Conventional RT-PCR Research Articles

Detection of TP53 Mutation in Acute Myeloid Leukemia by RT-PCR-Based Sanger Sequencing.

The TP53 gene is known to be one of the most frequently mutated genes in various human cancers. In de novo acute myeloid leukemia (AML), TP53 has been found to be mutated in ~10% of patients. Although the frequency of TP53 mutations in AML is substantially lower compared to other human cancers, TP53 mutations in AML are associated with poor response to chemotherapy and poor outcomes. Therefore, assessment of TP53 status is critical in clinical routines and research studies. In this chapter, we described the use of conventional RT-PCR for rapid detection of TP53 mutations by Sanger sequencing. We use AML cells as an example but provide sufficient details for usage in other cell types.

Fast COVID-19 Detection from Chest X-Ray Images Using DCT Compression

Novel coronavirus (COVID-19) is a new strain of coronavirus, first identified in a cluster with pneumonia symptoms caused by SARS-CoV-2 virus. It is fast spreading all over the world. Most infected people will develop mild to moderate illness and recover without hospitalization. Currently, real-time quantitative reverse transcription-PCR (rqRT-PCR) is popular for coronavirus detection due to its high specificity, simple quantitative analysis, and higher sensitivity than conventional RT-PCR. Antigen tests are also commonly used. It is very essential for the automatic detection of COVID-19 from publicly available resources. Chest X-ray (CXR) images are used for the classification of COVID-19, normal, and viral pneumonia cases. The CXR images are divided into sub-blocks for finding out the discrete cosine transform (DCT) for every sub-block in this proposed method. In order to produce a compressed version for each CXR image, the DCT energy compaction capability is used. For each image, hardly few spectral DCT components are included as features. The dimension of the final feature vectors is reduced by scanning the compressed images using average pooling windows. In the 3-set classification, a multilayer artificial neural network is used. It is essential to triage non-COVID-19 patients with pneumonia to give out hospital resources efficiently. Higher size feature vectors are used for designing binary classification for COVID-19 and pneumonia. The proposed method achieved an average accuracy of 95% and 94% for the 3-set classification and binary classification, respectively. The proposed method achieves better accuracy than that of the recent state-of-the-art techniques. Also, the time required for the implementation is less.

Identification and characterization of bluetongue virus in Culicoides spp. and clinically healthy livestock in southeastern Kazakhstan

ObjectiveBluetongue is an arthropod-borne disease of ruminants. Here, we investigated the seroprevalence of bluetongue virus (BTV) in livestock and performed the first genetic characterization of BTV isolated from sheep and Culicoides midges in the southeastern region of Kazakhstan. MethodsBlood samples were collected from 1241 asymptomatic livestock. In addition, 497 Culicoides midges were collected. Samples were analyzed for specific anti-BTV antibodies and BTV RNA by ELISA and conventional RT-PCR, respectively. ResultsThe overall seroprevalence of BTV antibodies was shown to be 4.3 % (46/1079) in small ruminant and 1 % (1/82) in cattle. Anti-BTV antibodies were not detected in camels (0/80). The minimum infection rate of BTV in Culicoides was shown to be 0.24 %. Seg-2 and Seg-10 sequence analysis demonstrated that all isolates belonged to the ‘western’ topotype of the BTV-9 strain. ConclusionThe present data confirm circulation of BTV in southeastern Kazakhstan.

Isolation and Molecular Detection of Feline Infectious Peritonitis Virus.

Feline coronavirus (FCoV) is an enveloped single-stranded RNA virus, affecting wild and domestic cats. Feline infectious peritonitis viruses (FIPV) variants of FCoV cause fatal peritonitis affecting approximately 5% of FCoV infected animals. The present study aimed to detect and isolate the feline infectious peritonitis virus for the first time in Iraq. In this study, 50 samples (fecal swab and peritoneal fluid) were collected from suspected pet cats from different areas of Baghdad, Iraq. The very suitable age was under two years old. Real-time reverse transcription-polymerase chain reaction(real-time RT-PCR) was used to detect Feline infectious peritonitis in infected collected samples by the amplification of spike protein (S). The result of real-time RT-PCR revealed that out of 50 samples from suspected cats, 10 samples were positive for FIPV. Moreover, 10 positive samples by real-time RT-PCR were used for the isolation of the virus in chicken embryo fibroblast cell culture. Subsequently, the isolated virus was detected by real-time RT-PCR and then by conventional RT-PCR, followed by electrophoresis.

