Cord Blood Treg Research Articles

Cord Blood Regulatory T Cells Prevent Mutiple Myeloma Progression By Suppressing Inflammation

Introduction: Regulatory T cells (Tregs) are potent immunosuppressors and are being developed as adoptive immunotherapy for inflammatory disorders and autoimmune diseases. Specifically, cord blood (CB) Tregs are emerging as a promising treatment for graft vs. host disease (GVHD) as well as immune mediated bone marrow failure disorders including aplastic anemia, hypoplastic myelodysplasia and primary myelofibrosis. We and others have shown that when compared to peripheral blood (PB), CB Tregs have a higher expression of Helios, a marker of thymic Tregs; exert superior suppression on proliferating conventional T cells and do not secrete inflammatory IL-17 or express RORүt under stressful conditions. Such a stable suppressor profile coupled with their ready availability as an off-the-shelf product positions CB Tregs to be a very attractive therapeutic agent. Since multiple myeloma, a plasma cell clonal malignancy, exists in an inflammatory microenvironment of hematopoietic and non-hematopoietic cells which is likely related to disease progression, we hypothesized that adoptive therapy with CB Tregs may block myeloma progression by exerting their anti-inflammatory function. Methods: We used the NOD-SCID IL2rγnull (NSG) mice to first establish the myeloma tumor model, where mice were injected intravenously via tail vein with 3 x 106 Firefly luciferase labeled MM1S cells. For generating CB Tregs for adoptive therapy, Treg cell enrichment was performed from the whole CB unit using CD25+ magnetic beads and LS column (MIltenyl) followed by continuous culture in the presence of CD3/28 T-cell activator beads, and human recombinant interleukin-2 for 14 days. Expanded CB Treg phenotype was confirmed using flow cytometry analysis and the in-vitro suppressive capacity was assessed by CellTrace Violet Cell Proliferation assay. The mice were injected intravenously via tail vein with Firefly luciferase labeled MM1S cells on day 0 with or without 10 x 106 ex-vivo expanded CB Treg cells on day -1. We monitored the progression of MM1S cells by in vivo bioluminescence imaging (BLI) using the IVIS imaging system (Xenogen) 10 minutes after intraperitoneal injection of D-luciferin. Imaging data were analyzed and quantified with Living Image Software (Xenogen). We also assessed the weight and survival as well as the plasma cytokines levels. At the time of euthanasia, organs were harvested and analyzed for myeloma burden by using immunohistochemistry as well as flow analysis. Results: The expanded CB Tregs showed a consistent phenotype of CD4+25+127-FoxP3high and more than 80% suppression of the proliferating conventional T cells (Tcons). The progression of MM1S cells in the mice injected with CB Treg (n=9) was significantly delayed as shown in figure 1A, where minimal evidence of myeloma cells is visualized on day 31 compared to widespread tumor in the control arm (n=9). CB Treg recipients preserved their weight for a longer time (Figure 1B) and had improved overall survival (p=0.039) (Figure 1C). The prevention of development of myeloma by CB Tregs correlated with the lower levels of the inflammatory cytokine, interleukin-6 (IL-6) (murine) especially on day 35 post myeloma inoculation (Figure 1D). The circulating myeloma cells in the CB Treg recipients were significantly lower as compared to control mice. Upon euthanasia on day 25 post inoculation, myeloma cells were barely detectable in bone marrow and spleen in the CB Treg recipients as compared to large tumor burden in the control arm (Figure 1E). Conclusions: Our results demonstrate that ex-vivo expanded CB Treg cells prevent the growth of myeloma cells in a xenogenic model via suppression of inflammatory cytokines such as IL-6. These data provide additional insight to the underpinnings of myeloma progression and may contribute to the development of the novel immunotherapies in the future. Figure 1 Disclosures Shah: University of California, San Francisco: Employment; Genentech, Seattle Genetics, Oncopeptides, Karoypharm, Surface Oncology, Precision biosciences GSK, Nektar, Amgen, Indapta Therapeutics, Sanofi: Membership on an entity's Board of Directors or advisory committees; Indapta Therapeutics: Equity Ownership; Celgene, Janssen, Bluebird Bio, Sutro Biopharma: Research Funding; Poseida: Research Funding; Bristol-Myers Squibb: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees; Amgen: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees; Nkarta: Consultancy, Membership on an entity's Board of Directors or advisory committees; Kite: Consultancy, Membership on an entity's Board of Directors or advisory committees; Teneobio: Consultancy, Membership on an entity's Board of Directors or advisory committees. Orlowski:Poseida Therapeutics, Inc.: Research Funding. Parmar:Cellenkos Inc.: Equity Ownership, Membership on an entity's Board of Directors or advisory committees, Research Funding.

Phase I Clinical Trial of CK0801 (cord blood regulatory T cells) in Patients with Bone Marrow Failure Syndrome (BMF) Including Aplastic Anemia, Myelodysplasia and Myelofibrosis

