Corn Rhizosphere Research Articles

Distinct effects of short-term reconstructed topsoil on soya bean and corn rhizosphere bacterial abundance and communities in Chinese Mollisol.

Eroded black soils (classified as Mollisols) lead to a thinner topsoil layer, reduced organic carbon storage and declined crop productivity. Understanding the changes in soil microbial communities owing to soil erosion is of vital importance as soil microbial communities are sensitive indicators of soil condition and are essential in soil nutrient cycling. This study used the reconstructed facility with 10, 20 and 30 cm topsoil thickness under no-till soya bean–corn rotation in black soil region of Northeast China. Illumina MiSeq sequencing targeting 16S rRNA, qPCR and soil respiration measurement were performed to assess the changes in soya bean and corn rhizosphere bacterial communities, as well as their abundance and activities due to the topsoil thickness. The results showed that soil bacterial communities from both soya bean and corn were more sensitive to topsoil removal than to soil biogeochemical characteristics. Topsoil depths significantly influenced both soya bean and corn bacterial communities, while they only significantly influenced the bacterial abundance and respiration in corn. We also found that the topsoil depths significantly induced the changes in phyla and genera from both soya bean and corn rhizosphere bacterial community, which aid further understandings on how topsoil layer influences the global nutrient cycling of Mollisols by influencing the change in microbial communities.

Exploration and identification of potassium solubilizing rhizo-bacteria isolate colony morphology from corn plant rhizosphere that potentially as a potassium solubilizing biofertilizer

Herdiyantoro D, Simarmata T, Setiawati MR, Nurlaeny N, Joy B, Hamdani JS, Handayani I. 2018. Exploration andidentification of potassium solubilizing rhizo-bacteria isolate colony morphology from corn plant rhizosphere that potentially as apotassium solubilizing biofertilizer. Pros Sem Nas Masy Biodiv Indon 4: 178-183. The availability of potassium (K) in soil for plants isvery low since most (98%) of K elements are in the form of primary silicate minerals such as K-feldspar or fixed in secondary silicateminerals such as 2:1 type clay. Potassium solubilizing rhizo-bacteria (KSRB) can facilitate increased availability of K elements forplants. The purpose of this research was to isolate and identify morphologically the colonies of KSRB isolates from the corn plantrhizosphere as a potential biofertilizer that could facilitate the availability of plant K elements. The research was carried out byexplorative method through sampling of soil rhizosphere of corn cultivated around Experimental Garden of Faculty of Agriculture,Padjadjaran University, Jatinangor (J1, J2, J3, J4 and J5). Serial dilutions using physiological saline solution were carried out to 10-5 toobtain the source of bacterial isolates and then inoculated into a petri dish containing Aleksandrov solid medium (K-feldspar as sole Ksource) ranging from 10-3 to 10-5 by 0,25 mL and 0,50 mL in duplicate. Colonies of bacteria that grow on Aleksandrov solid mediumand produce clear zones were KSRB isolate colonies. The research results showed: (i) The proportion of KSRB isolate colonies obtainedfrom sampling point J1, J2, J3, J4 and J5 were 33% (8% clear, 25% white), 100% (92% clear, 8% white), 33% (8% clear, 25% white),33% (8% clear, 25% white) and 8% (8% white); (ii) The main morphological features of KSRB isolate colonies were: (a) clear coloredcolonies (shape: rounded, edge: slippery, elevation: convex, size: small to large, and produce clear zone) and (b) white colored colonies(shape: rounded with spread edges, edge: like wool, elevation: arise, size: small, and produce clear zone); and (iii) Colonies of KSRBDHJ2isolates dominated the acquisition of KSRB isolate colonies with the main morphological characteristic of clear colored colonies.

