. Mutagenesis experiments suggest that some of them are involved in the cAMP-induced response of the rabbit PII.

Influence of cAMP on reporter bioassays for dioxin and dioxin-like compounds

In reporter assays for detection of dioxins, the dioxin-responsive element (DRE) is generally used as a sensor sequence. In several systems, the CYP1A1 promoter containing DREs (DRE(cyp)) is inserted into a part of the long terminal repeat of mouse mammary tumor virus (LTR(MMTV)) to improve sensitivity of assays. We found that DRE(cyp)-LTR(MMTV) responds not only to dioxins and dioxin-like compounds but also to forskolin, a cAMP-elevating agent. This effect was dose-dependent and reproduced by other cAMP-elevating agents including 8-bromo-cAMP and 3-isobutyl-methylxanthine. The cAMP response element (CRE) and CRE-like sequences were absent in DRE(cyp)-LTR(MMTV) and not involved in this process. In contrast to the effect of dioxin, the activation of DRE(cyp)-LTR(MMTV) by cAMP was independent of the aryl hydrocarbon receptor (AhR), a ligand-dependent transcription factor for DRE. Furthermore, neither DRE(cyp), LTR(MMTV) nor the consensus sequence of DRE alone was activated in response to cAMP. These data elucidated for the first time that the combination of DRE(cyp) with LTR(MMTV) causes a peculiar response to cAMP and suggested that use of AhR antagonists is essential to exclude false-positive responses of DRE(cyp)-LTR(MMTV)-based bioassays for detection and quantification of dioxins and dioxin-like compounds.

Identification of a functional CRE in the promoter of Fukuyama congenital muscular dystrophy gene fukutin

We isolated a fragment of the fukutin gene promoter from differentiated human NT2 cells using chromatin immunoprecipitation technique with an anti-CREB antibody. This fragment contained a CRE-like sequence and here we describe its functional validation. The results showed that the element was functional in vitro and in vivo and that CREB in neurons was involved in the transcriptional regulation of the fukutin gene. Moreover, its expression in neurons was regulated by cAMP and calcium ions, known triggers of CREB phosphorylation. To our knowledge, this is the first report on the regulation of fukutin gene by transcription factor CREB in response to the signals generated by synaptic activity. The true biological function of fukutin, the gene responsible for Fukuyama-type congenital muscular dystrophy and mental retardation, is at present not known. However, it has been suggested that it might possess glycosyltransferase activity and its intracellular localization within the Golgi structures is consistent with this function. As such, fukutin might play a significant role in post-translational modification of synaptic proteins in neuronal cells.

CAMP response element binding protein (CREB) activates transcription via two distinct genetic elements of the human glucose-6-phosphatase gene

BackgroundThe enzyme glucose-6-phosphatase catalyzes the dephosphorylation of glucose-6-phosphatase to glucose, the final step in the gluconeogenic and glycogenolytic pathways. Expression of the glucose-6-phosphatase gene is induced by glucocorticoids and elevated levels of intracellular cAMP. The effect of cAMP in regulating glucose-6-phosphatase gene transcription was corroborated by the identification of two genetic motifs CRE1 and CRE2 in the human and murine glucose-6-phosphatase gene promoter that resemble cAMP response elements (CRE).ResultsThe cAMP response element is a point of convergence for many extracellular and intracellular signals, including cAMP, calcium, and neurotrophins. The major CRE binding protein CREB, a member of the basic region leucine zipper (bZIP) family of transcription factors, requires phosphorylation to become a biologically active transcriptional activator. Since unphosphorylated CREB is transcriptionally silent simple overexpression studies cannot be performed to test the biological role of CRE-like sequences of the glucose-6-phosphatase gene. The use of a constitutively active CREB2/CREB fusion protein allowed us to uncouple the investigation of target genes of CREB from the variety of signaling pathways that lead to an activation of CREB. Here, we show that this constitutively active CREB2/CREB fusion protein strikingly enhanced reporter gene transcription mediated by either CRE1 or CRE2 derived from the glucose-6-phosphatase gene. Likewise, reporter gene transcription was enhanced following expression of the catalytic subunit of cAMP-dependent protein kinase (PKA) in the nucleus of transfected cells. In contrast, activating transcription factor 2 (ATF2), known to compete with CREB for binding to the canonical CRE sequence 5'-TGACGTCA-3', did not transactivate reporter genes containing CRE1, CRE2, or both CREs derived from the glucose-6-phosphatase gene.ConclusionsUsing a constitutively active CREB2/CREB fusion protein and a mutant of the PKA catalytic subunit that is targeted to the nucleus, we have shown that the glucose-6-phosphatase gene has two distinct genetic elements that function as bona fide CRE. This study further shows that the expression vectors encoding C2/CREB and catalytic subunit of PKA are valuable tools for the study of CREB-mediated gene transcription and the biological functions of CREB.