Background: Aplastic anemia is an autoimmune disease of the bone marrow (BM) characterized by defective and decreased regulatory T cells (Tregs) which results in unchecked cytotoxic T cell mediated bone marrow suppression [1]. In a xenogeneic model of induce BM aplasia, adoptive therapy with cord blood (CB) Tregs reverses such a defect (Fig 1A). Furthermore, as compared to peripheral blood (PB), CB Tregs show a higher expression of Helios, a marker of thymic derived Tregs (Fig 1B) and CB Tregs exert a superior suppression of proliferating conventional T-cells in CFSE assay (Fig 1C). In a xenogeneic mouse model of GVHD, CB Tregs can exert suppression across HLA barrier resulting in survival benefit (Fig 1D); and in another xenogenic lupus model, a single dose of CB Tregs results in significant decrease in circulating effector T cells (Fig 1E) up to 8 weeks. Furthermore, under stressful conditions of continued culture in the presence of inflammatory cytokines including IL15 and IL23, CB Tregs do not secrete IL-17 or express RORγt, a concern of plasticity that plagues PB Tregs (Fig 1F). In fact, CB Tregs increase their secretion of the suppressor cytokine, IL-10 in response to inflammatory stress, which supports our hypothesis, that CB Tregs based adoptive therapy can have wide application and can be used to treat inflammatory disorders. Therefore, we hypothesized that adoptive therapy with CB Tregs can be utilized as treatment for the inflammatory bone marrow failure (BMF) disorders including aplastic anemia, hypoplastic myelodysplasia and primary myelofibrosis. Study Design and Methods: We have now launched a phase I clinical trial examining the role of single infusion of CK0801, an allogeneic, fresh CB Treg product, utilizing novel process development that consist of well-defined qualification criteria for the starting material (cord blood units), parameters for manufacturing and culture-expansion; and well-defined analytic testing and lot release criteria, for the treatment of BMF, where 3 doses are examined: i) dose level I: 1x106 cells/kg; ii) dose level II: 3x106 cells/kg and iii) dose level III: 10x106 cells/kg (NCT03773393). The study follows 3+3 phase I design where 3 patients will be treated at dose level I. If no DLT is observed, then the dose will be escalated to dose level II and if no DLT is observed, then the dose will be escalated to dose level III. If 1 DLT is observed at a dose level, then 3 additional patients will be treated at that level. If no additional DLTs, then that dose level will be defined as MTD. If ≥2DLTs are observed at dose level II or III, then prior dose level is defined as MTD. If ≥2DLTs at dose level I, then DSMB will review and evaluate for study continuation. MTD will be decided when 6 patients are treated at a dose level with < 2 DLTs. The eligibility criteria include: i) diagnosis of aplastic anemia, myelodysplastic syndrome or myelofibrosis, ii) Age > 18 years, iii) cord blood unit matched at HLA 3 out of 6 with the patient for generation of CK0801. The primary endpoint includes dose limiting toxicity (DLT) as defined by i) severe (grade 3 or 4) infusion toxicity within 24 hours; ii) regimen related death within 30 days or iii) severe (grade 3 or 4) cytokine release syndrome within 30 days. The secondary endpoints include i) disease-specific response including complete remission, transfusion independence and hematologic improvement and ii) duration of response. The exploratory endpoints include assessment of PB and BM immune reconstitution and inflammatory cytokines at baseline and scheduled follow ups of Days 0, +1, +3, +7, +14, +21, +30, +60, +90, +180 and +365 in the post-treatment setting. These studies will include T cell compartment analysis: Treg, Effector T cells, T-cell anti-viral activity. Serum will be analyzed for inflammatory cytokines: IL1, IL2, IL4, IL6, IL7, IL8, IL10, IL17, IFN-gamma, ST2, REG3a, OPN, Follistatin, Elafin, TGF-beta. Optional exploratory cytokines: SCF, G-CSF, GM-CSF, HGF, VEGF, SDF1a, MCP1, MCP2, TARC, MIP3a, TECK, CTACK, CCL28, FGF, PDGF, EGF, TGF-α, TLR. The first patient is already consented with a planned total of 9 patients.

Novel CD4+CD8+ Umbilical Cord Blood Regulatory T Cells

Background: Regulatory T cells (Treg), a well defined suppressor cell population with the phenotype of CD4+CD25+CD127- FoxP3+ are emerging as a promising adoptive therapy for a diverse subset of autoimmune diseases and inflammatory disorders. Specificlaly, cord blood (CB) Tregs have been shown to be superior to peripheral blood (PB) Tregs in their function and stability. Here, we define a novel subset of CB Tregs CD4+CD8+CD25+CD127- FoxP3+ that is not very well defined in the PB population and explore its' differentiation characteristics. Method: Tregs were isolated from CB or PB as described previously and cultured in the presence of CD3/28 beads and IL-2. On the day of harvest, cells were further sorted for CD8+ cell population and labelled as CD8+CD4+ (double positive CB Tregs: DP) and the leftover fraction as CD8-CD4+ (single positive CB Tregs: SP). Cells fractions were analyzed using flow cytometry and for cytokine assay, cells were activated (5 hours) with 1X Cell Stimulation Cocktail with Golgi inhibitors and stained for IFN-γ, IL-4, IL-17, IL-10 or TGFβ1 as per manufacturer's instructions. Additional cytokine assay was performed on the culture supernatants. DNA methylation assay was performed for the TSDR region as per manufacturer's instructions. Single cell RNAseq was performed at Albert Einstein Hospital and analyzed at Methodist Hospital. A threshold for original counts were applied to all four conditions, i.e. only transcripts with original counts>10 in all four. This step reduced the number of genes from 34626 to 16628; subsequently stringent cutoffs pairs showed two sets of genes- 1) Fold change>1.5, p-value<0.1, and 2) Fold change<2/3, p-value<0.1, this led to 73 rows, all with defined transcript names. Enrichment analysis using ConsensusPathDB for the above two gene sets were run to identify all pathways with at least one member-gene overlapping with either list, and the enrichment p-value for the pathway<0.1. Result: We cultured the Tregs isolated from CB or PB for 14 days and no evidence of a DP Tregs (0) was seen in PB as compared to a clearly defined DP Treg (8-26%) population in CB cultures. No differences were seen between the SP and DP CB Tregs in terms of the markers for mechanisms of suppression (FoxP3,Helios,CD39 ), homing (PSGL1, CLA, CD62L, CD49d), TGF-beta signaling (LAP, TGF-beta, GARP) and T cell signaling (LAG23, PD1, Icos, Tim3, CTLA-4, GITR). DP CBTregs consisted of a significantly higher expression of CCR4hiCXCR3hiCD95hipopulation. DP CB Tregs demonstrated a significantly higher IL-10 secretion compared to SP CB Tregs (Fig 1A) which correlated with the level of IL-10 secreted in the cell cuture supernatant (data not shown). While the degree of suppression of the proliferating conventional T cells was similar by the DP and SP CB Tregs (data not shown), a significantly higher demethylation of FoxP3 promoter and first intron region was observed in the DP vs SP CB Treg population (n=3) (Fig 1B). A total of 337 pathways were identified from Up-406 gene set, 80 of these pathways had enrichment p-value<0.05 and q-value<0.25 (Fig 1C). The Top 10 pathways enriched with members of Up-406 genes include (Fig 1D): TGF-β Receptor Signaling; Interleukin-10 signaling; Inflammatory bowel disease; IL12 signaling mediated by STAT4. A total of 158 pathways were identified from Down-314 gene set, 19 of these pathways had enrichment p-value<0.05 and q-value<0.25. The Top 10 pathways enriched with Down-314 genes included Immuno-regulatory interactions between a Lymphoid and a non-Lymphoid cell; ESC Pluripotency Pathways; Downstream signaling in naive CD8+ T cells; PDGF receptor signaling network; Nef Mediated CD8 Down-regulation (Fig E, F). Conclusion: We have identified a novel double positive CD4+CD8+ CB Treg population. Additional experiments for evaluating suppressor mechanism in addition to IL-10 secretion are ongoing. Figure 1 Disclosures Verma: Stelexis: Equity Ownership, Honoraria; Acceleron: Honoraria; Celgene: Honoraria; BMS: Research Funding; Janssen: Research Funding. Iyer:Genentech/Roche: Research Funding; Incyte: Research Funding; Seattle Genetics, Inc.: Research Funding; Novartis: Research Funding; Arog: Research Funding; Bristol-Myers Squibb: Research Funding. Parmar:Cellenkos Inc.: Equity Ownership, Membership on an entity's Board of Directors or advisory committees, Research Funding.