Identification of a biocontrol agent Bacillus vallismortis BV23 and assessment of effects of its metabolites on Fusarium graminearum causing corn stalk rot

ABSTRACTCorn stalk rot, caused by Fusarium graminearum, is one of the most destructive diseases of maize in many regions of the world. A bacterial strain BV23 was isolated from corn rhizosphere that reduced corn stalk rot significantly in greenhouse studies in 2016 and 2017. BV23 was identified as Bacillus vallismortis, which showed antagonistic effects against a number of fungal pathogens, including F. graminearum, Rhizoctonia solani, Athelia rolfsii, and Thanatephorus cucumeris. BV23 had the greatest fungistatic effect on F. graminearum, inhibiting mycelial growth by 66.2%, conidial germination by 90.1%, and conidial production by 86.7%. The probable antifungal mechanism was assessed by examining the morphology and ultrastructure of F. graminearum hyphae. Treatment by BV23 culture supernatant resulted in coarser hyphae, induced cytoplasmic granulation, and increased cell membrane permeability of F. graminearum, causing cytoplasm leakage. These effects became increasingly obvious with increasing concentration (1%, 5% and 10%). Furthermore, the antifungal active substances were sensitive to heat.

Genome Sequence of a Plant Growth-Promoting Rhizobacterium, Pseudomonas sp. Strain 31-12.

We present here a draft genome sequence of Pseudomonas sp. strain 31-12, a plant growth-promoting rhizobacterium of several crop plants that was isolated from the rhizosphere of corn in southern Ontario, Canada.

Streptomyces flavalbus sp. nov., an actinobacterium isolated from rhizosphere of maize (Zea mays L.).

A novel actinobacterium, designated strain NEAU-QY24T, was isolated from the rhizosphere of corn (Zea mays L.). A polyphasic approach was employed to determine the taxonomic status of strain NEAU-QY24T. The isolate was found to have chemical and morphological properties of the genus Streptomyces, with high 16S rRNA gene sequence similarity to Streptomyces lanatus JCM 4332T (98.3%) and clustered phylogenetically with Streptomyces lannensis JCM 16578T (98.2%). The cell wall was found to contain meso-diaminopimelic acid and the whole cell sugars were identified as glucose and ribose. The predominant menaquinones were identified as MK-9(H6), MK-9(H4) and MK-9(H8). The phospholipid profile was found to consisted of diphosphatidylglycerol, phosphatidylethanolamine and phosphatidylinositol. The major fatty acids were identified as iso-C16:0, C16:0, anteiso-C17:0 and C15:0. A combination of DNA-DNA hybridization experiments and phenotypic tests were carried out between strain NEAU-QY24T and its closely related strains, which clarified their relatedness and demonstrated that strain NEAU-QY24T could be distinguished from these strains. These data indicate that the isolate should be recognised as a new species of the genus Streptomyces, for which the name Streptomyces flavalbus sp. nov. is proposed. The type strain is NEAU-QY24T (=CGMCC 4.7400T=DSM 104539T).

Вплив нових вітчизняних добрив і регуляторів росту рослин на мікробіологічні процеси в ґрунті

The purpose. To investigate effect of new organo-mineral fertilizers and growth regulators of plants on microbiological processes in soil. Methods. Stationary and short-term field and laboratory probes. Conventional methods of probes are applied, as well as dispersing, correlative, and variational analysises are used. Results. At application of new organo-mineral fertilizers and growth regulators of plants the content of general microbial mass in soil of rhizosphere of corn and soya bean increased, phytotoxicity of soil dropped, numerosity of microorganisms-amonificators decreased. Conclusions. Application of new OMF and GRP stimulated growth of nitrogen-fixing organisms, enriched soil with accessible to plants joints of nitrogen.

CORN ROOT AREA MYСOCENOSIS UNDER THE INFLUENSE OF CHAETOMIUM GLOBOSUM AS DESTRUCTOR OF STRAW

Quantitative and qualitative composition offungi in the rhizosphere soil of corn wasstudied. It was shown that introduction of strawinto the soil resulted in an increase the numberof representatives of Fusarium Link and Bipolaris Shoemaker genus, which often includephytopathogenic and phytotoxic fungi, whichcan affect plants, reducing crop yield andquality. It has been established that applicationof Chaetomium globosum 377 fungus as destructor of wheat straw leads to the decrease inrhizosphere of corn plants the number ofrepresentatives of these genus and an increasein Trichoderma Pers ex Fr. Thus application ofC. globosum 377 as destructor of plant residuesupports to increase the antagonistic potentialof corn rhizosphere soil and protect plants frompathogens.