Control of the rat angiotensin I converting enzyme gene by CRE-like sequences.

We characterized the role of potential cAMP-responsive elements (CRE) in basal and in induced angiotensin converting enzyme (ACE) gene promoter activity in order to shed light on the regulation of somatic ACE expression. We identified stimulators and repressors of basal expression between 122 and 288 bp and between 415 and 1303 bp upstream from the transcription start site, respectively, using a rabbit endothelial cell (REC) line. These regions also contained elements associated with the response to 8BrcAMP. When screening for CRE motifs we found pCRE, a proximal sequence between 209 and 222 bp. dCRE, a distal tandem of two CRE-like sequences conserved between rats, mice and humans, was detected between 834 and 846 bp. Gel retardation analysis of nuclear extracts of REC indicated that pCRE and dCRE bind to the same protein complexes as bound by a canonical CRE. Mutation of pCRE and dCRE in REC established the former as a positive element and the latter as a negative element. In 293 cells, a renal cell line, pCRE and dCRE are negative regulators. Co-transfection of ATF-2 or ATF-2 plus c-Jun repressed ACE promoter activity, suggesting that the ACE gene is controlled by cellular stress. Although mapping of cAMP responsiveness was consistent with roles for pCRE and dCRE, mutation analysis indicated that they were not required for cAMP responsiveness. We conclude that the basal activity of the somatic ACE promoter is controlled by proximal and distal CREs that can act as enhancers or repressors depending on the cell context.

Molecular characterization of CcpA and involvement of this protein in transcriptional regulation of lactate dehydrogenase and pyruvate formate-lyase in the ruminal bacterium Streptococcus bovis.

A ccpA gene that encodes global catabolite control protein A (CcpA) in Streptococcus bovis was identified and characterized, and the involvement of CcpA in transcriptional control of a gene (ldh) encoding lactate dehydrogenase (LDH) and a gene (pfl) encoding pyruvate formate-lyase (PFL) was examined. The ccpA gene was shown to be transcribed as a monocistronic operon. A catabolite-responsive element (cre) was found in the promoter region of ccpA, suggesting that ccpA transcription in S. bovis is autogenously regulated. CcpA required HPr that was phosphorylated at the serine residue at position 46 (HPr-[Ser-P]) for binding to the cre site, but glucose 6-phosphate, fructose 1,6-bisphosphate, and NADP had no effect on binding. Diauxic growth was observed when S. bovis was grown in a medium containing glucose and lactose, but it disappeared when ccpA was disrupted, which indicates that CcpA is involved in catabolite repression in S. bovis. The level of ccpA mRNA was higher when cells were grown on glucose than when they were grown on lactose, which was in line with the level of ldh mRNA. When cells were grown on glucose, the ldh mRNA level was lower but the pfl mRNA level was higher in a ccpA-disrupted mutant than in the parent strain, which suggests that ldh transcription is enhanced and pfl transcription is suppressed by CcpA. The ccpA-disrupted mutant produced less lactate and more formate than the parent, probably because the mutant had reduced LDH activity and elevated PFL activity. In the upper region of both ldh and pfl, a cre-like sequence was found, suggesting that the complex consisting of CcpA and HPr-[Ser-P] binds to the possible cre sites. Thus, CcpA appears to be involved in the global regulation of sugar utilization in S. bovis.

