Contour-clamped Homogeneous Electric Field Research Articles

Pulsed-field electrophoresis in contour-clamped homogenous electric fields (CHEF) for fingerprinting ofRhizobiumspp

Abstract A pulsed-field gel electrophoretic method based on contour-clamped homogeneous electric field (CHEF) was developed for the analysis of natural isolates of Rhizobium leguminosarum biovar viciae . The procedure involves the use of ‘rare-cutting’ endonucleases. The separation of genomic DNA fragments with split runs ( τ = 5 s for 15 h followed by τ = 12 s for 9 h) allows a clear definition of profiles with bands ranging from 20–300-kb pairs. Two and a half days are sufficient to reproducibly accomplish the procedure from cell lysis to gel picture. The method can be used for different fast-growing rhizobia.

Pulsed-field electrophoresis in contour-clamped homogenous electric fields (CHEF) for fingerprinting of Rhizobium spp

Pulsed-field electrophoresis in contour-clamped homogenous electric fields (CHEF) for fingerprinting of Rhizobium spp

Contour-clamped homogeneous electric field gel electrophoresis as a powerful epidemiologic tool in yeast infections

To examine the longitudinal and cross-sectional patterns of yeast colonization in critically ill patients using genotypic characteristics defined by contour-clamped homogeneous electric field (CHEF) gel electrophoresis, 322 clinical isolates of Candida species were prospectively collected from 29 critically ill patients under routine surveillance over a 6-month period. All isolates, recovered from multiple anatomic sites and from the same sites on different days, were characterized by several identification methods (germ tube test), phenotyping (API system), and genotyping (electrophoretic karyotyping). Electrophoretic karyotype (EK) was determined using pulsed field electrophoresis with the CHEF technique. We used a karyotyping system for Candida albicans (EK code) that facilitated intraspecies delineation. C. albicans colonized 83% of the 29 patients. Candida sp. strains isolated from an individual patient had an identical EK pattern, even when isolated from different body sites, and remained the same over a prolonged period, up to 140 days. EK delineated not only the different Candida species, but also different strains of C. albicans. Strains of C. albicans isolated from different patients were distinguished using the EK pattern, but not API system. Minor variations in EK pattern could be demonstrated in a minority of strains recovered from four patients and were interpreted as chromosomal rearrangements between parent strains. Severe candidal infections, including eight episodes of fungemia, occurred in 11 of 29 patients (38%). All patients had been previously colonized with strains with identical EK patterns. Infection occurred a mean of 25 days after initial surveillance cultures grew yeast. No horizontal transmission could be demonstrated during the study period. In conclusion, EK is a reproducible, stable marker allowing inter-, as well as, intraspecies Candida strain delineation. EK strain delineation is a useful tool in candidal epidemiologic and pathogenic studies. Yeast colonization with the same strain preceded infection in critically ill patients.

Physical map of the chromosome of Neisseria gonorrhoeae FA1090 with locations of genetic markers, including opa and pil genes

A physical map of the chromosome of Neisseria gonorrhoeae FA1090 has been constructed. Digestion of strain FA1090 DNA with NheI, SpeI, BglII, or PacI resulted in a limited number of fragments that were resolved by contour-clamped homogeneous electric field electrophoresis. The estimated genome size was 2,219 kb. To construct the map, probes corresponding to single-copy chromosomal sequences were used in Southern blots of digested DNA separated on pulsed-field gels, to determine how the fragments from different digests overlapped. Some of the probes represented identified gonococcal genes, whereas others were anonymous cloned fragments of strain FA1090 DNA. By using this approach, a macrorestriction map of the strain FA1090 chromosome was assembled, and the locations of various genetic markers on the map were determined. Once the map was completed, the repeated gene families encoding Opa and pilin proteins were mapped. The 11 opa loci of strain FA1090 were distributed over approximately 60% of the chromosome. The pil loci were more clustered and were located in two regions separated by approximately one-fourth of the chromosome.

The isolation and characterization of a calmodulin-encoding gene ( CMD1) from the dimorphic fungus Candida albicans

Candida albicans is a dimorphic, opportunistic pathogen of humans, and calcium and calmodulin have been implicated in its morphogenic transition. The C. albicans calmodulin-encoding gene, CMD1, was isolated from cDNA and genomic phage λ libraries using the Saccharomyces cerevisiae CMD gene as a hybridization probe. Southern-blot hybridization analysis of genomic DNA suggests the existence of only one type of calmodulin gene in C. albicans. Comparison of cDNA and genomic sequences identified a 222-bp intron located immediately after the Met start codon. The predicted amino acid sequence was 60% identical with yeast CMD and 70% identical with CMDs of filamentous fungi and vertebrates. We have localized the CMD1 gene to chromosome 3 using the contour-clamped homogeneous electric field gel electrophoresis. The CMD1 gene hybridized to a single 650-nucleotide transcript which was present in equivalent amounts in both the yeast and hyphal forms of the organism.