Establishment of a reverse transcription real-time quantitative PCR method for Getah virus detection and its application for epidemiological investigation in Shandong, China.

Getah virus (GETV) is a mosquito-borne, single-stranded, positive-sense RNA virus belonging to the genus Alphavirus of the family Togaviridae. Natural infections of GETV have been identified in a variety of vertebrate species, with pathogenicity mainly in swine, horses, bovines, and foxes. The increasing spectrum of infection and the characteristic causing abortions in pregnant animals pose a serious threat to public health and the livestock economy. Therefore, there is an urgent need to establish a method that can be used for epidemiological investigation in multiple animals. In this study, a real-time reverse transcription fluorescent quantitative PCR (RT-qPCR) method combined with plaque assay was established for GETV with specific primers designed for the highly conserved region of GETV Nsp1 gene. The results showed that after optimizing the condition of RT-qPCR reaction, the minimum detection limit of the assay established in this study was 7.73 PFU/mL, and there was a good linear relationship between viral load and Cq value with a correlation coefficient (R2) of 0.998. Moreover, the method has good specificity, sensitivity, and repeatability. The established RT-qPCR is 100-fold more sensitive than the conventional RT-PCR. The best cutoff value for the method was determined to be 37.59 by receiver operating characteristic (ROC) curve analysis. The area under the curve (AUC) was 0.956. Meanwhile, we collected 2,847 serum specimens from swine, horses, bovines, sheep, and 17,080 mosquito specimens in Shandong Province in 2022. The positive detection rates by RT-qPCR were 1%, 1%, 0.2%, 0%, and 3%, respectively. In conclusion, the method was used for epidemiological investigation, which has extensive application prospects.

SARS-CoV-2 Omicron and its current known unknowns: A narrative review.

The emergence of the SARS‐CoV‐2 Omicron variant (B.1.1.529) has created great global distress. This variant of concern shows multiple sublineages, importantly B.1.1.529.1 (BA.1), BA.1 + R346K (BA.1.1), and B.1.1.529.2 (BA.2), each with unique properties. However, little is known about this new variant, specifically its sub‐variants. A narrative review was conducted to summarise the latest findings on transmissibility, clinical manifestations, diagnosis, and efficacy of current vaccines and treatments. Omicron has shown two times higher transmission rates than Delta and above ten times more infectious than other variants over a similar period. With more than 30 mutations in the spike protein's receptor‐binding domain, there is reduced detection by conventional RT‐PCR and rapid antigen tests. Moreover, the two‐dose vaccine effectiveness against Delta and Omicron variants was found to be approximately 21%, suggesting an urgent need for a booster dose to prevent the possibility of breakthrough infections. However, the current vaccines remain highly efficacious against severe disease, hospitalisation, and mortality. Japanese preliminary lab data elucidated that the Omicron sublineage BA.2 shows a higher illness severity than BA.1. To date, the clinical management of Omicron remains unchanged, except for monoclonal antibodies. Thus far, only Bebtelovimab could sufficiently treat all three sub‐variants of Omicron. Further studies are warranted to understand the complexity of Omicron and its sub‐variants. Such research is necessary to improve the management and prevention of Omicron infection.

A Naked-Eye Visual Reverse Transcription Loop-Mediated Isothermal Amplification with Sharp Color Changes for Potential Pen-Side Test of Foot-and-Mouth Disease Virus.

