Control Of Plasmid Replication Research Articles

Control of ColE1 plasmid replication by antisense RNA

Control of ColE1 plasmid replication by antisense RNA

Control of plasmid replication—How do DNA iterons set the replication frequency?

Kurt NordstrBm Department of Microbiology Biomedical Center Uppsala University S-751 23 Uppsala Sweden Plasmids control their own replication; that is, during ex- ponential growth of a bacterial population, they are always present in defined copy numbers that are controlled by the plasmids themselves. The copy number may be different for the same plasmid in different hosts and, for the same plasmid-host combination, the copy number may be different under different growth conditions. At steady state, the number of replications per plasmid copy is exactly one per cell generation. This defines the steady state as shown in Figure 1. It should be stressed that while this is true for the population, it is not for in- dividual plasmids-these are selected randomly for repli- cation. Principles of Copy Number Control If the copy number is for some reason higher than the steady-state value, replication frequency is adjusted to be- come lower than one per plasmid copy (and cell genera- tion; Figure 1). At reduced copy numbers, the opposite is true; replication frequency exceeds one per plasmid copy and cell generation. Hence, the control curve falls within the hatched areas of Figure 1. This ensures that the steady-state value is retained and deviations are adjusted. Figure 1 illustrates that plasmids measure their copy number and use this measurement to adjust the replica- tion frequency to maintain a defined copy number. Both these processes use the same negative control circuit. The negative control element can be a repressor protein, antisense RNA, or direct repeats of DNA called iterons (see table; reviewed in Nordstrom, 1985). Copy Number Control by Repressor Protein Plasmid Xdv uses a repressor protein to adjust its replica- tion frequency (Figure 2A). Replication of hdv is limited by the availability of 0 protein, transcriptional activation of the replication origin (ori, which is situated within the 0 gene), or both. The negative control is exerted by the gene product of the first gene on the 0 operon, the Cro (or Tof) repressor. Hence, synthesis of Cro protein is autoregu- lated, which in turn ensures that copy number is con- trolled. The general properties of this control system have been discussed previously (Nordstrdm, 1985). Computer studies based on data about li indicate that the kinetics are essentially hyperbolic (Figure 1; Lee and Bailey, 1984). Using essentially the same data except for the values for some transcription and translation rate constants, a con- trol curve is predicted that is significantly less steep than that of Lee and Bailey (Figure 1; Womble and Rownd, 1988a); this would give a slower adjustment of the copy number from deviations back to the steady-state value than a hyperbolic response would.

DNA sequence analysis of the replication region of thePseudomonas aeruginosa plasmid R91-5

A 2815-basepair DNA segment of thePseudomonas aeruginosa bacterial plasmid R91-5 has been sequenced which includes a 2617-basepair region demonstrated to control replication and incompatibility. Sequence analysis and Northern blotting identified one large transcribed open reading frame of 888 basepairs which is believed to encode a replication protein as it has the properties of a DNA binding protein. A second smaller open reading frame of 276 basepairs was also shown to be transcriptionally active. This open reading frame overlaps a 329-basepair region which expresses plasmid incompatibility. Analysis indicates that the control of R91-5 replication does not readily conform to either of the two well-characterized models of plasmid replication control identified with other bacterial plasmids as its DNA does not encode an RNA countertranscript complementary to the transcript of the large open reading frame nor does it possess readily identifiable direct or inverted repeats. This suggests that replication in this plasmid may have some unique features.

Control of colE1 plasmid replication: Intermediates in the binding of RNA I and RNA II

Replication of plasmid ColE1 is regulated by a plasmid-specified small RNA (RNA I). RNA I binds to the precursor (RNA II) of the primer for DNA synthesis and inhibits primer formation. The process of binding of RNA I to RNA II that results in formation of a stably bound complex consists of a series of reactions forming complexes differing in the stability. Formation of a very unstable early intermediate that was previously inferred from the inhibition of stable binding caused by a second RNA I species was firmly established by more extensive studies. This complex is converted to a more stable yet reversible complex that was identified by its RNase sensitivity, which was altered from that of the earlier complex or from that of free RNA I or RNA II. In these complexes, most loops of RNA II interact with their complementary loops of RNA I. The kinetic and structural analyses of the binding process predict formation of a complex interacting at a single pair of complementary loops that precedes formation of these complexes. Thus the process of binding of RNA I to RNA II is seen to consist of a sequence of reactions producing a series of progressively more stable intermediates leading to the final product.