Kompatibilitas Sumber Inokulan Fungi Mikoriza Arbuskular pada Kedelai dengan Budidaya Jenuh Air

The main problem encountered by soybean crop in acid sulfate tidal lands is less availability of P, because of its chemical bond with Fe. Heavy dose of fertilization often lead to high fertilizer residue, wich could be used for crops farming using AMF. Research was conducted to study the effect of soybean culturing technique and AMF inoculants source on growth of soybean. The treatments consisted two factors, arranged in a randomized block design with three replications. The first factor was four inoculants sources of AMF, namely AMF and without inoculation AMF, inoculants from rhizospheres of kudzu (Pueraria javanica), sorghum (Sorghum bicolor), corn (Zea mays) and soybean (Glycine max). The second factor was culturing tehnique, namely water saturated and dry soil culture. Soybeans were grown in pots containing 5 kg soil derived from tidal land, Simpang Village, District of Berbak, East Tanjung Jabung Regency, Jambi Province. Results showed that the interaction saturated soil culture with inoculants from corn’s rhizosphere had positive effect on the variability of N, P and K uptake, N and P content in the plant, relative efficiency of inoculants and relative efficiency of P uptake, stem diameter, biomass dry weight, the number of filled pods and seed dry weight of soybeans. Dry soil culture with inoculants of corn’s rhizosphere had greater root colonization, but overall for the growth and grain yield of soybean, saturated soil culture with inoculants from corn rhizosphere has better effect on other growth variables.

Changes of the Microbial Community in Corn Soil Due to the Synergism Zeolite-Mineral Fertilizers

Microbial communities in agricultural ecosystems are characterized by a strong dynamic and radical change due to technological inputs applied. Corn is cultivated on large areas with high requirements for nutrients and an increased potential for activation of specific microbial groups. The aim of this study was to assess the unilateral and synergic effect of zeolite and mineral fertilizers on the development and transformation of microbial functional groups in the rhizosphere of corn. Physiological profile assessment of microbial communities has been carried out on the basis of substrate induced respiration, monitored over a period of 6 hours of incubation. The amount of CO2 registered in Microresp plates represents the activity of functional groups in decomposition of each type of substrate applied. Characteristic groups of microorganisms in maize rhizosphere are capable of decomposing acids: citric, L-malic, oxalic and α-Ketoglutaric. These substrates indicate the presence of high concentrations of organic matter in soil and the existence of a biological crust on the surface (citric acid), respectively the existence of powerful processes for the decomposition of organic material by actinomycetes (α-Ketoglutaric acid). The highest microbial activities were observed in groups of bacteria involved in processes of plant growth promotion and microbial groups with an important role in the processes of denitrification (oxalic acid). For the application of urea a triple value of activity of this type of microflora is observed. Functional groups codominant in soils cultivated with corn are specialized in efficient degradation of organic matter and biological crust, zeolite providing the complex substrate necessary for the development of these microorganisms.

Structure of bacterial communities in soil following cover crop and organic fertilizer incorporation.

Incorporation of organic material into soils is an important element of organic farming practices that can affect the composition of the soil bacterial communities that carry out nutrient cycling and other functions crucial to crop health and growth. We conducted a field experiment to determine the effects of cover crops and fertilizers on bacterial community structure in agricultural soils under long-term organic management. Illumina sequencing of 16S rDNA revealed diverse communities comprising 45 bacterial phyla in corn rhizosphere and bulk field soil. Community structure was most affected by location and by the rhizosphere effect, followed by sampling time and amendment treatment. These effects were associated with soil physicochemical properties, including pH, moisture, organic matter, and nutrient levels. Treatment differences were apparent in bulk and rhizosphere soils at the time of peak corn growth in the season following cover crop and fertilizer application. Cover crop and fertilizer treatments tended to lower alpha diversity in early season samples. However, winter rye, oilseed radish, and buckwheat cover crop treatments increased alpha diversity in some later season samples compared to a no-amendment control. Fertilizer treatments and some cover crops decreased relative abundance of members of the ammonia-oxidizing family Nitrosomonadaceae. Pelleted poultry manure and Sustane® (a commercial fertilizer) decreased the relative abundance of Rhizobiales. Our data point to a need for future research exploring how (1) cover crops influence bacterial community structure and functions, (2) these effects differ with biomass composition and quantity, and (3) existing soil conditions and microbial community composition influence how soil microbial populations respond to agricultural management practices.