Visual loop-mediated isothermal amplification (LAMP) is qualified to be applied in the field to detect pathogens due to its simplicity, rapidity and cost saving. However, the color changes in currently reported visual reverse transcription LAMP (RT-LAMP) for foot-and-mouth disease virus (FMDV) detection are not so obvious to the naked eye, so interpretation of results is troublesome. In this study, a new naked-eye visual RT-LAMP to detect all seven distinct serotypes of FMDV was established based on the 3D genes by using pH-sensitive neutral red as the indicator, rendering a sharp contrast of color changes between the negative (light orange) and the positive (pink). Analytical sensitivity tests showed that the detection limit of the visual RT-LAMP was 104 copies/µL while those were 103 and 104 copies/µL for the RT-qPCR and conventional RT-PCR methods, respectively. Specificity tests proved that the established visual RT-LAMP assay had no cross-reactivity with other common livestock viruses. Furthermore, the analysis of 59 clinical samples showed 98.31% and 100% concordance with the RT-qPCR and the RT-PCR, respectively. The pan-serotypic FMD visual RT-LAMP assay could be suitable for a pen-side test of all seven serotypes of FMDV because the results could be easily distinguished by the naked eye without the requirement of complicated instruments and professional technicians. Hence, the novel method may have a promising prospect in field tests which exert an important role in monitoring, preventing, and controlling FMD, especially in regions with no PCR or qPCR instrument available.

First report of watermelon crinkle leaf-associated virus 1 naturally infecting watermelon (Citrullus lanatus) in Georgia, USA.

Watermelon (Citrullus lanatus) is one of the major vegetable crops grown in Georgia during the spring and summer seasons, contributing $180 million of farmgate value to the state's economy (Georgia Farm Gate Value Report 2019). During the summer of 2021, watermelon plants with foliar symptoms such as yellow mottling, chlorosis, and wrinkling with thickened, bunchy, and upward curling were observed on commercial fields of Georgia, USA. A disease incidence of 15-20% in ~56 ac in Tift county and 10-15% in ~60 ac in Wilcox county was observed. The symptoms observed were similar to those described for watermelon crinkle leaf-associated viruses (WCLaV-1 and WCLaV-2) from Florida (Hendrick et al., 2021) and Texas (Hernandez et al., 2021). Symptomatic leaves from Tift (n=40) and Wilcox (n=20) counties were collected, surface sterilized with 0.1% bleach and used for total nucleic acid extractions using MagMAX 96 Viral RNA isolation kit (ThermoFisher Scientific, Waltham, MA, USA) following the manufacturer's instruction without DNase treatment. The potential introduction of WCLaV-1 and WCLaV-2 into Georgia was tested by reverse-transcription-polymerase chain reaction (RT-PCR) assay using specific primers targeting RNA-dependent-RNA polymerase (RdRp) and movement protein (MP) genes of both viruses (Hernandez et al., 2021). The expected amplicon sizes for RdRp (~900 nt) and MP (~500 nt) genes of WCLaV-1 located on RNA 1 and RNA 2 segements, respectively, were observed in 39 of 40 (97.5%) samples from Tift and seven of 20 (35%) samples from Wilcox. However, WCLaV-2 was not detected in any of the tested samples. All 60 samples also tested negative for the whitefly-transmitted viruses prevalent in the region, including cucurbit chlorotic yellows virus, cucurbit yellow stunting disorder virus, and cucurbit leaf crumple virus using virus-specific primers (Kavalappara et al., 2021). A subset of the samples analyzed by RT-PCR were also tested by SYBR green-based real-time RT-PCR assay targeting MP gene of WCLaV-1 using primers WCLaV-1FP (5'TCCACAAGCTTGATGGA- GGG3') and WCLaV-1RP (5'TCCCGAGTGAGGAAGCTAGT3'). The virus was detected in samples from both counties and the results matched with those obtained by the conventional RT-PCR assays (Suppl. Table 1). The presence of WCLaV-1 was further confirmed by sequencing (Genewiz, South Plainfield, NJ, USA) coupled with BLASTn analysis of amplicons resulted from the conventional RT-PCR from three randomly selected samples . The partial RdRp sequences (OL469153 to OL469155) were 99.3% and 99.9% identical to the corresponding sequences of WCLaV-1 isolates from China (KY781184) and Texas (MW559074) respectively. The partial MP sequences (OL469150 to OL469152) were 100% identical to those from China (KY781185) and Texas (MW559077). WCLaV-1 and WCLaV-2 were first discovered in Asia (Xin et al., 2017). Both viruses were subsequently reported from North and South Americas (Hendrick et al., 2021; Hernandez et al., 2021; Maeda et al., 2021), indicating their geographical expansion. Biological information, including vector relations, is unknown for both viruses and other members of the genus Coguvirus (family Phenuiviridae), to which they are provisionally assigned (Zhang et al., 2021). Further studies are also required to understand the biology and impact of both viruses on watermelon production and other crops, if any.