Control of ColE1 Plasmid replication: Interaction of rom protein with an unstable complex formed by RNA I and RNA II

A transcript (RNA I) from ColE1 inhibits initiation of replication of the plasmid DNA by binding to the precursor of the primer RNA (RNA II). The ability of RNA I to inhibit replication is altered by the presence of a plasmid-specified small protein, Rom. In vitro, RNA I binds to RNA II to form a very unstable complex, C ∗. Binding of a single molecule of Rom converts C ∗ to a more stable complex, C m∗. Each of these complexes, C ∗ or C m∗, transforms to a more stable complex, C ∗∗ or C m∗∗, respectively. While formation of complex C ∗ or C m∗ is inferred from the inhibition of binding caused by a second RNA I species, that of complex C ∗∗ or C m∗∗ is detected by alteration of RNase sensitivity. Complex C ∗ converts to complex C m∗ very rapidly upon addition of Rom to the medium and complex C m∗ converts to complex C ∗ very rapidly by removal of Rom from the medium. On the other hand, complexes C ∗∗ and C m∗∗ do not rapidly interconvert, but can eventually transform to the same stable final product. Thus, Rom affects binding of RNA I to RNA II through conversion of a very unstable early intermediate to a more stable complex, creating a second pathway for their stable binding.

Translational control by antisense RNA in control of plasmid replication

Control of replication of plasmids involves two processes: measurement of the copy number of the plasmid and adjustment of the replication frequency accordingly. For both these processes IncFII plasmids use an antisense RNA (CopA RNA) that forms a duplex with the upstream region (CopT) of the mRNA of the rate-limiting RepA protein. The kinetics of duplex formation was measured in vitro for the wild type and for a cop mutant plasmid; the mutant showed a reduction in the second-order rate constant for the formation of the RNA duplex and a similar increase in copy number. Hence, the kinetics of duplex formation and the concentration of CopA RNA determines the copy number of the plasmid.

Replication and incompatibility properties of plasmid pUB110 in Bacillus subtilis.

Within plasmid pUB110 we have identified a 1.2 kb segment necessary and sufficient for driving autonomous replication in Rec+ cells at a wild-type copy number. This region can be divided into three functionally discrete segments: a 24 base pair (bp) region that acts as an origin, a 949 bp determinant of an essential replication protein, repU, and a 358 bp incompatibility region, incA, overlapping with the repU gene. The synthesis of the IncA determinant/s proceeds in the direction opposite to that of RepU. The positively (RepU) and negatively (IncA) trans-acting products seem to be involved in the control of plasmid replication. The RepU product has an Mr of 39 kDa, could be overproduced in Escherichia coli, and binds to the pUB110 origin region. Outside the minimal replicon a cis-acting, orientation dependent, 516 bp determinant is required (i) to compete with a coexisting incompatible plasmid and (ii) for segregational stability.

Host control of plasmid replication: requirement for the sigma factor sigma 32 in transcription of mini-F replication initiator gene.

Replication of F factor or mini-F plasmid is strongly inhibited in the rpoH (htpR) mutants of Escherichia coli deficient in the sigma factor (sigma 32) known to be required for heat shock gene expression. Transcription of the mini-F repE gene encoding a replication initiator protein (E protein) was examined by operon fusion and by direct determination of repE mRNA. The synthesis rate and the level of repE mRNA were found to increase transiently upon temperature upshift (30 degrees C to 42 degrees C) in wild-type cells but to decrease rapidly in the rpoH mutants. Thus sigma 32 appeared to be directly involved in transcription of repE whose product, E protein, in turn activates DNA replication from the mini-F ori2 region. This scheme of host-controlled plasmid replication is further supported by the analysis of transcription in vitro: RNA synthesis can be initiated from the repE promoter by a minor form of RNA polymerase containing sigma 32 but not by the major polymerase containing the normal sigma factor sigma 70. The sigma 32-mediated transcription from the repE promoter is strongly inhibited by the E protein. We conclude that transcription of the mini-F repE gene is mediated by the host transcription factor sigma 32 and is negatively controlled by its own product.

A mathematical model for prediction of plasmid copy number and genetic stability in Escherichia coli

The design of bioreactors for genetically modified bacterial cultures would benefit from predictive models. Of particular importance is the interaction of the external environment, cell physiology, and control of plasmid copy number. We have recently developed a model based on the molecular mechanisms for control of replication of Co1E1 type plasmids. The inclusion of the plasmid model into a single-cell E. coli model allows the explicit prediction of the interaction of cell physiology and plasmid-encoded functions. The model predictions of the copy number of plasmids with the Co1E1 origin of replication carrying a variety of regulatory mutations is very close to that observed experimentally.All of the model parameters for plasmid replication control can be obtained independently and no adjustable parameters are needed for the plasmid model. In this article we discuss the model's use in predicting the effect of operating conditions on production of a protein from a plasmid encoded gene and the stability of the recombinant cells in a continuous culture.