Genes encoding peroxisomal enzymes are not necessarily assigned on the same chromosome of an n-alkane-utilizable yeast Candida tropicalis

We have resolved eight chromosomal bands from an n-alkane-assimilating yeast, Candida tropicalis pK 233, by using contour-clamped homogeneous electric field gel electrophoresis (CHEF). From the results of hybridization of DNA probes of yeast peroxisomal enzymes—catalase, acyl-CoA oxidase, carnitine acetyltransferase, isocitrate lyase, malate synthase, acetoacetyl-CoA thiolase, and 3-ketoacyl-CoA thiolase — to Southern transfers of CHEF gels, these genes were proven not necessarily to be located on the same chromosome. This fact shows that the genes encoding the enzymes tested were not distributed to be cistronic, although simultaneous and inducible synthesis of peroxisomal enzymes occurred in harmony with the proliferation of peroxisomes, suggesting that their co-ordinated expression might be mainly regulated by certain trans-acting factors.

Genome analysis of imperfect fungi: electrophoretic karyotyping and characterization of the nuclear gene coding for glyceraldehyde-3-phosphate dehydrogenase (gpd) of Curvularia lunata

The gene coding for glyceraldehyde-3-phosphate dehydrogenase (gpd) has been isolated from a genomic library of the filamentous fungus Curvularia lunata. The coding region of this gene consists of 1014 nucleotides and is interrupted by four introns. The gpd gene product shows a high degree of sequence identity with the corresponding proteins of various species belonging to both taxonomically related (e.g., Aspergillus nidulans), as well as more divergent, taxa. Using contour-clamped homogeneous electric field (CHEF) gel electrophoresis eight distinct chromosomal bands have been resolved, with two bands migrating as doublets and one as a triplet. Thus, the total number of chromosomes of C. lunata appears to be 12. The size of the chromosomes ranges from about 1.4 Mb to 4.0 Mb allowing an estimation of the genome to be approximately 29.7 Mb. By hybridization of fractionated chromosomes the gpd gene and the rDNA locus have been localized on individual chromosomes.

Treponema pallidum subsp. pallidum has a single, circular chromosome with a size of approximately 900 kilobase pairs

The genome size and chromosome conformation of Treponema pallidum subsp. pallidum, Nichols strain, were determined by contour-clamped homogeneous electric field electrophoresis, a pulsed-field gel electrophoresis technique. Digestion of T. pallidum subsp. pallidum DNA with the restriction endonucleases NotI and SpeI produced 12 and 26 fragments, respectively. Summation of the physical lengths of the fragments produced by NotI and SpeI cleavage yielded average sizes of 900 and 913 kbp, respectively, for the genome of T. pallidum subsp. pallidum. Contour-clamped homogeneous electric field electrophoresis of T. pallidum subsp. pallidum DNA exposed to 4 krads of gamma irradiation resolved a single band of 800 to 1,000 kbp; treatment of the DNA with 16 krads of gamma irradiation resulted in the production of smaller fragments, whereas untreated DNA did not migrate into the gels. The gamma irradiation results indicate that T. pallidum subsp. pallidum has a single, circular chromosome that was linearized at a dosage of 4 krads of gamma irradiation. The size estimate provided by restriction endonuclease digestion with NotI and SpeI shows that the genome of T. pallidum subsp. pallidum, at approximately 900 kbp, is considerably smaller than the 13,700-kbp genome size calculated from renaturation kinetics.

Separation of large DNA by a variable-angle contour-clamped homogeneous electric field apparatus

A device for separating large DNA molecules by pulsed field electrophoresis is described. Based on the principles of contour-clamped homogeneous electric fields (CHEF), it uses feedback to clamp voltages in a square electrode array, which is compact and inexpensive to construct, adaptable to computer control, and reorients the electric field by arbitrary angles. To illustrate its capabilities, pulsed fields with reorientation angles ranging from 90 to 140° were used to separate DNAs of 4.7 and 5.7 megabases by up to four bandwidths in 20 h. The combination of accessible technology and complete control of the electric field should facilitate the search for ways to resolve even larger DNA.