Smilax auriculata: A new host for Orchid fleck dichorhavirus identified in Florida, USA.

In June 2020, Orchid fleck virus (OFV) was detected in a species of Liriope in Leon and Alachua County, Florida (Fife et al; 2021). In October of the same year, four adjacent dune/ear-leaf greenbrier vines, Smilax auriculata (Smilaceae: Liliales), showed yellowing and mottling symptoms (Figure 1). Infected and healthy S. auriculata leaves samples were collected in Alachua County by the Florida Department of Agriculture and Consumer Services, Gainesville, Florida. OFV primers successfully detected in four Smilax samples by conventional RT-PCR assay. Amplicon sequences (Acc. No. MZ645935 and MZ645938) shared 99% nucleotide identity with OFV infecting orchids (LC222629) and citrus (MK522804). The OFV subgroup I (OFV-Orc1) and subgroup II (OFV-Orc2) specific primers (Kondo et al 2017) were utilized to confirm the presence of OFV type strains infecting Smilax. Sanger sequencing of subgroup I specific amplicons (MZ645934) shared 99% nucleotide identity with OFV-Orc1 (LC222629) whereas subgroup II specific amplicon sequence (MZ645930) shared 98-99 % nucleotide identity with OFV-Orc2 (AB244417). Further confirmation was done by USDA-APHIS-PPQ-Plant Pathogen Confirmatory Diagnostics Laboratory utilizing optimized conventional RT-PCR protocols (Roy et al. 2020) and deep sequencing on a on a NextSeq550 Illumina platform. Assembled reads identified seven non-overlapping viral contigs. Five RNA1 and two RNA2 contigs covered more than 97% of the bipartite OFV genome with average coverage depth of 5297.61 and 5186.04, respectively. Contigs of RNA1 and RNA2 shared 98-99% nt identity to OFV-Orc2-RNA1 (AB244417) and OFV-Orc-RNA2 (AB244418 and LC222630). No other pathogen sequences were identified. This is the first time the genus Smilax has been identified as a natural host of OFV. Very recent findings of OFV-Orc in Florida in Liriope, Aspidistra, and Ophiopogon among the Asparagaceae family members (Fife et al; 2021) and now in the Smilacaceae suggest a broader host range of the virus than previously known; further research should be conducted to better characterize the potential risk of introduction into citrus in Florida.

903 Protein Saver cards: the best alternative for dried blood spot storage at room temperature for HCV RNA

Hepatitis C virus (HCV) infection remains a global health problem, detected only in the early stages by molecular tests. Molecular tests detect HCV RNA, which is very prone to degradation by ribonucleases, reason why blood samples must be transported and stored at − 20 °C, or even − 70 °C for long-term storage. Flinders Technology Associates (FTA) cards are a useful sampling collecting device for dry blood spot (DBS) storage, especially for low and middle-income countries (LMIC). In this study, we analyzed viral HCV RNA integrity for long-term storage at room temperature compared to − 20 °C using two different types of cards for DBS: FTA Classic and 903 Protein Saver cards. For this purpose, DBS were prepared on these cards using blood or plasma samples from HCV infected patients, and samples were analysed by conventional RT-PCR. Our results showed that 903 Protein Saver cards are the best and cheapest alternative for DBS storage at room temperature. In these conditions, we found that HCV RNA integrity lasted for up to 9 months.