English

ABSTRACT Aspergillus flavus is one type of fungus that often cause problems in the field of agriculture and animal husbandry. Biological control is necessary in order to reduce the use of synthetic fungicides which have good side effect on humans and the environment. Exploratory research that has been done shows a candidate isolate potential to inhibit the growth of Aspergillus flavus. These isolates, isolated from the rhizosphere of corn and is named Trichoderma sp. TKD. The purpose of this study was to determine the species of Trichoderma sp. TKD and its ability in inhibiting the A. flavus FNCC6109. Identification of Trichoderma sp. TKD was done macroscopically, microscopically and molecularly using internal transcribed spacer region (ITS 5 F: 5 '- ¬GAAGTAAAAGTCGTAACAAGG-- 3' and ITS 4 R: 5 '- TCCTCCGCTTATTGATATGC - 3'). The test of the inhibitory power used dual culture method. The results showed Trichoderma sp. TKD isolated from the rhizosphere of corn was identified as Trichoderma asperellum and had the potential to inhibit the growth of A. flavus FNCC6109 at 98.849±1.100%. Keywords: Aspergillus flavus FNCC6109, Trichoderma sp.TKD, Aflatoxin

Nonomuraea zeae sp. nov., isolated from the rhizosphere of corn (Zea mays L.).

A novel actinobacterium, designated strain NEAU-ND5T, was isolated from the rhizosphere of corn (Zea mays L.) collected in Heilongjiang Province, north-east China, and characterized using a polyphasic approach. 16S rRNA gene sequence analysis showed that strain NEAU-ND5T was a member of the genus Nonomuraea, with highest sequence similarities to Nonomuraea jabiensis A4036T (98.29 %), Nonomuraea rosea GW12687T (98.25 %), Nonomuraea candida HMC10T (98.22 %), Nonomuraea rhizophila YIM 67092T (98.04 %) and Nonomuraea kuesteri NRRL B-24325T (98.04 %). Similarities to other type strains of the genus Nonomuraea were lower than 98 %. Morphological and chemotaxonomic properties of strain NEAU-ND5T were also consistent with the description of the genus Nonomuraea. The cell wall contained meso-diaminopimelic acid and the whole-cell sugars were glucose, ribose and madurose. The phospholipid profile consisted of diphosphatidylglycerol, phosphatidylmonomethylethanolamine, phosphatidylethanolamine, hydroxy-phosphatidylmonomethylethanolamine, hydroxy-phosphatidylethanolamine, phosphatidylinositol and phosphatidylinositol mannoside. The major menaquinones were MK-9(H4), MK-9(H2) and MK-9(H0). The predominant cellular fatty acids were iso-C16:0 and 10-methyl C17:0. A combination of DNA-DNA hybridization results and some phenotypic characteristics demonstrated that strain NEAU-ND5T was clearly distinguished from its closely related Nonomuraea species. Consequently, it is concluded that strain NEAU-ND5T represents a novel species of the genus Nonomuraea, for which the name Nonomuraea zeae sp. nov. is proposed. The type strain is NEAU-ND5T (=CGMCC 4.7280T=DSM 100528T).