Single Injection of Cord Blood Regulatory T Cells Can Delay the Manifestations of Systemic Lupus Erythematosus

Background: Systemic Lupus Erythematosus (SLE) is a chronic inflammatory autoimmune disorder with multi-organ involvement, including skin rash, joint pain, neurological dysfunction, pulmonary fibrosis, vasculitis, and renal failure. Previously it has been reported that SLE patients have a lower percentage of regulatory T cells (Tregs) and when compared to healthy population, Tregs derived from SLE patients show defect in their suppressor function. Our group at MD Anderson Cancer Center has already shown that a significantly lower dose of cord blood (CB) Tregs as compared to conventional T cells (Tcon) in the donor graft is able to prevent graft vs host disease (GVHD). Furthermore, adoptive therapy with CB Tregs is being explored as a therapy for bone marrow failure including aplastic anemia as a single agent in the non-transplant setting. Therefore, we hypothesized that adoptive therapy with CB Tregs may be utilized for the treatment of SLE. Method: For examining the efficacy of CB Tregs in vivo, we developed a humanized SLE model, where female Rag2-/-γc-/- mice were transplanted with 3 ~ 4 x 106 human SLE-PBMCs by intravenous injection on day 0. The mice were allowed to develop disease (control) and at 1 weeks post-transplant a single dose of 1x107 CB Tregs was injected through the tail vein (treatment). Mice peripheral blood (PB) was assessed weekly for their cell compartment composition by using flow cytometry; double stranded DNA (dsDNA IgG) and plasma cytokines. Mice were monitored twice per week for weight loss, GVHD score and survival. Weekly urine collection was performed to analyze for albumin and creatinine. At the time of euthanasia, harvested organs were analyzed by flow cytometry, and immunohistochemistry. Result: Single injection of CB Tregs was sufficient to slow down the phenotype of SLE as shown in figure 1A, where the physical appearance of CB Treg treated mice was significantly better than the control and it correlated with a significantly lesser CD3+ infiltrates in the spleen of the treatment vs. control mice (Figure 1B) and a similar finding was observed in the CD20 infiltrate in the renal tissue (data not shown). While a widespread parakeratosis in the skin of the control mice, almost complete resolution was observed in the treatment arm (figure 1C). In addition, a lack of lymphoid infiltrate in the kidney and resolution of splenic lymphoid hyperplasia was observed in the CB Treg recipients (data not shown). In another experiment, we studied the role of weekly injection of 1x107 CB Tregs with the first injection administered at week 4 after the lupus inoculation. Significant improvement was observed in the urine albumin (p<0.02) (Fig 1D) as well as urine creatinine (p<0.0006) levels; which correlated with the significant improvement in the dsDNA IgG levels in the treatment arm compared to control (Fig 1E), respectively. We also measure the durability of single dose CB Treg injection, where a decrease in the 5-week plasma inflammatory cytokines including sCD40L (Fig 1F); TNFα (Fig 1G) and IFNγ (Fig 1H) was observed irrespective of CB Treg injection on day+7 or day+28 after the lupus PBMC injection. Conclusion: We conclude that adoptive therapy with CB Tregs is a viable option for SLE and additional studies are planned to optimize the dose and schedule details. Figure 1 Disclosures Khoury: Angle: Research Funding; Stemline Therapeutics: Research Funding; Kiromic: Research Funding. Iyer:Seattle Genetics, Inc.: Research Funding; Novartis: Research Funding; Bristol-Myers Squibb: Research Funding; Genentech/Roche: Research Funding; Incyte: Research Funding; Arog: Research Funding. Parmar:Cellenkos Inc.: Equity Ownership, Membership on an entity's Board of Directors or advisory committees, Research Funding.

Allogeneic Cord Blood Regulatory T Cells Can Prevent Graft Vs. Host Disease and Preserve Graft Vs Leukemia Effect: Update on Phase I/II Clinical Trial

Previously, we presented the results of a phase I trial of using cord blood (CB) derived regulatory T cells (Tregs) at a dose of 1x106 cells/kg in the prevention of graft vs. host disease (GVHD) in five patients undergoing allogeneic stem cell transplant (SCT). We now present an update of those patients and also the outcome of a single patient treated with CB Tregs at higher dose of 1x107 cells/kg. At the last follow up of 3.5 years, 5 of 6 patients are alive, in complete remission, without GVHD and off immune-suppression (table 1). One patient died of head injury at day 45 post-transplant without GVHD. None of the patients relapsed in spite of having high risk disease including Flt3+ acute myeloid leukemia (AML) (pt#1); refractory mycosis fungoides/ sezary syndrome (pt#2); relapsed refractory multiple myeloma including two autologous SCT (pt#3); myeloid sarcoma (pt#4); AML with complex cytogenetics (pt#5). Specifically, the sixth patient (treated at CB Tregs cell dose of 1x107 cells/kg) had a diagnosis of lymphoid blast crisis of chronic myelogenous leukemia (CML) and underwent allogeneic peripheral blood (PB) matched unrelated donor (MUD) SCT in second chronic phase with the conditioning regimen of fludarabine (40 mg/m2/d on day -5 to -2) and melphalan (140mg/m2 on day -2) and received CB Tregs at a dose of 1x107 cells/kg on day -1. The CB Tregs were manufactured at the MD Anderson GMP facility. Tregs were isolated from 4 out of 6 HLA matched CB unit with a post-thaw total nucleated cell (TNC) count of 1295 x 106 cells with 90% recovery. Enrichment of CD25+ Treg cells was accomplished with directly conjugated anti-CD25 magnetic microbeads and the LS column (Miltenyl) based selection. After selection, the total no. of isolated CB Tregs was 17.6 x 106 cells. These cells were ex-vivo expanded in culture for a total of 14 days in the continued presence of CD3/28 microbeads and interleukin-2. On the day of harvest, a total of 1359 x 106 Treg cells were generated with 96% viability. Based on patient's weight of 67 kg, a total of 67x107 CB Treg cells were infused. The expanded CB Tregs were also evaluated for functionality by using an in vitro suppression assay, where the stimulated CD4+ Tcon cells stained with CellTrace Violet and Tregs were added into a 96-well plate at a 1:1 and 1:2 ratio and incubated for three days at 37oC. As shown in figure 1A, the clinically manufactured CB Tregs were functional and exerted 98% suppression of the proliferating Tcon cells. Subsequently, the patient received PB MUD graft on day 0. The graft had a TNC count of 1900 x106 cells where the CD3+ T cells were at a dose of 400 x106 cells/kg resulting in a Treg: Tcon ratio of 1:40, a significantly lower number of Tregs compared to other published clinical trials using Treg prophylaxis for GVHD. There was no infusion reaction related to the CB Treg infusion, the patient engrafted on day+12 with 100% donor chimerism on day +30. The patient did not develop any grade II-IV GVHD and was off immune suppression by +6 months. At the time of last follow up of 2 years and 4 months, the patient remains alive, in complete remission and without GVHD. We compared the inflammatory cytokine profile as well as GVHD biomarkers for pt #6 to the rest of the five patients who received the lower dose of CB Tregs at 1x106 cells/kg (with up to 400 times Tcon cells in the graft), where 4 patients had developed acute GVHD. The inflammatory biomarkers of IL-6 (fig 1B) and IL-8 (fig 1C) for pt#6 were low to undetectable compared to the other patients. Similarly, the GVHD biomarkers of ST2 (fig 1D); MIG/ CXCL9 (fig 1E) and follistatin (fig 1F) were also low to undetectable in pt#6 compared to the rest. At the time of last follow up, all patients had resolved acute GVHD and were off-immune suppression and in complete remission. Based on these data, we conclude that CB Treg dose of 1x107 cells/kg may be able to prevent GVHD without alleviating the graft vs leukemia effect. Disclosures Popat: Jazz: Consultancy; Incyte: Research Funding; Bayer: Research Funding. Nieto:Affimed: Consultancy; Astra-Zeneca: Research Funding; Novartis: Research Funding; Affimed: Research Funding. Ciurea:Kiadis Pharma: Membership on an entity's Board of Directors or advisory committees, Other: stock holder; MolMed: Membership on an entity's Board of Directors or advisory committees; Spectrum: Membership on an entity's Board of Directors or advisory committees; Miltenyi: Research Funding. Qazilbash:Amgen: Consultancy, Other: Advisory Board; Genzyme: Other: Speaker; Bioclinical: Consultancy; Autolus: Consultancy. Champlin:Actinium: Consultancy; Johnson and Johnson: Consultancy; Sanofi-Genzyme: Research Funding. Parmar:Cellenkos Inc.: Equity Ownership, Membership on an entity's Board of Directors or advisory committees, Research Funding.