Evaluation of enterovirus nucleic acids detection method based on ultra‐fast real‐time fluorescence RT‐PCR technology—A pilot study

The outbreak of COVID-19 epidemic has enabled the establishment and application of various rapid detection methods. It is particularly important to establish a fast and accurate detection method for enterovirus, which will be beneficial for clinical diagnosis, epidemic prevention and control, and timely traceability. Through establishing an ultra-fast reverse transcription-polymerase chain reaction (RT-PCR) equipment, this study aimed to evaluate the sensitivity and specificity of the testing method of enterovirus nucleic acids based on ultra-fast real-time fluorescence RT-PCR technology. A total of 61 cases were sampled, which were then transported and preserved. After the nucleic acid extraction, the nucleic acids of the same sample were tested with the enterovirus nucleic acid detection kit produced by Guangzhou Da An Gene Company and the ultra-fast RT-PCR equipment system established in this study. ABI7500Fast and Ahram biosystems S1 fast equipment were used for amplification detection. If the sample had an S-shaped amplification curve in the FAM channel and the Ct value ≤40.00, the result was positive. The sensitivity, precision, and accuracy of the detection method were then verified. This study established a novel testing method to achieve enterovirus nucleic acid detection within 24 min. The sensitivity detection limit of the method was 1.0 × 102 copies/ml. The coefficients of variation for repeated detection of the high, medium, and low concentration samples were 2.644%, 1.674%, and 4.281%, respectively, with good detection repeatability. In addition, a total of 29 cases were positive by the ultra-fast RT-PCR detection method in 61 suspected samples, which was consistent with the conventional fluorescent RT-PCR method. The established rapid detection method can greatly shorten the time for providing a detection report, which may greatly improve the efficiency of diagnosis and treatment.

Rapid SARS-CoV-2 Virus Enrichment and RNA Extraction for Efficient Diagnostic Screening of Pooled Nasopharyngeal or Saliva Samples for Dilutions Up to 1:100.

As COVID-19 transmission control measures are gradually being lifted, a sensitive and rapid diagnostic method for large-scale screening could prove essential for monitoring population infection rates. However, many rapid workflows for SARS-CoV-2 detection and diagnosis are not amenable to the analysis of large-volume samples. Previously, our group demonstrated a technique for SARS-CoV-2 nanoparticle-facilitated enrichment and enzymatic lysis from clinical samples in under 10 min. Here, this sample preparation strategy was applied to pooled samples originating from nasopharyngeal (NP) swabs eluted in viral transport medium (VTM) and saliva samples diluted up to 1:100. This preparation method was coupled with conventional RT-PCR on gold-standard instrumentation for proof-of-concept. Additionally, real-time PCR analysis was conducted using an in-house, ultra-rapid real-time microfluidic instrument paired with an experimentally optimized rapid protocol. Following pooling and extraction from clinical samples, average cycle threshold (CT) values from resultant eluates generally increased as the pooling dilution factor increased; further, results from a double-blind study demonstrated 100% concordance with clinical values. In addition, preliminary data obtained from amplification of eluates prepared by this technique and analyzed using our portable, ultra-rapid real-time microfluidic PCR amplification instrument showed progress toward a streamlined method for rapid SARS-CoV-2 analysis from pooled samples.

Molecular Characterization of Recently Classified Newcastle Disease Virus Genotype VII.1.1 Isolated from Egypt