CREB trans-activates the murine H(+)-K(+)-ATPase alpha(2)-subunit gene.

Despite its key role in potassium homeostasis, transcriptional control of the H(+)-K(+)-ATPase alpha(2)-subunit (HKalpha(2)) gene in the collecting duct remains poorly characterized. cAMP increases H(+)-K(+)-ATPase activity in the collecting duct, but its role in activating HKalpha(2) transcription has not been explored. Previously, we demonstrated that the proximal 177 bp of the HKalpha(2) promoter confers basal collecting duct-selective expression. This region contains several potential cAMP/Ca(2+)-responsive elements (CRE). Accordingly, we examined the participation of CRE-binding protein (CREB) in HKalpha(2) transcriptional control in murine inner medullary collecting duct (mIMCD)-3 cells. Forskolin and vasopressin induced HKalpha(2) mRNA levels, and CREB overexpression stimulated the activity of HKalpha(2) promoter-luciferase constructs. Serial deletion analysis revealed that CREB inducibility was retained in a construct containing the proximal 100 bp of the HKalpha(2) promoter. In contrast, expression of a dominant negative inhibitor (A-CREB) resulted in 60% lower HKalpha(2) promoter-luciferase activity, suggesting that constitutive CREB participates in basal HKalpha(2) transcriptional activity. A constitutively active CREB mutant (CREB-VP16) strongly induced HKalpha(2) promoter-luciferase activity, whereas overexpression of CREBdLZ-VP16, which lacks the CREB DNA-binding domain, abolished this activation. In vitro DNase I footprinting and gel shift/supershift analysis of the proximal promoter with recombinant glutathione S-transferase (GST)-CREB-1 and mIMCD-3 cell nuclear extracts revealed sequence-specific DNA-CREB-1 complexes at -86/-60. Mutation at three CRE-like sequences within this region abolished CREB-1 DNA-binding activity and abrogated CREB-VP16 trans-activation of the HKalpha(2) promoter. In contrast, mutation of the neighboring -104/-94 kappabeta element did not alter CREB-VP16 trans-activation of the HKalpha(2) promoter. Thus CREB-1, binding to one or more CRE-like elements in the -86/-60 region, trans-activates the HKalpha(2) gene and may represent an important link between rapid and delayed effects of cAMP on HKalpha(2) activity.

Fission yeast global repressors regulate the specificity of chromatin alteration in response to distinct environmental stresses.

The specific induction of genes in response to distinct environmental stress is vital for all eukaryotes. To study the mechanisms that result in selective gene responses, we examined the role of the fission yeast Tup1 family repressors in chromatin regulation. We found that chromatin structure around a cAMP-responsive element (CRE)-like sequence in ade6-M26 that is bound by Atf1.Pcr1 transcriptional activation was altered in response to osmotic stress but not to heat and oxidative stresses. Such chromatin structure alteration occurred later than the Atf1 phosphorylation but correlated well with stress-induced transcriptional activation at ade6-M26. This chromatin structure alteration required components for the stress-activated protein kinase (SAPK) cascade and both subunits of the M26-binding CREB/ATF-type protein Atf1.Pcr1. Cation stress and glucose starvation selectively caused chromatin structure alteration around CRE-like sequences in cta3(+) and fbp1(+) promoters, respectively, in correlation with transcriptional activation. However, the tup11Delta tup12Delta double deletion mutants lost the selectivity of stress responses of chromatin structure and transcriptional regulation of cta3(+) and fbp1(+). These data indicate that the Tup1-like repressors regulate the chromatin structure to ensure the specificity of gene activation in response to particular stresses. Such a role for these proteins may serve as a paradigm for the regulation of stress response in higher eukaryotes.

Forskolin up-regulates aromatase (CYP19) activity and gene transcripts in the human adrenocortical carcinoma cell line H295R.