Cord blood CD4+/CD25+ T cells down-regulates NKG2D on cytokine-induced killer cells.

Studies have shown that CD4+ CD25+ regulatory T cells (Tregs) could inhibit cytokine-induced killer (CIK) cells against tumor cells, but minimal data have been reported on the underlying mechanisms. The purpose of this study was to investigate the potential suppressive mechanisms of cord blood Tregs on CIK cells in vivo and in vitro. The in vitro study demonstrated that Tregs were normally proliferated and had potent suppressive characteristics. CD4+ CD25+ LAP+ cells were highly expressed as part of activated Tregs, which limited CIK cell-mediated cytotoxicity and reduced the expression of the NKG2D receptor. Interestingly, the inhibitory ability of Tregs could be mimicked by soluble TGF-β1 and neutralizing TGF-β1 antibody could abrogate the inhibitory function of Tregs on CIK cells. In vivo results showed that adoptively transferred CIK cells could delay the tumor growth in nude mice. Moreover, depletion of CD4+ CD25+ Tregs in preculture or blockade of TGF-beta 1 strikingly enhanced CIK cells cytotoxicity. These data indicate that Tregs inhibit CIK cells cytotoxicity mainly by down regulating the expression of NKG2D receptor in a TGF-β dependent manner.

Expansion of Human Tregs from Cryopreserved Umbilical Cord Blood for GMP-Compliant Autologous Adoptive Cell Transfer Therapy

Umbilical cord blood is a traditional and convenient source of cells for hematopoietic stem cell transplantation. Thymic regulatory T cells (Tregs) are also present in cord blood, and there is growing interest in the use of autologous Tregs to provide a low-risk, fully human leukocyte antigen (HLA)-matched cell product for treating autoimmune diseases, such as type 1 diabetes. Here, we describe a good manufacturing practice (GMP)-compatible Treg expansion protocol using fluorescence-activated cell sorting, resulting in a mean 2,092-fold expansion of Tregs over a 16-day culture for a median yield of 1.26 × 109 Tregs from single-donor cryopreserved units. The resulting Tregs passed prior clinical trial release criteria for Treg purity and sterility, including additional rigorous assessments of FOXP3 and Helios expression and epigenetic analysis of the FOXP3 Treg-specific demethylated region (TSDR). Compared with expanded adult peripheral blood Tregs, expanded cord blood Tregs remained more naive, as assessed by continued expression of CD45RA, produced reduced IFN-γ following activation, and effectively inhibited responder T cell proliferation. Immunosequencing of the T cell receptor revealed a remarkably diverse receptor repertoire within cord blood Tregs that was maintained following in vitro expansion. These data support the feasibility of generating GMP-compliant Tregs from cord blood for adoptive cell transfer therapies and highlight potential advantages in terms of safety, phenotypic stability, autoantigen specificity, and tissue distribution.

Fetal thymus size in human pregnancies reveals inverse association with regulatory T cell frequencies in cord blood

ObjectiveTo determine fetal thymus growth and its relationship with fetal weight and cord blood T-regulatory cells in a prospective study. Assessment of fetal immune organs by ultrasound could provide a screening approach to identify fetuses at risk of impaired postnatal immunity. Study design and outcome measuresThymus size was measured with four ultrasound techniques. The approaches with lowest coefficient of variation (thymus transverse diameter, 3 vessel edge) were used to longitudinally assess fetal and thymus growth in 137 cases at four time points between a gestational age (GA) of 13 and 37 weeks. Cord blood at birth was analyzed by flow-cytometry to evaluate the frequency of regulatory T (Treg) cells. Results and conclusionFetal thymus growth is significantly correlated with fetal weight (GA 23–25 weeks r=0.40, p<0.01; GA 28–30 weeks r=0.21, p=0.04, GA 35–37 weeks r=0.56, p<0.01). We observed an inverse correlation between fetal thymus size at GA 23–25 weeks and cord blood Treg cells (r=0.37, p=0.01). Thymus growth occurs in a linear fashion throughout pregnancy and can be reliably measured using ultrasound. Our findings of an inverse correlation between thymus growth and Treg cells in cord blood suggests a link between fetal growth, thymus development and immune-status at birth.