Newcastle disease virus (NDV) is classified as Avian OrthoAvulavirus-1 (AOAV-1) and is still one of the most important poultry diseases in the world. Collected tissue specimens (trachea, cecal tonsils, and spleen) from 85 chicken flocks (broilers, layers, and native breeds) raised in 5 Egyptian governorates (El-Qalubia, El-Behaira, El-Menofia, El-Gharbia, and Alexandria) in the period between March 2019 to February 2020. The flocks had a history of vaccination against ND and showed clinical signs and lesions of infection. We characterized the isolates molecularly using conventional RT-PCR via amplifying the NDV full Fusion protein gene. The analysis of the full F-gene sequence revealed that our isolates were classified as genotype VII with the characteristic amino acids motif in the fusion protein cleavage site for the velogenic NDV (vNDV) strains. Among the molecularly identified NDV Genotype VII isolates, 5 representative isolates in different 5 Egyptian Governorates were sequenced for full fusion protein gene (sequence). The obtained sequences were submitted on GenBank: MW580389, MW580388, MW580387, MW566177, and MW590306. The five isolates' full-length F protein gene amino acid sequences revealed 99.5% identity with the Reference GenBank NDV/Egypt/ch/MN51/2019 strain isolate. The deduced amino acids sequences' comparative alignment of the five Avian OrthoAvulavirus-1 isolates confirmed the presence of motif of virulent strains (RRQKRF) between 112 and 117 residues of fusion protein cleavage site. All five AOAV-1 isolates from 2019 and 2020 belonged to the NDV genotype classified as genotype VII.1.1 depending on full Fusion gene sequences; those five isolates were grouped with subgenotype VIId. Through significant genetic changes in vNDV observed in our study, continuous monitoring of the multiple vNDV outbreaks in vaccinated chicken and targeted evaluation of the used vaccines.

Isolation and Molecular Characterization of Peste des Petits Ruminants Virus from Outbreaks in Southern Ethiopia, 2020.

Peste des petits ruminants (PPR) is one of the most important transboundary diseases of small ruminants. In this study, nasal and oral swabs (n = 24) were collected from sheep (n = 7) and goats (n = 17) with clinical signs in southern Ethiopia in March 2020. PPR virus was isolated on Vero dog cells expressing the signaling lymphocyte activation molecule (VDS) and screened using RT-qPCR. Positive samples were confirmed by conventional RT-PCR followed by sequencing of a partial nucleoprotein (N) gene segment. Results revealed that 54% (n = 13/24) of the tested samples were PPRV-positive Phylogenetic analysis revealed that the viruses belonged to lineage IV and lineage II. The lineage IV viruses were similar, although not identical, to other lineage IV viruses previously reported in Ethiopia and other East African countries while the lineage II viruses have been reported for the first time in Ethiopia showed a high nucleotide identity (99.06%) with the vaccine (Nigeria 75/1) that is currently used in Ethiopia for the prevention of PPR. Further investigations are therefore recommended in order to fully understand the true nature of the lineage II PPRVs in Ethiopia.

Development of an ultra-sensitive single-tube nested PCR assay for rapid detection of Campylobacter jejuni in ground chicken

Traditional culture-based detection methods for Campylobacteri jejuni, a leading cause of human bacterial gastroenteritis worldwide, are time-consuming, cumbersome, and lacking in reliability. While polymerase chain reaction (PCR) has been frequently used for pathogen testing, it might generate false-negative results due to inadequate sensitivity. This study was the first to explore novel single-tube nested PCR (STN-PCR) to detect pathogens in food. Two pairs of nested PCR primers were designed based on the hippuricase gene of C. jejuni. The annealing temperatures and concentrations of nested primers were optimized to ensure the sequential use of outer and inner pairs of primers during amplification. Efficacy of the developed STN-PCR assay was compared with standard culture-based methods and conventional PCR in artificially contaminated ground chicken homogenate. Limit of detection of the STN-PCR assay was determined to be 3.6 × 101 CFU/ml of C. jejuni in the homogenate without enrichment, which was 100 times lower than conventional PCR. Moreover, 0.1 CFU/g of C. jejuni in ground chicken homogenate was identified by STN-real time PCR (rtPCR) after 24 h of enrichment, while a 48-h enrichment was required for culture-based methods and conventional rtPCR. This developed assay provides a powerful tool for rapid, highly specific, and ultra-sensitive detection of C. jejuni and may potentially be used to identify contaminated chicken and other foods.