A number of conditions related to sex-reversal in boys and men and precocious puberty in girls are caused by estrogen-secreting adrenal tumors. In these tumors, cytochrome P450 aromatase (aromatase) that is encoded in the CYP19 gene is expressed at high levels. To investigate the molecular mechanism of aromatase expression in these adrenal tumors, we characterized the activity, gene transcript and genomic promoter region of aromatase in the human adrenocortical carcinoma cell line H295R. Aromatase activity and the transcript of the CYP19 gene were highly up-regulated by forskolin, but not by dexamethasone. The results from exon I-specific reverse transcriptase (RT)-PCR and the transfection of reporter constructs suggested that promoter I.3 and promoter II were activated in H295R. Deletion and mutation analysis suggested that cAMP response element-like sequence (CLS) and steroidogenic factor-1 (SF-1) motif, were critical for the activation of promoter II. The results of this work should provide the basis for the molecular analysis of aromatase expression in adrenocortical cells.

Interaction between C/EBPβ and Tax down-regulates human T-cell leukemia virus type I transcription

The human T-cell leukemia virus type I (HTLV-I) Tax protein trans-activates viral transcription through three imperfect tandem repeats of a 21-bp sequence called Tax-responsive element (TxRE). Tax regulates transcription via direct interaction with some members of the activating transcription factor/CRE-binding protein (ATF/CREB) family including CREM, CREB, and CREB-2. By interacting with their ZIP domain, Tax stimulates the binding of these cellular factors to the CRE-like sequence present in the TxREs. Recent observations have shown that CCAAT/enhancer binding protein β (C/EBPβ) forms stable complexes on the CRE site in the presence of CREB-2. Given that C/EBPβ has also been found to interact with Tax, we analyzed the effects of C/EBPβ on viral Tax-dependent transcription. We show here that C/EBPβ represses viral transcription and that Tax is no more able to form a stable complex with CREB-2 on the TxRE site in the presence of C/EBPβ. We also analyzed the physical interactions between Tax and C/EBPβ and found that the central region of C/EBPβ, excluding its ZIP domain, is required for direct interaction with Tax. It is the first time that Tax is described to interact with a basic leucine-zipper (bZIP) factor without recognizing its ZIP domain. Although unexpected, this result explains why C/EBPβ would be unable to form a stable complex with Tax on the TxRE site and could then down-regulate viral transcription. Lastly, we found that C/EBPβ was able to inhibit Tax expression in vivo from an infectious HTLV-I molecular clone. In conclusion, we propose that during cell activation events, which stimulate the Tax synthesis, C/EBPβ may down-regulate the level of HTLV-I expression to escape the cytotoxic-T-lymphocyte response.

Transactivation of the fucosyltransferase VII gene by human T-cell leukemia virus type 1 Tax through a variant cAMP-responsive element

Human T-cell leukemic virus type 1 (HTLV-1)-infected T cells express the fucosyltransferase (Fuc-T) VII gene involved in the biosynthesis of the leukocyte sialyl Lewis X, which may be related to tissue infiltration in patients with malignant adult T-cell leukemia. HTLV-1 induces Fuc-T VII transcription through the viral transactivator Tax, although the underlying molecular mechanism remains unknown. In the present study, we analyzed the role of the cis-activating element in Tax activation using reporter constructs bearing the 5'-regulatory region of Fuc-T VII in Jurkat T cells. A sequence (GGCTGTGGGGGCGTCATATTGCCCTGG) covering a half-palindromic cyclic adenosine monophosphate (cAMP)-responsive element (CRE) was found to be required for Tax activation of the Fuc-T VII promoter. We further demonstrated that transcription factors of the CRE-binding protein (CREB)/activating transcription factor (ATF) family bind to this CRE-like sequence and that Tax binds in association with CREB and the coactivator CREB-binding protein (CBP) in Jurkat T cells. This element, containing the G+C-rich flanking sequences, is homologous to the Tax-responsive viral CREs in the HTLV-1 long terminal repeat (LTR)-promoter. Furthermore, CREM alpha, an isoform of CREB deficient in the glutamine-rich domains, was found to activate the Fuc-T VII promoter in a phosphorylation-independent manner, similar to the viral CRE in HTLV-1 LTR but in contrast to the phosphorylation-dependent activation of the cellular CREs by Tax. These findings indicate that the Fuc-T VII promoter is transactivated by Tax in concert with CBP through a CRE-like sequence in a manner similar to that of viral CRE in HTLV-1 LTR.