Maturation and Phenotypic Diversity of Human CD4+ Regulatory T Cells in Umbilical Cord Blood and Peripheral Blood from Healthy Donors

Introduction: CD4+ FoxP3+ CD25+ regulatory T cells (Treg) are required for maintenance of immune tolerance and immune homeostasis. Quantitative or functional Treg deficiency has been correlated with autoimmune disease, allergy, allograft rejection and graft versus host disease. Conversely, increased Treg can suppress tumor immunity resulting in tumor progression. Treg express a large number of cellular markers that reflect their level of maturation, functionality, activation and migratory capacity. Nevertheless, it has not previously been possible to integrate the expression of these various markers and correlate their expression with human Treg differentiation in vivo.Methods: We used single cell mass cytometry (CyTOF) to simultaneously study 36 phenotypic and functional markers of human Treg in samples obtained from umbilical cord blood (CB) (n=4) and healthy adult donors (n=10). Wanderlust trajectory detection algorithm was used to analyze temporal positioning of Treg across development. To quantify Treg heterogeneity we used ACCENSE; an analysis tool that combines a nonlinear dimensionality reduction algorithm (t-SNE) with spectral clustering algorithm and automated cell classification into subpopulations.Results: Using Wanderlust to characterize Treg maturation, the majority of CB Treg were naive (CD45RA+) and CB memory Treg (CD45RA-) were poorly differentiated with minimal expression of activation (HLA-DR) and pro-apoptotic (CD95) markers (Figure 1A). Adult Treg contained few naive cells and mature Treg effector cells expressed high levels of activation and pro-apoptotic markers. (Figure 1B). Using Wanderlust together with spearman correlation, 5 discrete stages of Treg maturation were identified; 1) recent thymic emigrants (RTE), 2) naive, 3) effector, 4) activated and 5) terminal effector. RTE Treg defined by expression of CD45RA, CD31 and CCR7, also expressed markers of proliferation (KI67) and functionality (Tbet, PDL-1, Helios) at low levels but lacked functional CTLA4 and TIM-3. Naive Treg lacked expression of CD31 but expressed other markers characteristic of RTE. Effector Treg expressed increased levels of CD95, CTLA-4, CCR7, GITR, Helios and FoxP3 but lacked HLA-DR. Activated effector Treg expressed the highest levels of FoxP3, Helios and Ki67, along with functional markers (CD28, CXCR3, ICOS, GITR, CD39, CTLA-4, TIM-3) and homing molecules (vascular endothelial CCR5, gut addressin ACT-1, skin addressins CCR4, CLA). Activated Treg express the highest levels and diversity of functional markers along with the ability to migrate to different tissues. Lastly, terminal effector Treg express a more restricted set of functional and homing markers (CD28, CTLA-4, ICOS and CCR5) with less diversity. Markers of exhaustion (PD-1 and TIM-3) are also expressed by effector, activated and terminal effector Treg. Pro-apoptotic markers (CD95high BCL2low) are primarily expressed by activated and terminal effector Treg.Using ACCENSE to evaluate Treg diversity allowed further identification of discrete Treg sub-populations within each maturation state. RTE and naive Treg appear very homogeneous and appear as a single cluster in both CB and adults. In contrast, effector, activated and terminal effector Treg are more heterogeneous and are visualized as 9 distinct clusters (Figure 1C, D). This clustering reflects distinct subsets of memory Treg that co-express various combinations of functional markers in our panel. All 9 Treg effector populations are present in CB, but at much lower levels. Treg effector cell diversity is maintained but does not increase as Treg mature and expand in adults and RTE/naive Treg become less prevalent.Conclusion: Our study is the first to quantify human Treg heterogeneity based on expression of a large set of activation, proliferation, tissue homing and functional markers in conjunction with stages of Treg maturation and differentiation. These studies define 5 stages of Treg maturation and 10 clusters of Treg diversity based on differential expression of phenotypic and functional markers. Similar approaches can be applied to describe maturation and diversity of other cell populations. Further application of this CyTOF panel can be used to study Treg maturation and diversity after hematopoietic stem cell transplantation and in immune and inflammatory diseases, to identify specific defects that may contribute to immune dysfunction. [Display omitted] DisclosuresNo relevant conflicts of interest to declare.

Reprint of “Vitamin D deficiency in pregnant women impairs regulatory T cell function”

Regulatory T cells and IgE receptors (CD23 and CD21) on B cells were assessed in vitamin D deficient pregnant women. For this, 153 pregnant women were recruited from a government hospital and were categorized into three groups based on 25-hydroxyvitamin D3 (25(OH)D3) status. Regulatory T cell population (Treg cells) and CD23/CD21 expression on B cells were quantified by FACS ARIA II in maternal blood at third trimester; and the same parameters were evaluated in cord blood soon after delivery. In addition, TGF β and IL-10 were quantified in maternal and cord blood by using Milliplex kits. In a representative sample of eight women from each group (vitamin D sufficient, insufficient and deficient), placental tissues were processed for mRNA expressions of vitamin D receptor (VDR), retinoic acid receptor (RXR), vitamin D binding protein (VDBP) and vitamin D regulating enzymes. Of the 153 pregnant women, 18 were sufficient (≥30ng/mL), 55 were insufficient (20–29ng/mL) and 80 were deficient (≤19ng/mL) for 25(OH)D3 status. The maternal blood Treg cell population (mean (%)±SE) was lower (p<0.05) in 25(OH)D3 deficient (0.2±0.01) pregnant women compared to insufficient (0.34±0.01) and sufficient (0.45±0.02) pregnant women. Similarly, cord blood Treg cell population (mean (%)±SE) was also lower (p<0.05) in 25(OH)D3 deficient (0.63±0.03) pregnant women when compared to insufficient (1.05±0.04) and sufficient (1.75±0.02) pregnant women. Mean (%)±SE of B cells with CD23 and CD21 in maternal blood was higher (p<0.05) in 25(OH)D3 deficient pregnant women (0.35±0.02; 1.65±0.04) when compared to insufficient (0.22±0.02; 0.55±0.05) and sufficient (0.15±0.02; 0.21±0.01) pregnant women. Similarly, mean (%)±SE of B cell population with CD23 and CD21 in cord blood was also higher (p<0.05) in 25(OH)D3 deficient (0.41±0.02; 1.2±0.03) when compared to insufficient (0.32±0.01; 0.6±0.05) and sufficient (0.2±0.01; 0.4±0.02) pregnant women.Regulatory cytokines, TGF β and IL-10 were lower (p<0.05) in 25(OH)D3 insufficient and deficient subjects. In the placenta tissue of women with 25(OH)D3 deficiency, the regulatory T cell transcription factor FOXP3, vitamin D receptor (VDR) and retinoic acid receptor (RXR) expressions were downregulated. In contrast, CD23, CD21 and VDBP expressions were upregulated in 25(OH)D3 deficient and insufficient women. Vitamin D regulating enzymes (CYP24A1, CYP2R1 and CYP27B1) expression were also altered in women with 25(OH)D3 deficiency. The current study shows that impaired maternal 25(OH)D3 during pregnancy influences the spectrum of immune cells such as regulatory T cells and B cells with IgE receptors and this in turn may be linked to allergy and asthma in neonates.

Fucosylation enhances activity of cytotoxic T lymphocytes against breast cancer

Fucosylation is a process by which fucose sugar groups are added to cell surface receptors. This process is mediated by fucosyl transferases that attach terminal fucose groups to acceptor molecules on the cell surface. Fucosylation of cord blood stem cells and human regulatory T cells (Treg) were shown to enhance cord blood engraftment and Treg homing to inflamed tissues. Since tumor tissues have a component of inflammation, we hypothesized that fucosylation of antigen specific cytotoxic T lymphocytes (CTL) ex vivo will enhance their migration into tumors and subsequent killing of tumor cells. Specifically we tested whether ex vivo fucosylation of CTL that target the HLA-A2 restricted HER2/neu-derived peptide, E75, enhances E75-CTL migration and cytotoxic functions.