Changes in rhizosphere bacterial gene expression following glyphosate treatment

In commercial agriculture, populations and interactions of rhizosphere microflora are potentially affected by the use of specific agrichemicals, possibly by affecting gene expression in these organisms. To investigate this, we examined changes in bacterial gene expression within the rhizosphere of glyphosate-tolerant corn (Zea mays) and soybean (Glycine max) in response to long-term glyphosate (PowerMAX™, Monsanto Company, MO, USA) treatment. A long-term glyphosate application study was carried out using rhizoboxes under greenhouse conditions with soil previously having no history of glyphosate exposure. Rhizosphere soil was collected from the rhizoboxes after four growing periods. Soil microbial community composition was analyzed using microbial phospholipid fatty acid (PLFA) analysis. Total RNA was extracted from rhizosphere soil, and samples were analyzed using RNA-Seq analysis. A total of 20–28 million bacterial sequences were obtained for each sample. Transcript abundance was compared between control and glyphosate-treated samples using edgeR. Overall rhizosphere bacterial metatranscriptomes were dominated by transcripts related to RNA and carbohydrate metabolism. We identified 67 differentially expressed bacterial transcripts from the rhizosphere. Transcripts downregulated following glyphosate treatment involved carbohydrate and amino acid metabolism, and upregulated transcripts involved protein metabolism and respiration. Additionally, bacterial transcripts involving nutrients, including iron, nitrogen, phosphorus, and potassium, were also affected by long-term glyphosate application. Overall, most bacterial and all fungal PLFA biomarkers decreased after glyphosate treatment compared to the control. These results demonstrate that long-term glyphosate use can affect rhizosphere bacterial activities and potentially shift bacterial community composition favoring more glyphosate-tolerant bacteria.

Mineral Phosphate Solubilizing Bacteria Isolated from Various Plant Rhizosphere under Different Aluminum Content

The objectives of this study was to isolate and characterize the mineral phosphate solubilizing bacteriafrom rhizosphere and evaluate their potential as plant growth promoting bacteria in Al-toxic soils. The halozone formation method was used to isolate PSB using the media containing insoluble phosphates (Ca-P or Al-P)as a source of phosphate. Eight of acid and Al-tolerant PSB isolates that were able to solubilize Ca-P wereobtained from rhizosphere of clover, wheat, corn, and sunflower grown in Al-toxic soil. Identification of theisolates based on the 16S rRNA gene sequence analysis demonstrated that the isolates were strains of Burkholderia(5 strains), Pseudomonas (1 strain), Ralstonia (1 strain), and unidentified bacterium (1 strains). All PSB isolatesshowed the capability to dissolve Ca-P, and only 1 strain (Ralstonia strain) was able to dissolve Al-P in agar platemedium. The P-solubilization by these isolates was correlated with pH of medium. Inoculation of the bacterialstrains on clover on Al-toxic medium showed that all isolates increased the plant dry weight compared withuninoculated treatment. Our results showed that those PSB isolates have potential to be developed as a biofertilizerto increase the efficiency of P-inorganic fertilizer used in Al-toxic soils.

Rhizosphere-induced weathering of minerals in loess-derived soils of Golestan Province, Iran

Weathering of minerals is the major source of nutrients to plants. The rhizosphere can play a central role in the weathering of minerals through the release of acid exudates that drive hydrolysis of minerals. Although many studies have examined the weathering of pure natural industrial minerals in rhizosphere, information on the weathering of clay and silt minerals from soils is limited. This study examined the weathering and K release of minerals in clay and silt fraction in the rhizosphere of corn. Growth medium was a mixture of quartz sand as filling materials and clay and silt fraction of four dominant soils formed on loess parent material with different characteristics (i.e., Aridisols, Alfisols, Inceptisols and Mollisols). During 100days of the experiment, plants were irrigated with distilled water and complete and K-free nutrient solution as needed. At the end of cultivation, plants were harvested and their K uptake was measured. Clay and silt fractions were separated from quartz sand and analyzed by X-ray diffraction (XRD) and XRF both before and after the experiment. Intense weathering of mica and chlorite was observed in silt fraction of Aridisols and Mollisols. The high acidity of the rhizosphere induced by root exudates has resulted in the release of structural K from mineral lattice. In contrast to the silt fraction, the X-ray patterns of the clay fraction showed minor changes following plant growth such as the formation of mixed layer mica-vermiculite and vermiculite. The K content extracted by corn was significantly greater for silt than the clay sizes. The highly weatherable silt sized minerals therefore, could be regarded as the major source of nutrients to plants.