Chicken CDS2 isoforms presented distinct spatio-temporal expression pattern and regulated by insulin in a breed-specific manner

The cytidine diphosphate diacylglycerol synthases (CDSs) gene encodes the cytidine diphosphate-diacylglycerol (CDP-DAG) synthase enzyme that catalyzes the formation of CDP-diacylglycerol from phosphatidic acid. At present, there are no reports of CDS2 in birds. Here, we identified chicken CDS2 transcripts by combining conventional RT-PCR amplification, 5′ rapid amplification of cDNA ends (RACE), and 3′ RACE, explored the spatio-temporal expression profiles of total CDS2 and the longest transcript variant CDS2-4, and investigated the effect of exogenous insulin on the mRNA level of total CDS2 via quantitative RT-PCR. Four transcripts of chicken CDS2 (CDS2-1, -2, -3, and -4) were identified, which were alternatively spliced at the 3′-untranslated region (UTR). Both total CDS2 and CDS2-4 were prominently expressed in adipose tissue, and exhibited low expression in liver and pectoralis of 49-day-old chickens. Regarding the spatio-temporal expression patterns of CDS2 in chicken, total CDS2 exhibited a similar temporal expression tendency with a high level in the later period of incubation (embryonic day 19 [E19] or 1-day-old) in the brain, liver, and pectoralis. While CDS2-4 presented a distinct temporal expression pattern in these tissues, CDS2-4 levels peaked at 21 d in the brain and pectoralis, while liver CDS2-4 mRNA levels were highest at the early stage of hatching (E10). Total CDS2 (P < 0.001) and CDS2-4 (P = 0.0090) mRNA levels in the liver were differentially regulated throughout the development of the chicken. Total CDS2 levels in the liver of Silky chickens were higher than that of the broiler in the basal state and after insulin stimulation. Exogenous insulin significantly down-regulated the level of total CDS2 at 240 min in the pectoralis of Silky chickens (P < 0.01). In conclusion, chicken CDS2 isoforms with variation at the 3′-UTR were identified, which was prominently expressed in adipose tissue. Total CDS2 and CDS2-4 presented distinct spatio-temporal expression patterns, that is they were differentially regulated with age in brain, liver, and pectoralis. Insulin could regulate chicken CDS2 levels in a breed- and tissue-specific manner.

Molecular characterization of sapovirus from children with gastroenteritis in Botswana

Sapoviruses are an important cause of acute viral gastroenteritis in children. The objective of this study was to determine the burden and genetic diversity of sapoviruses in children hospitalized with acute gastroenteritis in Botswana between 2016 and 2018. Samples were screened using the BioFire® Filmarray® GI Panel assay and for positive sapovirus samples, conventional RT-PCR was used to amplify the partial VP1 gene. Strain characterization was performed using both the Human Calicivirus Typing tool and the NCBI GenBank BLAST. Phylogenetic and evolutionary analysis was inferred using BEAST V1.10.4. General time-reversible was used as a nucleotide substitution model. Sapovirus was detected in 6.5% of participants and two different sapovirus genotypes GI.1 (5/7) and GI.6 (2/7) were identified from the seven samples. This study provides the first data on sapovirus infections and their genetic diversity in a clinical setting in Botswana, contributing to the global knowledge of this virus.

First report of canine Astrovirus and Sapovirus in Greece, hosting both asymptomatic and gastroenteritis symptomatic dogs

BackgroundAstrovirus, Norovirus and Sapovirus are widely distributed viruses in humans and animals worldwide. They have frequently been associated with disease, mainly of gastroenteric nature. In dogs, these viruses have been detected both in symptomatic and asymptomatic animals, mainly of young age.MethodsIn the present epidemiologic study, we investigated the presence of canine Astrovirus (CAstV), canine Norovirus (canine NoV) and canine Sapovirus (Canine SaV) in saliva and stools of 201 domestic dogs originating from throughout Greece, based on two different molecular methods, i.e. conventional and SYBR-Green Real-time RT-PCR. The samples derived from young and adult asymptomatic and symptomatic animals. CAstV was detected in 15/201 (7.5%) and 29/201 (15%) of the examined dogs using conventional RT-PCR and SYBR-Green Real time RT-PCR, respectively.ResultsThe prevalence of the virus was higher at healthy dogs, with a slight discrepancy of the two methods on the aspect of age (67% young dogs with the method of conventional RT-PCR, versus 52% adult positive dogs with the method of SYBR-Green Real-time RT-PCR). Canine SaV was detected in 52/201 (23%) of the dogs (mainly young and asymptomatic), with the method of SYBR-Green Real-time RT-PCR only, while canine NoV was not detected in any sample with either of the two methods applied. Sequencing of the CAstV positive samples resulted in the acquisition of one CAstV sequence. Phylogenetic analysis confirmed the results, clustering the CAstV sequence with homologous canine hosting sequences from other countries.ConclusionsCAstV and Canine SaV were proved to circulate in Greek dogs. SYBR-Green Real time RT-PCR showed greater sensitivity in the detection of these viruses. Additionally, we were able to specify the CAstV strain that circulates in Greece, through phylogenetic analysis. To our knowledge, this is the first epidemiological study of CAstV and canine SaV in dogs in Greece, as well as the first time detected in dogs from Greece.