Regulatory T Cells in Human Cord Blood of Preterm and Term Infants

Regulatory T (Treg) cells are a subset of CD4+ T cells that play key roles in the maintenance of immunologic self-tolerance and negative control of immune responses. Treg cells are defined based on expression of CD4, CD25, and transcription factor forkhead box P3 (FoxP3). FoxP3 controls the development and function of Treg cells and can be used as a reliable marker of Treg cells, however, its intracellular localization prohibits its use for the isolation of viable Treg cells. Most FoxP3+ Treg cells express low levels of CD127 in adult peripheral blood, however, the expression of CD127 in cord blood (CB) Treg cells of preterm and term infants at each gestational age remains unknown. Being that CD127 is a cell surface marker, it enables the isolation of viable Treg cells by flow cytometric sorting for further analysis. We analyzed CD4+CD25+FoxP3+ and CD4+CD25+CD127− T cells in preterm and term CB at various gestational ages.CB samples were obtained at Iwate Medical University hospital from preterm and term neonates who had no hereditary disorders, hematologic abnormalities, or immunodeficiency diseases. Of 103 total samples, 36 were obtained from preterm (24–36 gestational weeks) neonates and 67 were obtained from term (37–41 gestational weeks) neonates. Out of 36 preterm infants, 9 were diagnosed with chorioamnionitis histologically. None of the mothers involved in the study had any specific underlying diseases. CB mononuclear cells were isolated and analyzed by FACSCalibur flow cytometer and CellQuestPro software (BD Biosciences).No differences were observed in the proportions of CD25+FoxP3+ (median 4.5%) and CD25+CD127− (median 5.0%) cells in the CD4+ T-cell population. A strong correlation was found between the proportions of CD25+FoxP3+ and CD25+CD127− cells in the CD4+ T-cell population (r=0.96). The proportion of CD25+FoxP3+ cells in the CD4+ T-cell population in the CB of neonates at 24-26, 27-29, and 30-32 gestational weeks was significantly higher than in the CB of neonates at 37-38 and 39-41 gestational weeks. The proportion of CD25+CD127− cells in the CD4+ T-cell population in the CB of neonates at 24-26, 27-29, and 30-32 gestational weeks was also higher than in the CB of neonates at 37-38 and 39-41 gestational weeks. The absolute number of both CD4+CD25+FoxP3+ and CD4+CD25+CD127− T cells did not differ between the CB of preterm and term neonates. Absolute lymphocyte counts in preterm CB were significantly lower than term infants (P<0.05). The proportions of CD25+FoxP3+ and CD25+CD127− cells in the CD4+ T-cell population did not differ between preterm infants with histological chorioamnionitis (n=9) and no histological chorioamnionitis (n=27).We showed that CD127 is preferable to FoxP3 as a marker for identifying Treg cells in CB of various gestational ages and would be useful for separating Treg cells by flow cytometry for therapeutic applications. The proportions of Treg cells in the CB of preterm infants were significantly higher than in the CB of term infants. The high Treg proportion during early gestation suggests that fetal naive T cells have a high propensity to differentiate into Treg cells in response to antigenic stimulation, such as by maternal alloantigens. The functional implications of the high proportion of Treg cells in preterm CB are unknown but may be important for the suppression of undesirable alloimmune reactions to maternal derivatives in utero and the maintenance of tolerance during pregnancy. DisclosuresNo relevant conflicts of interest to declare.

Vitamin D deficiency in pregnant women impairs regulatory T cell function

Regulatory T cells and IgE receptors (CD23 and CD21) on B cells were assessed in vitamin D deficient pregnant women. For this, 153 pregnant women were recruited from a government hospital and were categorized into three groups based on 25-hydroxyvitamin D3 (25(OH)D3) status. Regulatory T cell population (Treg cells) and CD23/CD21 expression on B cells were quantified by FACS ARIA II in maternal blood at third trimester; and the same parameters were evaluated in cord blood soon after delivery. In addition, TGF β and IL-10 were quantified in maternal and cord blood by using Milliplex kits. In a representative sample of eight women from each group (vitamin D sufficient, insufficient and deficient), placental tissues were processed for mRNA expressions of vitamin D receptor (VDR), retinoic acid receptor (RXR), vitamin D binding protein (VDBP) and vitamin D regulating enzymes. Of the 153 pregnant women, 18 were sufficient (≥30ng/mL), 55 were insufficient (20–29ng/mL) and 80 were deficient (≤19ng/mL) for 25(OH)D3 status. The maternal blood Treg cell population (mean (%)±SE) was lower (p<0.05) in 25(OH)D3 deficient (0.2±0.01) pregnant women compared to insufficient (0.34±0.01) and sufficient (0.45±0.02) pregnant women. Similarly, cord blood Treg cell population (mean (%)±SE) was also lower (p<0.05) in 25(OH)D3 deficient (0.63±0.03) pregnant women when compared to insufficient (1.05±0.04) and sufficient (1.75±0.02) pregnant women. Mean (%)±SE of B cells with CD23 and CD21 in maternal blood was higher (p<0.05) in 25(OH)D3 deficient pregnant women (0.35±0.02; 1.65±0.04) when compared to insufficient (0.22±0.02; 0.55±0.05) and sufficient (0.15±0.02; 0.21±0.01) pregnant women. Similarly, mean (%)±SE of B cell population with CD23 and CD21 in cord blood was also higher (p<0.05) in 25(OH)D3 deficient (0.41±0.02; 1.2±0.03) when compared to insufficient (0.32±0.01; 0.6±0.05) and sufficient (0.2±0.01; 0.4±0.02) pregnant women.Regulatory cytokines, TGF β and IL-10 were lower (p<0.05) in 25(OH)D3 insufficient and deficient subjects. In the placenta tissue of women with 25(OH)D3 deficiency, the regulatory T cell transcription factor FOXP3, vitamin D receptor (VDR) and retinoic acid receptor (RXR) expressions were downregulated. In contrast, CD23, CD21 and VDBP expressions were upregulated in 25(OH)D3 deficient and insufficient women. Vitamin D regulating enzymes (CYP24A1, CYP2R1 and CYP27B1) expression were also altered in women with 25(OH)D3 deficiency. The current study shows that impaired maternal 25(OH)D3 during pregnancy influences the spectrum of immune cells such as regulatory T cells and B cells with IgE receptors and this in turn may be linked to allergy and asthma in neonates.

Reduced neonatal regulatory T cell response to microbial stimuli associates with subsequent eczema in high-risk infants.