Physical map of the chromosome of Lactococcus lactis subsp. lactis DL11 and localization of six putative rRNA operons

A physical map of the chromosome of Lactococcus lactis subsp. lactis DL11 was constructed by using the contour-clamped homogeneous electric field mode of pulsed-field gel electrophoresis in one- and two-dimensional separations to analyze restriction digests of high-molecular-weight genomic DNA. The map, which shows all the observed NotI and SmaI sites (six and 21, respectively) and 8 of approximately 30 SalI sites, is circular and yields a total size of 2.58 megabase pairs for the L. lactis subsp. lactis DL11 chromosome. By using rDNA from Mycoplasma capricolum to probe Southern blots of pulsed-and fixed-field digestion patterns, six putative rRNA operons were identified in L. lactis subsp. lactis DL11 and placed on the map of the chromosome. Five of these loci are clustered in a region representing only 20% of the chromosome. The presence of a SmaI site in each of the putative operons allowed the direction of transcription of each operon to be deduced.

Physical map of the Myxococcus xanthus chromosome

The genome of Myxococcus xanthus, which is 9,454 kbp, is one of the largest bacterial genomes. The organization of the DNA and the distribution of genes encoding social and developmental behaviors were examined by using pulsed field gel electrophoresis. Intact genomic DNA was digested with AseI into 16 restriction fragments, which were separated by contour-clamped homogeneous electric field electrophoresis, purified, and radiolabeled. Each AseI fragment was hybridized to SpeI-digested DNA and to an M. xanthus genomic library contained in yeast artificial chromosomes. Some SpeI restriction fragments and yeast artificial chromosome clones contained AseI sites and hybridized with two different AseI restriction fragments, providing evidence for the juxtaposition of these AseI restriction fragments in the chromosome. The deduced AseI physical map is circular, suggesting that this bacterium contains a single, circular chromosome. Transposable elements shown by transduction to be in or near genes of interest were located on specific AseI restriction fragments by restriction analysis and Southern hybridization. Most AseI restriction fragments contained genes involved in social and developmental behaviors.

Human-specific amplification of radiation hybrid DNA fractionated by pulsed-field gel electrophoresis

Recently, a method named interspersed repetitive sequence polymerase chain reaction (IRS-PCR) was described by which, using primers directed against an IRS, human DNA sequences flanked by the IRS are selectively amplified from complex DNA mixtures such as somatic cell hybrid DNA (1,2). Hybrids containing human chromosomal fragments, such as radiation hybrids (RH) (3, 4), have been used to further reduce the complexity of the human DNA template and increase the specificity of IRS-PCR amplification (5). Here we describe a method which facilitates the isolation of specific DNA sequences from a subchromosomal region. We have developed a method to amplify human-specific DNA sequences from pulsed-field gel (PFGE) fractionated RH DNA; by amplifying a fraction of digested RH DNA containing an identifiable DNA restriction fragment, this method provides a means to selectively amplify and enrich for DNA sequences contained within a specific DNA restriction fragment. Genomic DNA from RH 128, a RH harboring about 10% of a human X chromosome including region Xpl 1.22-Xpl 1.1 (P.N.Goodfellow and J.L.Gorski, unpublished data), was prepared in agarose blocks (6) and digested with SfiI (NEB). DNA blocks were loaded into 1.2% LMP agarose gels (BRL) made with 0.5 xTBE and electrophoresed using a contourclamped homogeneous electric field (CHEF) gel system (CHEFDRII; BioRad) at 200 V with pulse times of 60s (15 hrs) and 90s (9 hrs). Horizontal 5 mm gel slices were cut; DNA was recovered by electroelution, dialyzed against TE, sequentially extracted with phenol, chloroform, and ether, precipitated using ammonium acetate, ethanol, and carrier yeast tRNA (10 gg/ml), and resuspended in 50 Al of dH2O. PCRs were 100 ,tl in volume and contained 400 ng of DNA, 50 mM KCl, 10 mM Tris-HCl, 1.6 mM MgCl2, 0.01% gelatin, 250 uM each dNTP, 1 itg RNase A, and 0.5 ,tM primer; the primer, A-517N (5' AAGTGCGGCCGCGATCTCGGCTCACTGCAA 3'), was directed against a consensus Alu repetitive sequence (1) modified to contain a 5' NotI restriction endonuclease recognition sequence. PCR reactions were incubated at 37°C for 1 hr, 94°C for 9 min, and after the addition of 5 U AmpliTaq DNA polymerase (PerkinElmer/Cetus), 36 cycles of 94°C denaturation (1 min), 55°C annealing (1 min), and 72°C extension (4 min) were performed; amplification products were fractionated on a 1.2% agarose gel and stained with ethidium bromide. No products resulted from the amplification of hamster DNA indicating that the primer was specific for human DNA (Fig. 1). Amplification of hybrid DNA containing only a human X chromosome yielded a large number of products while amplification of RH 128 DNA and RH 128 DNA digested with Sfil yielded an identical subset of products (Fig. 1); Sfil-digested RH 128 DNA isolated from LMP agarose (Fig. 1; RH 128 Sfil gp) yielded a reduced but similar pattern of products. Compared to RH 128 DNA, amplification of a fraction of RH 128 DNA (450-500 kb) recovered from a preparative CHEF gel yielded relatively fewer products consistent with a further reduction of human template DNA complexity; the pattern of products observed upon the amplification of similar

