Consensus Binding Sequence Research Articles

Abstract We137: PGC-1α-dependent transcriptional regulatory mechanisms for tricarboxylic acid cycle genes in the heart.

Many metabolic genes, including tricarboxylic acid (TCA) cycle genes, are downregulated in heart failure, which may promote the pathology due to insufficient energy production. To clarify how TCA cycle genes are downregulated in the failing heart, it is a prerequisite to clarify how these genes are transcribed in the normal heart. PGC-1α is a transcriptional co-activator that broadly induces metabolic genes through activation of transcription factors, such as ERR, Nrf1, Gabpa and YY1. Here we show that PGC-1α transcribes 13 among 14 TCA cycle genes partly through ERR, Nrf1, Gabpa and YY1. Thirteen TCA cycle genes, except for Suclg2, were downregulated in cardiac specific PGC-1α knockout (KO) mice (Relative mRNA levels in KO mice compared to wild type (WT) were CS 0.66*, Aco2 0.64*, Idh3a 0.62*, Idh3b 0.54*, Idh3g 0.54*, Ogdh 0.64*, Suclg1 0.45*, Suclg2: 1.1, Sdha 0.57*, Sdhb 0.53*, Sdhc 0.72*, Sdhd 0.57*, Fh1 0.32* and Mdh2 0.54*,p<0.05 vs. WT). ChIP-sequencing with PGC-1α antibody demonstrated that PGC-1α is localized at the promoter of thirteen TCA cycle genes, besides Suclg2. Bioinformatics analyses identified consensus binding sequences of ERR, Nrf1, Gabpa and YY1 in these promoters. Gene expression analyses with knockdown of these transcription factors demonstrated that a transcription factor whose binding sequence is found proximal to the PGC-1α localization peak transcribes the downstream genes in general. These transcription factor binding sequences were well conserved between mice and humans. ERR-, Nrf1- and Gabpa-dependent PGC-1α recruitment was verified with in vitro DNA binding assays using endogenous promoter sequences of Idh3a, Idh3g and Sdha. Taken together, this study clarifies a precise transcriptional mechanism for TCA cycle genes in the normal heart, which could be useful for understanding how those genes are dysregulated in the failing heart.

Myocardin regulates fibronectin expression and secretion from human pleural mesothelial cells.

During the progression of pleural fibrosis, pleural mesothelial cells (PMCs) undergo a phenotype switching process known as mesothelial-mesenchymal transition (MesoMT). During MesoMT, transformed PMCs become myofibroblasts that produce increased extracellular matrix (ECM) proteins, including collagen and fibronectin (FN1) that is critical to develop fibrosis. Here, we studied the mechanism that regulates FN1 expression in myofibroblasts derived from human pleural mesothelial cells (HPMCs). We found that myocardin (Myocd), a transcriptional coactivator of serum response factor (SRF) and a master regulator of smooth muscle and cardiac muscle differentiation, strongly controls FN1 gene expression. Myocd gene silencing markedly inhibited FN1 expression. FN1 promoter analysis revealed that deletion of the Smad3-binding element diminished FN1 promoter activity, whereas deletion of the putative SRF-binding element increased FN1 promoter activity. Smad3 gene silencing decreased FN1 expression, whereas SRF gene silencing increased FN1 expression. Moreover, SRF competes with Smad3 for binding to Myocd. These results indicate that Myocd activates FN1 expression through Smad3, whereas SRF inhibits FN1 expression in HPMCs. In HPMCs, TGF-β induced Smad3 nuclear localization, and the proximity ligation signal between Myocd and Smad3 was markedly increased after TGF-β stimulation at nucleus, suggesting that TGF-β facilitates nuclear translocation of Smad3 and interaction between Smad3 and Myocd. Moreover, Myocd and Smad3 were coimmunoprecipitated and isolated Myocd and Smad3 proteins directly bound each other. Chromatin immunoprecipitation assays revealed that Myocd interacts with the FN1 promoter at the Smad3-binding consensus sequence. The results indicate that Myocd regulates FN1 gene activation through interaction and activation of the Smad3 transcription factor.NEW & NOTEWORTHY During phenotype switching from mesothelial to mesenchymal, pleural mesothelial cells (PMCs) produce extracellular matrix (ECM) proteins, including collagen and fibronectin (FN1), critical components in the development of fibrosis. Here, we found that myocardin, a transcriptional coactivator of serum response factor (SRF), strongly activates FN1 expression through Smad3, whereas SRF inhibits FN1 expression. This study provides insights about the regulation of FN1 that could lead to the development of novel interventional approaches to prevent pleural fibrosis.