Establishment of a duplex TaqMan RT-PCR for the differential detection of RHDV GI.1 and GI.2

BackgroundRabbit haemorrhagic disease (RHD) is a highly contagious and acute fatal hepatitis of the European rabbit (Oryctolagus cuniculus), caused by a calicivirus (genus Lagovirus). Up to 2010, all RHD viruses (RHDV) isolated belonged to one genotype. In 2010, a new genotype of RHDV (RHDV2/b, currently designated GI.2 based on phylogenetic analysis) emerged in France. The aim of this study was to develop a rapid, simple, specific and sensitive TaqMan real-time PCR assay for the classic strain of RHDV and RHDV2 detection. Specific primers and probes were designed for the VP60 gene of RHDV and RHDV2 within the conserved region of viral genome. ResultsThis study was demonstrated to be highly specific for RHDV and RHDV2, without cross-reactions with other non-targeted viruses. The detection limit of this work was 102 copies of RHDV and RHDV2, respectively. The coefficient of variation of the assay was less than 5% for both intra-assay and inter-assay. The reproducibility of method was assessed using plasmids and the coefficient of variation obtained was 0.2–3.70. Of 79 clinical samples, 68 were positive samples (86.08%), of which 60 were classic RHDV variants (75.9%), 4 were co-infected (5.06%) and 8 were RHDV2 (10.12%), those results are more sensitivity compare with conventional RT-PCR RT-PCR. ConclusionsIn conclusion, this duplex TaqMan RT-qPCR based on VP60 gene of RHDV and RHDV2 could be a valuable tool in diagnose and molecular epidemiological study of the RHDV and RHDV2.

Sensitive and specific clinically diagnosis of SARS-CoV-2 employing a novel biosensor based on boron nitride quantum dots/flower-like gold nanostructures signal amplification

The sudden increase of the COVID-19 outbreak and its continued growth with mutations in various forms has created a global health crisis as well as devastating social and economic effects over the past two years. In this study, a screen-printed carbon electrode reinforced with boron nitride quantum dots/flower-like gold nanostructures (BNQDs/FGNs/SPCE) and functionalized by highly specific antisense DNA oligonucleotide presents an alternative and promising solution for targeting SARS-CoV-2 RNA without nucleic acid amplification. The platform was tested on 120 SARS-CoV-2 RNA isolated from real clinical samples (60 positive and 60 negative confirmed by conventional RT-PCR method). Based on obtained quantitative results and statistical analysis (box-diagram, cutoff value, receiver operating characteristic curve, and t-test), the biosensor revealed a significant difference between the two positive and negative groups with 100% sensitivity and 100% specificity. To evaluate the quantitation capacity and detection limit of the biosensor for clinical trials, the detection performance of the biosensor for continuously diluted RNA isolated from SARS-CoV-2-confirmed patients was compared to those obtained by RT-PCR, demonstrating that the detection limit of the biosensor is lower than or comparable to that of RT-PCR. The ssDNA/BNQDs/FGNs/SPCE showed negligible cross-reactivity with RNA fragments isolated from Influenza A (IAV) clinical samples and also remained stable for up to 14 days. In conclusion, the fabricated biosensor may serve as a promising tool for point-of-care applications.