Structure of the ColE1 Rop protein at 1.7 Å resolution

Structural details of the Rop protein from plasmid ColE1 are presented, with a description of the X-ray crystal structure determination and refinement at a nominal resolution of 1.7 Å. The 63 amino acid protein is a dimer. Each monomer consists almost entirely of two alpha helices, the whole molecule forming a highly regular four-alpha-helix bundle. This may be approximated by a four-stranded rope with a radius of 7.0 Å, a left-handed helical twist and a pitch of 172.5 Å. The packing constraints for this novel type of coiled-coil structure are given. The protein acts in the control of plasmid replication via regulation of an RNA-RNA interaction in a manner not yet understood in atomic detail.

Similarities in control of mini-F plasmid and chromosomal replication in Escherichia coli.

In Escherichia coli, concentrations of a mini-F plasmid with two origins of replication (oriV and oriS) were 50% lower in fast-growing cells than in slow-growing cells. By contrast, a mini-F plasmid deleted for oriV maintained a uniform concentration in both fast- and slow-growing cells, and in this behavior the plasmid mimicked the control by the host of chromosomal origin (oriC) concentration.

DNA and protein interactions in the regulation of plasmid replication.

As for bacterial and animal viruses that employ different mechanisms for their duplication in a host cell, plasmids have evolved different strategies to assure their hereditary stability or maintenance at a specific copy number during cell growth and division. A characteristic feature of plasmid replication control, however, is an involvement of one or more negatively controlling elements. Furthermore, a majority of the bacterial plasmids examined to date contain direct nucleotide sequence repeats at their origin of replication and encode a replication protein that binds to these repeat sequences. The binding of the replication protein (pi protein) specified by the antibiotic resistance plasmid R6K to a set of 22 base pair direct nucleotide sequence repeats is required for the initiation of replication at each of three origins of replication (alpha, beta and gamma) within a 4 Kb segment of R6K. The pi initiation protein is multifunctional in that it has both positive and negative activities in both controlling the initiation of replication and autoregulating its own synthesis. Similarly, the direct repeats of plasmid R6K and several other plasmid systems play more than one role in plasmid replication. These repeats, termed iterons, are not only required for origin activity but also exert a negative effect on plasmid copy number possibly as a result of their 'titration' of a plasmid encoded replication protein. The properties of plasmid replication proteins and direct nucleotide sequence repeats that are important for their opposing positive and negative roles in the regulation of the initiation of replication are described with particular emphasis on plasmid R6K of Escherichia coli.

Mathematical model for the control of ColE1 type plasmid replication

A mathematical model for the molecular events controlling replication of ColE1 type plasmids is described. All the model parameters can be evaluated independently. The model simulates plasmid replication and accurately predicts the copy-number of ColE1 plasmids carrying a variety of regulatory mutations. The model is used to test the plausibility of hypotheses concerning the interactions of regulatory elements involved in the replication apparatus. The model favorably supports the mechanism proposed by Tomizawa and co-workers concerning the nature of RNA-RNA interactions and that the Rom protein increases the binding between the two RNA species. The hypothesis that the interactions of RNA I–II increases the susceptibility of RNA II to the action of endonucleases is not a plausible mechanism.

Control of ColE1 plasmid replication: Binding of RNA I to RNA II and inhibition of primer formation

Formation of the primer for ColE1 DNA replication from the primary transcript, RNA II, is regulated by an antisense transcript, RNA I. Exposure of elongating RNA II 100–360 nucleotides long to RNA I inhibits subsequent primer formation. However, primer forms normally for transcripts longer than 360 nucleotides. Therefore, the rate of binding of RNA I to RNA II is crucial to regulation. The binding rate varies among RNA II transcripts of different lengths. Transcripts longer than 200 nucleotides are bound faster than shorter ones. The Rom protein enhances binding of RNA I to these longer transcripts, whereas it suppresses binding to some shorter ones. The insensitivity to RNA I of transcripts longer than 360 nucleotides is not due to the absence of RNA I binding but to this binding having no effect on primer formation.

Complete nucleotide sequence of the low copy number plasmid pRAT11 and replication control by the RepA protein in Bacillus subtilis.