Regulatory T cells (Treg) play an essential role in early immune programming and shaping the immune response towards a pro-allergic or tolerant state. We evaluated cord blood Treg and cytokine responses to microbial and non-microbial stimuli in infants at high risk of allergic disease and their associations with development of allergic disease in the first year. Cord blood mononuclear cells from 72 neonates were cultured with toll-like receptors (TLR2) ligands: lipoteichoic acid (LTA) and heat-killed Lactobacillus rhamnosus GG (HKL); TLR4 ligand: lipopolysaccharide (LPS); ovalbumin (OVA); anti-CD3; or media for 48 h. Treg numbers and Treg cytokines were assessed in relation to allergic disease outcomes during the first year of life (eczema and atopic sensitization). Infants with eczema (n = 24) had reduced percentages of FoxP3(hi)CD25(hi) Treg in LTA (p = 0.01, adj p = 0.005) and HKL (p = 0.04, adj p = 0.02) stimulated cultures as well as reduced IL-10 (p = 0.01) production following HKL stimulation compared to those without eczema (n = 48). No differences in Treg or cytokine responses to LPS, OVA or anti-CD3 were seen. Infants who developed sensitization had lower percentages of Treg following TLR2 stimulation (but not other stimuli) compared to non-sensitized infants. High-risk children who develop allergic disease in the first year of life have deficient Treg responses to microbial stimuli but not allergen from the time of birth, which may contribute to failure of immune tolerance development in infancy.

Cord blood CD4+CD25+ regulatory T cells fail to inhibit cord blood NK cell functions due to insufficient production and expression of TGF-beta1

Although CD4+CD25+ Treg (Treg) cells are known to modulate NK cell functions, the modulation mechanism of these cells in cord blood has not been fully clarified. The purpose of this study was to clarify the mechanism whereby cord blood Treg cells modulate cord NK cells. By performing various cultures of purified NK cells with or without autologous Treg cells, diminished inhibitory effects of cord Treg cells towards cord NK cell functions, including activation, cytokine production, and cytotoxicity, were observed. We also observed lower secretion of sTGF-beta1 and lower expression of mTGF-beta1 by cord Treg cells than by adult Treg cells. These data revealed the capability of adult Treg cells to suppress rhIL-2-stimulated NK cell function by TGF-beta1, both membrane-bound and soluble types. The reduced inhibitory capabilities of cord Treg cells compared with adult Treg cells is thought to be due to insufficient expression of TGF-beta1.

FOXP3 is a direct target of miR15a/16 in umbilical cord blood regulatory T cells.

Exact mechanism of action of umbilical cord blood (CB)-derived regulatory T cells (Tregs) in the prevention of GVHD remains unclear. On the basis of selective overexpression of peptidase inhibitor 16 in CB Tregs, we explored the related p53 pathway, which has been shown to negatively regulate miR15a/16 expression. Significantly lower levels of miR15a/16 were observed in CB Tregs when compared with conventional CB T cells (Tcons). In a xenogeneic GVHD mouse model, lower levels of miR15a/16 were also found in Treg recipients, which correlated with a better GVHD score. Forced overexpression of miR15a/16 in CB Tregs led to inhibition of FOXP3 and CTLA4 expression and partial reversal of Treg-mediated suppression in an allogeneic mixed lymphocyte reaction that correlated with the reversal of FOXP3 demethylation in CB Tregs. On the other hand, miR15a/16 knockdown in CB Tcons led to expression of FOXP3 and CTLA4 and suppression of allogeneic lymphocyte proliferation. Using a luciferase-based mutagenesis assay, FOXP3 was determined to be a direct target of miR15a and miR16. We propose that miR15a/16 has an important role in mediating the suppressive function of CB Tregs and these microRNAs may have a 'toggle-switch' function in Treg/Tcon plasticity.

FOXP3 Is a Direct Target Of miR15a/16 in Umbilical Cord Blood Regulatory T Cells

The exact mechanism of action of Umbilical cord blood (CB) derived regulatory T cells (Tregs) in the prevention of graft versus host disease (GVHD) remains unclear. Based on the selective overexpression of peptidase inhibitor 16 in CB Tregs we explored the related p53 pathway that has been shown to negatively regulate microRNA 15a and 16 (Fabbri, JAMA, 2011). We systematically evaluated the expression of miR15a/16 in CB Tregs (CD4+25+127lo) and compared it to CB derived conventional T cells (Tcons) (CD4+25-127hi). CB Tregs and Tcons were isolated using CD25 based magnetic selection and were ex-vivo expanded for 14 days in the presence of IL-2. Total RNA was reverse transcribed with microRNA-specific primers using a TaqMan® microRNA reverse transcription kit. Differences in miRNA levels were compared with the Student's T-test. Fisher exact and χ2 tests were applied to categorical variables. Lentivirus based transduction was performed in CB Tregs and CB Tcons for the purpose of miR15a overexpression (OE) and knockdown (KO), respectively. Firefly and Renilla dual luciferase report system were employed to investigate the interaction between miR15a/16 and FOXP3. In order to generate the 3′ UTR mutant construct (3′UTR-del), seed regions were deleted using the QuikChange site-directed mutagenesis kit according to the manufacturer's protocols (Agilent) and designated as FOXP3 del. We found significantly lower levels of miR15a and miR16 in CB Tregs when compared to CB Tcons (p=0.002 and p<0.001, respectively). As a positive control, miR21 was overexpressed in CB Tregs when compared to CB Tcons (p=0.005). No difference was seen in the miR15a/16 expression between CB Tregs and peripheral Blood Tregs. In a xenogeneic GVHD mouse model, lower levels of miR15a/16 were also found in the circulating CD4+ cells of Treg recipients which correlated with their preservation of phenotype, better GVHD score and overall survival. OE of miR15a/16 in CB Tregs inhibited FOXP3 and CTLA4 expression and led to partial reversal of Treg mediated suppression in an allogeneic mixed lymphocyte reaction (MLR) (p=0.005 and p=0.00001, respectively). OE miR15a/16 also led to reversal of FOXP3 demethylation in CB Tregs. Furthermore, KD of miR15a/16 in CB Tcons led to increased expression of FOXP3 and CTLA4. miR15a/16 KD CB Tcons were able to suppress the proliferation reaction in an alloMLR. Using luciferase based mutagenesis assay, FOXP3 was determined to be a target of miR15a/16 at binding site 1: GTGGTTCTAGACACCCCCTCCCCCATCATA (forward) and GTGGTTCTAGAGGC TCTCTGTGTTTTGGGGT (reverse) and binding site 2: GTGGTTCTAGACCTACAC AGAAGCAGCGTCA (forward) and GTGGTTCTAGAGATCAGGGCTCAGGGAATGG (reverse). This is the first report of identification of FOXP3 as a direct target of miR15a/16 and we propose miR15a/16 as a mechanism involved in the checkpoint of CB Tregs and Tcons (Figure 1). Further study of miR15a/16 pathway can be helpful in better understanding of Treg function. Disclosures:Shah:Celgene: Membership on an entity's Board of Directors or advisory committees, Research Funding. McNiece:Proteonomix Inc: Consultancy.