Regulation of the 25-hydroxyvitamin D-1alpha-hydroxylase gene and its splice variant.

The 25-hydroxyvitamin D-1alpha-OHase (1alpha-OHase) is responsible for producing the active form of vitamin D, 1alpha,25-dihydroxyvitamin D. The enzyme not only is expressed in kidneys, but also is expressed in many nonrenal tissues, including skin. In this study, we compared the regulation of the 1alpha-OHase expression in kidney cells and keratinocytes. Using transfected luciferase reporter gene constructs, we compared the activity and regulatory features of the human 1alpha-OHase gene promoter in C-21 human kidney cells (PTH/PTHrP receptor positive) and cultured human keratinocytes (NHKs). We found that two regions, -1,100 bp and -396 bp from the ATG, were highly sensitive to parathyroid hormone (PTH) in C-21 cells but not in NHK. Furthermore, three CRE-like sequences (CLS) were identified within this PTH-sensitive area of the 1alpha-OHase promoter and when deleted they reduced induction of PTH by 50%-95% in C-21 cells. To further investigate the differential regulation profile, we examined the protein products of 1alpha-OHase in kidney and skin. Western blot analysis of whole cell extracts from these tissues with a 1alpha-OHase-specific antibody revealed the predicted 1alpha-OHase protein product of 56 kDa in kidney and a larger protein product of 59 kDa in skin. Using RT-PCR for the 1alpha-OHase in skin and kidney, we detected an insertion between exons 2 and 3 in skin but not in kidney. These results suggest that the regulation of renal and skin 1alpha-OHase gene expression may be tissue specific and possibly produce different splice variants, and that this specificity is likely conferred by differential expression of CRE-binding proteins in different cell types. In conclusion, the differential tissue expression of 1alpha-OHase gene variants and the tissue-specific regulation profile open up a new paradigm in the understanding of the role of 25-hydroxyvitamin D3 1alpha-hydroxylase gene in the regulation of vitamin D physiology.

ACTH-induced Nucleocytoplasmic Translocation of Salt-inducible Kinase: IMPLICATION IN THE PROTEIN KINASE A-ACTIVATED GENE TRANSCRIPTION IN MOUSE ADRENOCORTICAL TUMOR CELLS

Salt-inducible kinase (SIK), a serine/threonine protein kinase expressed at an early stage of adrenocorticotropic hormone (ACTH) stimulation in Y1 mouse adrenocortical tumor cells, repressed the cAMP-responsive element (CRE)-dependent gene transcription by acting on the basic leucine zipper domain of the CRE-binding protein (Doi, J., Takemori, H., Lin, X.-z., Horike, N., Katoh, Y., and Okamoto, M. (2002) J. Biol. Chem. 277, 15629-15637). The mechanism of SIK-mediated gene regulation has been further explored. Here we show that SIK changes its subcellular location after the addition of ACTH. The immunocytochemical and fluorocytochemical analyses showed that SIK was present both in the nuclear and cytoplasmic compartments of resting cells; when the cells were stimulated with ACTH the nuclear SIK moved into the cytoplasm within 15 min; the level of SIK in the nuclear compartment gradually returned to the initial level after 12 h. SIK translocation was blocked by pretreatment with leptomycin B. A mutant SIK whose Ser-577, the cAMP-dependent protein kinase (PKA)-dependent phosphorylation site, was replaced with Ala could not move out of the nucleus under stimulation by ACTH. As expected, the degree of repression exerted by SIK on CRE reporter activity was weak as long as SIK was present in the cytoplasmic compartment. The same was true for the SIK-mediated repression of a steroidogenic acute regulatory (StAR) protein-gene promoter, which contained a CRE-like sequence at -95 to -85 bp. These results suggest that in the ACTH-stimulated Y1 cells the nuclear SIK was PKA-dependently phosphorylated, and the phosphorylated SIK was then translocated out of the nuclei. This intracellular translocation of SIK, a CRE-repressor, may account for the time-dependent change in the level of ACTH-activated expression of the StAR protein gene.