Physical map of chromosomal and plasmid DNA comprising the genome of Leptospira interrogans.

The size and physical structure of the Leptospira interrogans genome was characterized using contour-clamped homogenous electric field (CHEF) gel electrophoresis. The L. interrogans genome is approximately 4750 kb in size and is composed of two molecular species of DNA: a 4400 kb chromosome; and a 350 kb plasmid, pLIN1. A physical map of the chromosome was constructed with the restriction enzymes NotI and SfiI. A physical map of pLIN1 was constructed with ApaI, NotI, Sse83871, SgrAI, and SmaI. Both the L. interrogans chromosome and pLIN1 are circular.

Low molecular weight DNA in the heteromeric macronuclei of two cyrtophorid ciliates

Summary— The size range of the native DNA molecules in the heteromeric macronuclei of two cyrtophorid ciliates (Trithigmostoma cucullulus, Chilodonella uncinata) was mainly investigated by using agarose gel electrophoresis. Numerous bands superimposed on a continuous spectrum of molecular sizes between about 0.35 kb and 30 kb were resolved by conventional electrophoresis. Species‐specific banding patterns indicate a variation between species in the copy number of individual DNA fragments. A slight intra‐specific variability of banding patterns can exist. Electrophoretic distributions for two strains of T cucullulus were indeed found to differ by at least one more intense band (‘overamplified’ sequences?). Fractionation by contour‐clamped homogeneous electric field (CHEF) gel electrophoresis revealed that the size continum of macronuclear DNA molecules does not extend beyond 60–70 kb. The average size was estimated to be around 4 kb. Unresolved DNA fraction (> 1000 kb) accounted for less than 10% of the mass of cellular DNA entering CHEF gels. Macronuclear ribosomal DNA of each cyrtophorid species was identified by Southern hybridization with a Tetrahymena rDNA probe. The hybridization signal was observed on a single band of low molecular weight DNA. The corresponding size was close to 14.5 kb in Trithigmostoma and 15.5 kb in Chilodonella, which is about twice the size of monomeric rDNA in hypotrichous ciliates. We showed that S1 nuclease resistant duplexes wit half the length of the native rDNA can be formed by rapid renaturation of heat‐denatured molecules and hybridized with native rDNA. This strongly suggests that the nucleotide sequence of this rDNA is a large palindrome. Unlike the hypotrichs, macronuclear rDNA in cyrtophorids should be organized into palindromic dimers as in Tetrahymena species.

Electrophoretic karyotyping and chromosomal gene mapping ofChlorella

Molecular karyotypes for six strains of four Chlorella species were obtained by using an alternating-field gel electrophoresis system which employs contour-clamped homogenous electric fields (CHEF). The number and migration pattern of the chromosomal DNA molecules varied greatly from strain to strain: for example, nine separated chromosomes of C. ellipsoidea C87 ranged from 2.5 to 6.5 megabase pairs (mbp) in size, whereas 16 chromosomes of C. vulgaris C169 were from 980 kilobase pairs (kbp) to 4.0 mbp. Depending on the chromosome migration patterns, the six strains were classified into two major chromosome-length polymorphism groups. Using hybridization techniques, the genes for alpha-tublin, chlorophyll-a, b-binding proteins, ribosomal RNAs, and the small subunit of ribulose-1, 5-bisphosphate carboxylase/oxygenase (RuBisCO) were mapped on the separated chromosomes of C. vulgaris C169. Since Chlorella chromosomes are small enough to separate and isolate individually by CHEF gel electrophoresis under ordinary conditions, they should serve as excellent materials to study the fundamental molecular structure of plant-type chromosomes.