Comparison of root system architecture and rhizosphere microbial communities of Balsas teosinte and domesticated corn cultivars

The progenitor of maize is Balsas teosinte (Zea mays subsp. parviglumis) which grows as a wild plant in the valley of the Balsas river in Mexico. Domestication, primarily targeting above-ground traits, has led to substantial changes in the plant's morphology and modern maize cultivars poorly resemble their wild ancestor. We examined the hypotheses that Balsas teosinte (accession PI 384071) has a) a different root system architecture and b) a structurally and functionally different rhizosphere microbial community than domesticated cultivars sweet corn (Zea mays subsp. mays accession PI 494083) and popping corn (Zea mays subsp. mays accession PI 542713). In a greenhouse experiment, five plants from each corn variety were grown in individual pots containing a Maury silt loam – perlite (2:1) mixture and grown to the V8 growth stage at which rhizosphere bacterial and fungal community structure was assessed using terminal restriction fragment length polymorphism and fatty acid methyl ester analysis. Functional characteristics of the rhizosphere were assayed by examining the potential activity of seven extracellular enzymes involved in carbon, nitrogen and phosphorus cycling. Root system architecture was characterized by root scans of sand grown plants at the V5 growth stage. Compared to the control the sweet corn rhizosphere had different bacterial and fungal community structure, decreased fungal diversity and increased bacterial abundance. Teosinte caused a significant change in the rhizosphere bacterial and fungal community structure and increased bacterial abundance, but no significant decrease in bacterial or fungal diversity where the former was found to be significantly greater than in the sweet corn rhizosphere. Popping corn did not trigger significant changes in the bacterial or fungal diversity and bacterial abundance in the soil. The individual popping corn plants changed the bacterial and fungal communities in different directions and the overall effect on community structure was significant, but small. Of the enzymes analyzed, potential N-acetylglucosaminidase (NAG) activity was found to contributed most to the differentiation of teosinte rhizosphere samples from the other corn varieties. The teosinte root system had proportionally more very fine (diameter < 0.03 mm) roots than popping corn and sweet corn and it developed the highest root to shoot dry weight ratio, followed by popping corn. Sweet corn had significantly lower average root diameter than popping corn and teosinte and grew proportionally the least below-ground dry mass. The results allude to functional and structural differences in the rhizosphere microbial communities of the corn varieties that, with additional research, could lead to useful discoveries on how corn domestication has altered rhizosphere processes and how plant genotype influences nutrient cycling.

Complete Genome Sequence of Paenibacillus polymyxa CR1, a Plant Growth-Promoting Bacterium Isolated from the Corn Rhizosphere Exhibiting Potential for Biocontrol, Biomass Degradation, and Biofuel Production

Here we report the complete genome sequence of the bacterium Paenibacillus polymyxa CR1 (accession no. CP006941), which consists of one circular chromosome of 6,024,666 bp with 5,283 coding sequences (CDS), 87 tRNAs, and 12 rRNA operons. Data presented will allow for further insights into the mechanisms underpinning agriculturally and industrially relevant processes.

Enhancement of growth and yield of upland rice (Oryza sativa L.) by Actinomycetes

G room and greenhouse experiments examined the potential of actinomycetes as microbial inoculant to improve the yield of upland rice. Fifty-nine isolates from rice and corn rhizosphere and existing collection of the National Institute of Molecular Biology and Biotechnology (BIOTECH) were screened for growth promoting activities. Thirty-two isolates produced indoleacetic acid (IAA), fourteen of which showed ACC deaminase activity while twenty-four solubilized bound phosphate in vitro. Five isolates were selected from among 59 isolates evaluated for further study. The selected isolates were subjected to morphological and 16S rDNA analysis to establish isolates identity. Based on morphology and 16S rDNA analysis, the probable identities of the selected isolates with their corresponding percent identity are as follows: YB6y, Actinomycetales bacterium-95%; AVermi3, uncultured Actinomyces-96%; AVermi7, Streptomyces sp-95%; NB1, Rhodococcus sp-95%; NB3, Streptomyces mutabilis-98%. In the growth room, the selected actinomycetes increased root dry weight of upland rice by 24 to 71% at 14 days after sowing (DAS). All five isolates were rhizosphere competent as indicated by the root colonization study. Actinomycetes colonized the roots of upland rice with population densities ranging from 5.9 x 105 to 1.2 x 107 CFU g-1 rhizosphere soil with R:S ratios of 0.8 to 1.1. At 30 DAS, actinomycete isolate NB3 population in the rhizosphere increased 100-fold with R:S ratio of 1.08. In the greenhouse, NB3 combined with full rate of fertilization, had the highest shoot biomass. At full rate of fertilization, inoculation with NB1, AVermi7, YB6y and NB3 significantly increased P uptake by 80 to 136% over the uninoculated control. Inoculation with NB3 and AVermi7 significantly increased grain yield by 62% and 48% respectively, relative to uninoculated treatment. The significant increase in grain yield by NB3 and AVermi7 and their ability to colonize the rhizosphere demonstrate the potential of these actinomycetes as plant growth-promoting inoculants for upland rice. However, field assessment is recommended to determine the effect of biotic and abiotic stresses in the performance of promising actinomycetes.