A Thyroid-Specific Far-Upstream Enhancer in the Human Sodium/Iodide Symporter Gene Requires Pax-8 Binding and Cyclic Adenosine 3′,5′-Monophosphate Response Element-Like Sequence Binding Proteins for Full Activity and Is Differentially Regulated in Normal and Thyroid Cancer Cells

The sodium/iodide symporter (NIS) gene is highly expressed in the thyroid gland and is important for the diagnosis and radioiodide therapy of differentiated thyroid cancers. We investigated a human NIS (hNIS) gene 5'-far-upstream enhancer (hNUE) (-9847 to -8968). The hNUE is TSH responsive in both FRTL-5 cells and primary normal thyroid cells, but not in human papillary thyroid cancer cells (BHP cells). The hNUE enhanced expression of the basal hNIS promoter 15-fold and required both a Pax-8 binding site and a cAMP response element (CRE)-like sequence for full activity. The hNUE activated transcription in a thyroid-selective and cAMP-dependent manner, mediated by both protein kinase A (PKA)-dependent and PKA-independent pathways. Pax-8 and two CRE-like sequence binding proteins bind to the hNUE. Supershift binding assay indicated that one of the CRE-like sequence binding protein(s) was CRE-binding protein-1, activation transcription factor-1, and/or CRE modulator, and the other was an unknown factor(s) that is absent in BHP 2-7 cells. A far-upstream enhancer is important for hNIS regulation in the thyroid. Deficient CRE-like sequence binding protein(s) that bind to the hNUE in normal thyroid cells may be responsible for reduced NIS gene expression in some thyroid carcinomas.

Evidence for a regulatory role of inducible cAMP early repressor in protein kinase a-mediated enhancement of vitamin D receptor expression and modulation of hormone action.

Parathyroid hormone (PTH) or activators of protein kinase A (PKA) up-regulate the vitamin D receptor (VDR) and augment the induction by 1,25-dihydroxyvitamin D(3) of the expression of target genes (24-hydroxylase and osteopontin) in osteoblastic cells. To understand regulatory mechanisms involved, we asked whether the inducible cAMP early repressor (ICER), which serves as a dominant negative regulator of cAMP-induced transcription in other endocrine systems, may similarly play a role in modulation of vitamin D hormone action. In this study we demonstrate that PTH or 8-bromo-cAMP rapidly induces ICER mRNA and protein in osteoblastic cells. In UMR 106 osteoblastic cells transfected with an expression vector containing the ICER II-gamma coding sequence, cAMP or PTH enhancement of 1,25-dihydroxyvitamin D(3)-induced osteopontin and 24-hydroxylase mRNA and transcription is inhibited. The vitamin D response element is sufficient for the PKA enhancement of VDR-mediated transcription and is also sufficient to observe the inhibitory effect of ICER. Our data indicate that the mechanism of the inhibitory effect of ICER involves an inhibition of PKA-induced VDR transcription, and this inhibition may be mediated in part by binding of ICER to a cAMP response element-like sequence in the VDR promoter. This study provides evidence for the first time that ICER has a key regulatory role in the PKA enhancement of VDR transcription and therefore in the cross-talk between the PKA signaling pathway and the vitamin D endocrine system.