Electrophoretic karyotype of the ascomycete Podospora anserina

Fractionation of intact chromosomes of the ascomycete Podospora anserina by contour-clamped homogenous electric field (CHEF) gel electrophoresis resulted in the resolution of five distinct chromosomal bands. Two of these bands migrated as doublets. Using chromosomal standards from Schizosaccharomyces pombe we estimated the size of the P. anserina genome to about 33.4 megabases (Mb). By heterologous hybridization of fractionated chromosomes the rDNA locus was identified on one of the two chromosomes migrating at about 4.9 Mb.

Semiconductor-controlled contour-clamped homogeneous electric field apparatus

The design and construction of a transistor-driven hexagonal contour-clamped homogeneous electric field (CHEF) apparatus is discussed in detail. The addition of computer control of pulsed-field timings and experiment duration gives rise to an efficient electrophoresis tool designed to achieve separation of DNA molecules in different size groupings. In particular, pulse time regimes which lead to the monotonic separation of DNA molecules ranging from 90 kbp to over a megabase pair are demonstrated. Theoretical treatment of electric field clamping with transistor-driven multiple electrodes is supported by measurements and by the actual performance of electrophoretic separation of yeast chromosomes. The large sample capacity of gels run in this apparatus coupled with the modest power requirements necessary to provide a homogeneous electric field offer significant advantages over earlier CHEF designs.

A physical map of the genome of Haemophilus influenzae type b

Contour-clamped homogeneous electric field pulsed-field gel electrophoresis (PFGE) was used in combination with Southern hybridization to construct a genomic restriction map for the pathogen Haemophilus influenzae serotype b, strain Eagan. Sites for four restriction endonucleases, EagI, NaeI, RsrII and SmaI, were located on the 2100 kbp circular chromosome. Twelve potential virulence loci have been placed on the map together with certain loci essential for growth of the bacteria (e.g. ribosomal RNA operons). PFGE also provided a valuable tool for characterizing ten capsulated, type b isolates (other than Eagan) known to be genetically heterogeneous and two laboratory-derived variants (transformants) derived through complex recombinational events involving random uptake of high-molecular-mass donor genomic DNA.

An electrophoretic karyotype of Aspergillus niger

An electrophoretic karyotype of Aspergillus niger was obtained using contour-clamped homogeneous electric field (CHEF) gel electrophoresis. Chromosome-sized DNA was separated into four bands. Seven of the eight linkage groups could be correlated with specific chromosomal bands. For this purpose DNA preparations from seven transformant strains of A. niger each carrying the heterologous amdS gene of Aspergillus nidulans on a different chromosome were analysed. Some of the assignments were confirmed with linkage group-specific A. niger probes. The estimated sizes of the A. niger chromosome range from 3.5 to 6.6 Mb, based on gel migration relative to the chromosomes of Schizosaccharomyces pombe strains, Saccharomyces cerevisiae and A. nidulans. The total genome size of A. niger significantly exceeds that of A. nidulans and is estimated to be about 35.5-38.5 Mb. Electrophoretic karyotyping was used to allocate non-mutant rRNA genes and to estimate the number of plasmids integrated in a high copy number transformant.

Apparatus for contour-clamped homogeneous electric fields

These notes and diagrams describe the construction of a simple hexagonal electrode array contour-clamped homogeneous electric field (CHEF) apparatus (1, 2). Included are a number of improvements on the original design. The circuit is shown in modules so that the investigator can upgrade an existing device as desired. The modules represent modifications of a second-generation device with vertical electrodes (2). One module replaces the original mechanical relay with an electronic switching circuit, which is (blissfully) silent and more reliable and permits faster switch times. The other module inserts transistor circuits to provide more accurate voltage clamping. However, it should be noted that the clamping is still not as precise as it is in commercial devices available from Bio-Rad or BRL. We have also developed a new system with electrodes in a square array that produces precise voltage clamping with operational amplifiers and is capable of arbitrary reorientation angles. That device is described elsewhere (3). Nevertheless, the circuits shown here are inexpensive, are easy to construct, are adaptable to older generation devices, and give good results for most applications. The circuits can be followed by anyone with a rudimentary training in electronics.