Third-party umbilical cord blood–derived regulatory T cells prevent xenogenic graft-versus-host disease

Background aimsNaturally occurring regulatory T cells (Treg) are emerging as a promising approach for prevention of graft-versus-host disease (GvHD), which remains an obstacle to the successful outcome of allogeneic hematopoietic stem cell transplantation. However, Treg only constitute 1–5% of total nucleated cells in cord blood (CB) (<3 × 106 cells), and therefore novel methods of Treg expansion to generate clinically relevant numbers are needed. MethodsSeveral methodologies are currently being used for ex vivo Treg expansion. We report a new approach to expand Treg from CB and demonstrate their efficacy in vitro by blunting allogeneic mixed lymphocyte reactions and in vivo by preventing GvHD through the use of a xenogenic GvHD mouse model. ResultsWith the use of magnetic cell sorting, naturally occurring Treg were isolated from CB by the positive selection of CD25+ cells. These were expanded to clinically relevant numbers by use of CD3/28 co-expressing Dynabeads and interleukin (IL)-2. Ex vivo–expanded Treg were CD4+25+FOXP3+127lo and expressed a polyclonal T-cell receptor, Vβ repertoire. When compared with conventional T-lymphocytes (CD4+25− cells), Treg consistently showed demethylation of the FOXP3 TSDR promoter region and suppression of allogeneic proliferation responses in vitro. ConclusionsIn our NOD-SCID IL-2Rγnull xenogeneic model of GvHD, prophylactic injection of third-party, CB-derived, ex vivo–expanded Treg led to the prevention of GvHD that translated into improved GvHD score, decreased circulating inflammatory cytokines and significantly superior overall survival. This model of xenogenic GvHD can be used to study the mechanism of action of CB Treg as well as other therapeutic interventions.

Maternal and cord blood miR-223 expression associates with prenatal tobacco smoke exposure and low regulatory T-cell numbers

There is evidence that microRNAs (miRNAs) are sensitive to environmental stressors, including tobacco smoke. On the other hand, miRNAs are involved in immune regulation, such as regulatory T (Treg) cell differentiation. The aim of the present study was to investigate the association between prenatal tobacco smoke exposure, miRNAs, and Treg cell numbers. Within a prospective mother-child study (Lifestyle and Environmental Factors and Their Influence on Newborns Allergy Risk), we analyzed the expression of miR-155 and miR-223 together with Treg cell numbers in maternal blood during pregnancy, as well as in cord blood (n = 441). Tobacco smoke exposure was assessed based on questionnaire answers and maternal urine cotinine levels. Additionally, the concentration of smoking-related volatile organic compounds was measured in dwellings of study participants. Both maternal and cord blood miR-223 expressions were positively correlated with maternal urine cotinine levels. An association was also found between maternal miR-223 expression and indoor concentrations of benzene and toluene. High miR-223 expression was associated with lower Treg cell numbers in maternal and cord blood. Furthermore, children with lower Treg cell numbers at birth had a higher risk of atopic dermatitis during the first 3 years of life. The concentration of the toluene metabolite S-benzylmercapturic acid in maternal urine was associated with decreased cord blood, but not maternal blood, miR-155 expression. A relationship between miR-155 expression and Treg cell numbers was not found. For the first time, we show that maternal tobacco smoke exposure during pregnancy correlates with the level of miRNA-223 expression in blood, with an effect on children's cord blood Treg cell numbers and subsequent allergy risk.

Su1266 In Vitro Generated Regulatory T Cells From Blood Suppress Mucosal Effector T Cells in Crohn's Disease Patients

Background: Thymically derived CD4+CD25hiCD127loFOXP3+ regulatory T cells (Tregs) maintain immunological tolerance and prevent inappropriate activation of multiple immune cell types. Quantitative and qualitative Treg defects are seen in inflamed Crohn's (CD) mucosa, suggesting that insufficient Treg-mediated suppressor function contributes to chronic mucosal inflammation in CD. Consequently, cell-based therapy with autologous Tregs to restore mucosal Treg numbers and function is conceptually attractive. The recent use of in vitro expanded umbilical cord blood (UCB) Tregs to prevent GvHD following UCB transplantation confirmed the safety of this approach in humans. The optimal method of generating Tregs in vitro from CD patients to produce a homogenous, phenotypically stable yet functionally suppressive population on expansion is unknown, as is the effect of these cells on target organs: mesenteric lymph node (MLN) and lamina propria (LP) immune cells in inflamed CD gut. Aim: To define the optimal method of GMP-compatible Treg isolation and expansion from CD patients' blood with reference to homogeneity, phenotypic stability and suppressive ability of the cell product. Results: Tregs were expanded for 2028 days in X-VIVO15 with 5% human AB serum, IL-2 and Rapamycin. Tregs initially isolated using GMP-compatible MACS-based enrichment had unacceptably high CD8+ contamination (.20%) and high expression of IL-17 and IFNγ (n=5 independent experiments). CD4+CD25+CD127lo Tregs were then sorted from CD blood on the basis of CD45RA expression and expanded a median of 127-fold (IQR 58-531) to yield a .97% CD4+CD25hiCD127loFOXP3+ population (n=10). Expanded CD45RA+ Tregs expressed functionally relevant markers including CTLA-4, ICOS, CD27 and CD62L ( .97% each) and TGF-β but not IL-10. CD45RA+ Tregs expressed ,1% IL-17 by FACS and had greater phenotypic stability than expanded CD45RATregs, with less spontaneous (p,0.05) and induced (p,0.01) IL-17 production by ELISA. CD45RA+ Tregs highly suppressed autologous CD4+CD25proliferation at 96h (median=97.3% [96.6%-99.1%] at 1:1 ratio); and were more effective than CD45RATregs at suppressing CD4+CD25activation (p=0.003), assessed by CD154 expression at 7h. Importantly, using CD3+ T responders from inflamed Crohn's resections, CD45RA+ Tregs suppressed MLN CD3+ proliferation (88.4% [53.8-93.2%]), MLN CD154 expression (82.9% [60.1-87.6%]) and LP CD3+ CD154 expression (64.3% [64.377 . 9%] ) i n a do s e d ep enden t manne r . Conc lu s i ons : FACS so r t i n g o f a CD4+CD25hiCD127loCD45RA+ precursor population is required to produce a homogenous, phenotypically stable in vitro expanded cell product from CD patients. For the first time, we show that in vitro expanded Tregs suppress immune cell activation in relevant mucosal immune niches, strengthening the rationale for clinical trials of autologous in vitro expanded Tregs in CD.