The Rod cGMP-phosphodiesterase β-Subunit Promoter Is a Specific Target for Sp4 and Is Not Activated by Other Sp Proteins or CRX

The beta-subunit of cGMP-phosphodiesterase (beta-PDE) is a key protein in phototransduction expressed exclusively in rod photoreceptors. It is necessary for visual function and for structural integrity of the retina. beta-PDE promoter deletions showed that the -45/-23 region containing a consensus Crx-response element (CRE) was necessary for low level transcriptional activity. Overexpressed Crx modestly transactivated this promoter in 293 human embryonic kidney cells; however, mutation of CRE had no significant effect on transcription either in transfected Y79 retinoblastoma cells or Xenopus embryonic heads. Thus, Crx is unlikely to be a critical beta-PDE transcriptional regulator in vivo. Interestingly, although the beta/GC element (-59/-49) binds multiple Sp transcription factors in vitro, only Sp4, but not Sp1 or Sp3, significantly enhanced beta-PDE promoter activity. Thus, the Sp4-mediated differential activation of the beta-PDE transcription defines the first specific Sp4 target gene reported to date and implies the importance of Sp4 for retinal function. Further extensive mutagenesis of the beta-PDE upstream sequences showed no additional regulatory elements. Although this promoter lacks a canonical TATA box or Inr element, it has the (T/A)-rich beta/TA sequence located within the -45/-23 region. We found that it binds purified TBP and TFIIB in gel mobility shift assays with cooperative enhancement of binding affinity.

The Sko1p repressor and Gcn4p activator antagonistically modulate stress-regulated transcription in Saccharomyces cerevisiae.

In the transcriptional response of Saccharomyces cerevisiae to stress, both activators and repressors are implicated. Here we demonstrate that the ion homeostasis determinant, HAL1, is regulated by two antagonistically operating bZIP transcription factors, the Sko1p repressor and the Gcn4p activator. A single CRE-like sequence (CRE(HAL1)) at position -222 to -215 with the palindromic core sequence TTACGTAA is essential for stress-induced expression of HAL1. Down-regulation of HAL1 under normal growth conditions requires specific binding of Sko1p to CRE(HAL1) and the corepressor gene SSN6. Release from this repression depends on the function of the high-osmolarity glycerol pathway. The Gcn4p transcriptional activator binds in vitro to the same CRE(HAL1) and is necessary for up-regulated HAL1 expression in vivo, indicating a dual control mechanism by a repressor-activator pair occupying the same promoter target sequence. gcn4 mutants display a strong sensitivity to elevated K(+) or Na(+) concentrations in the growth medium. In addition to reduced HAL1 expression, this sensitivity is explained by the fact that amino acid uptake is drastically impaired by high Na(+) and K(+) concentrations in wild-type yeast cells. The reduced amino acid biosynthesis of gcn4 mutants would result in amino acid deprivation. Together with the induction of HAL1 by amino acid starvation, these results suggest that salt stress and amino acid availability are physiologically interconnected.

An autoregulatory function of Dfos during Drosophila endoderm induction.

The endoderm of Drosophila is patterned during embryogenesis by an inductive cascade emanating from the adhering mesoderm. An immediate-early endodermal target gene of this induction is Dfos whose expression is upregulated in the middle midgut by Dpp signalling. Previous evidence based on a dominant-negative Dfos construct indicated that Dfos may cooperate with Dpp signalling to induce the HOX gene labial, the ultimate target gene of the inductive cascade. Here, we examine kayak mutants that lack Dfos to establish that Dfos is indeed required for labial induction. We provide evidence that Dfos acts through a CRE-like sequence, previously identified to be a target for signalling by Dpp and by the Epidermal growth factor receptor (Egfr) in the embryonic midgut. We show that Dfos expression is stimulated by Egfr signalling. Finally, we find that Dfos function is required for its own upregulation. Thus, endoderm induction is based on at least four tiers of positive autoregulatory feedback loops.

The human NAD+-dependent 15-hydroxyprostaglandin dehydrogenase gene promoter is controlled by Ets and activating protein-1 transcription factors and progesterone.