The 2.6 kb kanamycin-resistant (Kmr) plasmid, pRAT11, was constructed using both the replication determinant (repA) region of the 10.8 kb tetracycline-resistant (Tcr) low copy number plasmid pTB52 and another fragment (0.9 kb) that contained solely the Kmr gene of pUB110. The complete nucleotide sequence of this plasmid was determined. The repA region contained a large open reading frame encoding RepA protein (396 amino acid residues). In vitro transcription and translation of the repA gene were confirmed. RepA protein was shown to be indispensable for plasmid replication, and acted in trans on DNA. The part of the repA gene encoding the specific recognition region of the RepA protein was located and contained 3.5 direct repeats of 24 bp (GGTTTCAAAAATGAAACGGTGGAG). Upstream and downstream of the direct repeats were the recognition sequence (TTATCCACA) of the Escherichia coli DnaA protein and an AT-rich region, respectively. The replication control mechanism of the low copy number Bacillus plasmid is discussed.

プラスミドの複製調節機構

プラスミドの複製調節機構

Directly repeated, 20-bp sequence of plasmid R1162 DNA is required for replication, expression of incompatibility, and copy-number control

DNA required in cis for the replication of the broad-host-range plasmid R1162 is located on two contiguous HpaII fragments of 210 and 370 bp. The latter of these contains three and one-half, perfectly conserved, 20-bp directly repeated sequences. The significance of these for plasmid replication, incompatibility, and copy-number control was examined by generating deletions into these repeats and testing the properties of the remaining DNA. We conclude from the results that the direct repeats are essential for expression of incompatibility and for the decrease in copy number observed when the directly repeated DNA is cloned into R1162. Little, if any, additional DNA is required from the ori region for these properties. Moreover, deletions of intermediate size result in an intermediate level of incompatibility, indicating the importance of the periodic structure of the direct repeats. The directly repeated DNA is also required for an active origin of replication, as are additional, nonrepeated sequences adjacent to this DNA. The properties of the direct repeats are discussed with respect to their possible role in the replication of R1162 DNA.

Negative control of oriC plasmid replication by transcription of the oriC region.

We have demonstrated that the replication of the oriC plasmid, carrying the replication origin of the Escherichia coli chromosome, is inhibited by transcriptional readthrough from an oriC flanking region of the plasmid. This was drawn from an examination of the replication of an oriC plasmid, pKZ4, which bears the lacOP segment at the right-hand side of oriC (the asnA side) in such an orientation that transcription from the lac promoter proceeds towards oriC. Replication of pKZ4 was found to be drastically inhibited by inducing transcription from the lac promoter with IPTG, an inducer of the lactose operon. When trp transcription attenuator termination sequences were inserted near the right-hand end of the oriC region of pKZ4, the replication of the plasmid became considerably insensitive to the inhibitory effect of IPTG. This indicates that the inhibition is due to the frequent leftward transcription, which initiates at the lac promoter and proceeds into the oriC region. Since IPTG inhibits the replication of pKZ4, but not that of another coexisting oriC plasmid which is devoid of the lacOP segment, the replication inhibition is judged to act only in cis. Transcription from the promoter of the chloramphenicol resistance gene also caused the inhibition of oriC plasmid replication.

Control of cole1 plasmid replication: Initial interaction of RNA I and the primer transcript is reversible

Replication of ColEl-type plasmids is known to be regulated by a plasmid-specific RNA (RNA I), whose binding to the transcript (RNA II) from the primer promoter results in inhibition of formation of the primer for DNA replication. In this paper, it is shown that binding of RNA I to the homologous RNA II is inhibited by an RNA I specified by a plasmid of different compatibility. The inhibition is caused by the reversible interaction of RNA II with the heterologous RNA I, which competes with reversible interaction of the two homologous RNAs at a step preceding their stable binding. As predicted from these results, the copy numbers of both CoIE1 and RSF1030 are increased when both plasmids are present in the same cell. The Rom protein enhances the reversible interaction.

Analysis of the individual regulatory components of the IncFII plasmid replication control system.

Replication of the IncFII plasmid NR1 is controlled by regulating the amount of synthesis of the repA1 initiator protein at both the transcriptional and translational levels. We have examined mutations which have altered each of these levels of regulation, resulting in different plasmid copy numbers. The genes which encode each of the individual wild-type or mutant regulatory components from the replication control region of NR1 have been cloned independently into pBR322 vectors, and their effects in trans, either individually or in various combinations, on plasmid incompatibility, stability, copy number, and repA1 gene expression have been defined.