Increased microbial activity and nitrogen mineralization coupled to changes in microbial community structure in the rhizosphere of Bt corn

The interactions between plant roots and soil microorganisms are essential for the function and stability of ecosystems, primary agricultural production and plant health. Despite the importance of soil microbes the response of these microbes to large-scale cultivation of genetically modified (GM) crops is still poorly understood. This study evaluated the potential impact of two lines of transgenic Bt maize on rhizosphere microorganisms. A time-course field experiment was conducted over a period of two years in two fields in Guadalajara (Spain) with monthly sampling from April to September. Rhizosphere soil was collected from transgenic (TG) and unmodified (WT) maize plants from each field and sampling time for the analysis of several important functional and structural soil quality parameters. Total microbial activity, as determined by H3-Thymidine and C14-Leucine incorporation, was found to be higher in the rhizospheres of the transgenic plants. Similarly, differences in potential ammonification and nitrification were observed in the second year of the study. In contrast, bacterial and fungal microbial catabolic abilities, as determined by Biolog ECO and FF plate analyses, respectively, were more influenced by sampling time than the transgenic nature of the plants. Microbial community structure was also studied by bacterial and phylum-specific PCR-DGGE and PCR cloning approaches. In general, differences were again more pronounced between sampling times, as opposed to between TG versus WT plants, although marked differences were observed within the Betaproteobacteria between plant lines. For the first time it describes the presence of Iamiaceae family in soil, specifically to TG plant rhizosphere. To summarize, the study showed that some important properties of rhizopshere microbes may be impacted by Bt maize cultivation and highlighted the fact that such potential effects need to be viewed within the context of seasonal and spatial variability.

Soil microbial properties in Bt (Bacillus thuringiensis) corn cropping systems

Growing Bt crops reduces the use of insecticides applied to them, but these crops could affect soil microorganisms and their activities. We evaluated the effects of Bt (Cry1Ab) corn (Zea mays L.) and deltamethrin ([S]-α-cyno-3-phenoxybenzyl [1R, 3R]-3-[2,2-dibromovinyl]-2,2-dimethylcyclopropane-1-carboxylate) insecticide application on soil microbial biomass C (MBC), β-glucosidase enzyme activity (final season only), bacterial functional diversity, and bacterial community-level physiological profiles (CLPPs) in corn monoculture in five seasons. We also determined if growing Bt corn in crop rotation would alter these effects. Statistical analysis of pooled data across seasons did not show any effects of Bt technology, insecticide application or crop rotation on soil microbial biomass or diversity even though differences between seasons and between the rhizosphere and bulk soil were observed. Annual analyses of results also showed that neither the Bt technology nor insecticide application affected soil MBC, enzyme activity, or functional diversity of bacteria in corn rhizosphere, but shifts in bacterial CLPPs due to Bt trait were observed in one year. Crop rotation effects on soil microbial properties were not observed in most cases. Where effects were observed, Bt corn grown in rotation resulted in greater MBC, enzyme activity and functional diversity than Bt corn grown in monoculture or conventional corn grown in rotation, and these effects were observed only in bulk soil. Therefore, the Bt technology is safe with respect to the non-target effects measured in this study. However, the effects of repeated use of Bt crops over many years on the soil environment should continue to be monitored.