NAD+-dependent 15-hydroxyprostaglandin dehydrogenase (PGDH) is a key catabolic enzyme in the inactivation of PGF2alpha and PGE2 and therefore serves as an important determinant in regulating their local concentrations. To gain insights into the transcriptional regulation of this enzyme, we have isolated 3.5 kb of the 5'-flanking sequence of the human PGDH promoter and characterized its control in hemopoietic cells and cells of myometrial and placental origin. Several potential binding sites for cAMP-responsive element-binding protein (CREB), Ets, and activating protein-1 (AP-1) transcription factors are present within 2368 bp of the 5'-flanking region. This region and deletions thereof were fused to the luciferase reporter gene and used for transient transfection experiments. In Jurkat leukemic T cells, which express PGDH endogenously, the transfected PGDH promoter was strongly induced by phorbol ester. Induction was reversed by coexpression of A-Fos, a dominant negative to AP-1. In primary cultures of myometrial smooth muscle cells (SMC), the Ets family members Ets-1, Ets-2, and PEA3 potently stimulated transcriptional activity of the PGDH promoter. PEA3-mediated activation was partially repressed by A-Fos, suggesting an involvement of AP-1 proteins, which might be conferred by a distal and a proximal Ets/ AP-1 composite element. The distal Ets/AP-1 element is flanked by two CRE-like sequences. Cotransfection of A-CREB, a dominant negative to CREB, inhibited stimulation of PGDH-2368/luc3 by PEA3 in myometrial SMC, whereas treatment with 8-bromo-cAMP moderately enhanced promoter activity. Progesterone is believed to be an important stimulus for PGDH expression in the utero-placental unit, thus contributing to the maintenance of a quiescent uterus during pregnancy. In myometrial SMC, both isoforms of the progesterone receptor, PR-B and PR-A, caused a ligand-dependent activation of PGDH-2368/luc3. Transcriptional activity of PR-B, but not PR-A, was further enhanced by the addition of 8-bromo-cAMP. We could not confirm a recently proposed transcriptional control of PGDH by mineralocorticoid receptor. No effect of mineralocorticoid receptor, in the absence or presence of aldosterone, with or without 8-bromo-cAMP, was observed on PGDH-2368/luc3. Taken together, these findings demonstrate control of the PGDH promoter by multiple pathways and provide evidence for cross-talk among Ets, AP-1, cAMP, and PR-mediated signaling, suggesting complex regulatory mechanisms for the expression of PGDH.

Transcriptional Activation of the Human Manganese Superoxide Dismutase Gene Mediated by Tetradecanoylphorbol Acetate

Transcriptional activation of human manganese superoxide dismutase (MnSOD) mRNA induced by a phorbol ester, 12-O-tetradecanoylphorbol-13-acetate (TPA), was examined to identify the responsive transcriptional regulator. The effect of various deletions and mutations within the 5'-flanking region of the human MnSOD gene promoter was evaluated using the luciferase reporter system in A549 human lung carcinoma cells. Deletion of a region between -1292 and -1202 nucleotides upstream of the transcription start site abolished TPA-responsive induction, whereas deletion of the putative binding sequence for NF-kappaB or AP-1 did not. The region between -1292 and -1202 contains a cAMP-responsive element-like sequence, TGACGTCT, which we identified as the manganese superoxide dismutase TPA-responsive element, MSTRE. Site-specific mutation of the MSTRE abolished the TPA-responsive induction, validating the critical role of this sequence. We detected specific MSTRE activity from nuclear extracts and demonstrated by antibody supershift assay that this activity is closely related to CREB-1/ATF-1. TPA treatment rapidly induced phosphorylation of the CREB-1/ATF-1-like factor via the protein kinase C pathway. These results led us to conclude that the human MnSOD gene having the promoter construct used in this study is induced by TPA via activation of a CREB-1/ATF-1-like factor and not via either NF-kappaB or AP-1. In addition, we found that this induction was blocked by inhibitors of flavoproteins and NADPH oxidases, indicating involvement of enhanced generation of superoxide radical anion as an upstream signal.