Abstract 17696: Perm1 Stabilizes Nrf2 via Keap1 Oxidation to Protect the Heart Against Reperfusion Injury

Introduction: Reperfusion after ischemia (IR) produces reactive oxygen species (ROS) that promote myocardial injury. Nrf2 is a transcription factor that promotes transcription of antioxidant enzymes. Keap1 is a negative regulator of Nrf2. When oxidated by ROS, Keap1 releases Nrf2, leading to Nrf2 activation. Perm1 (PPARGC-1 and ESRR-induced regulator, muscle specific 1) is a scaffold or adaptor protein that maintains cellular metabolism. However, whether and how Perm1 protects the heart against IR injury via Nrf2 remains unknown. Methods: We used systemic Perm1 knockout (KO) mice and adeno-associated virus (AAV)-induced cardiac-specific Perm1 overexpression to investigate the pathological role of Perm1 in IR injury. Results: IR-induced myocardial infarction was greater in Perm1KO mice than in control mice. Consistently, infarction was smaller in mice with Perm1 overexpression (Infarction size/area at risk (AAR): AAV-GFP as a control 0.41 and AAV-Perm1 0.28*; p<0.05). Myocardial oxidative stress, evaluated via increases in dityrosine, 4HNE and GSSG/GSH, after IR was greater in Perm1KO but less in Perm1 overexpression mice. Expression of IR-induced Nrf2 target genes, such as catalase, superoxide dismutase 2, heme oxygenase 1, NADH quinone dehydrogenase 1 and thioredoxin 1, was inhibited in Perm1KO but promoted in overexpression mice. The detrimental effects observed in Perm1KO mice were normalized by ML334, an inhibitor of Keap1-Nrf2 interaction (Infarction size/AAR: Wild 0.42; Perm1KO 0.58; Wild with ML334 0.37 and Perm1KO with ML334 0.42*; p<0.05 vs. Perm1KO), suggesting that Perm1 protects the heart via Nrf2. In primary cultured rat cardiomyocytes, Perm1 was bound to Keap1 and promoted its oxidation, thereby stabilizing and activating Nrf2. Perm1-induced Nrf2 activation was verified with reporter gene assays using a consensus binding sequence of Nrf2, termed antioxidant response element. In an in vitro system using recombinant proteins, Perm1 directly bound to Keap1. Conclusions: These results suggest that Perm1 is a novel regulator of cellular redox homeostasis through Nrf2 activation via Keap1 oxidation that protects the heart against IR injury.

Gate dynamics studies of M. smegmatis TOP1A using magnetic tweezers.

DNA topoisomerases are enzymes that regulate DNA supercoiling and relieve any structural entanglements that occur during normal cellular processes. We used MT to study the gate dynamics of wild type and mutant Mycobacterium smegmatis (MSM) topoisomerase IA. Two duplex DNA constructs with a 27-nt ssDNA binding region (Gap) were used: one with a 27-nt poly-T tail at the opposite strand and the other without the poly-T tail. A MSM TOP1 binding consensus sequence CCGCTTG was included at the gap region of both constructs. Topoisomerase mediated gate opening and closing were recorded with both wild type and C-terminal deletion mutants at different forces. The force dependent data was analyzed with vbFRET to determine the open and closed states. The states and their lifetimes were then used for kinetic rate analyses. Biased molecular dynamics simulations using metadynamics were also performed on the two MSM structures - with and without ssDNA bound at the topoisomerase catalytic active site. The biasing method was used to explore the open, closed and transition states of the protein mediated DNA gate. We report our findings from both experimental and computational methods which shed light on the working mechanism of MSM TOP1 on a single-molecule scale.

Interaction of C-terminal p53 isoforms depends strongly upon DNA sequence and topology

The p53 protein is a key tumor suppressor and the most commonly mutated and down-regulated protein in human tumors. It functions mainly through interaction with DNA, and p53 acts as a transcription factor that recognizes the so-called p53 target sites on the promoters of various genes. P53 has been shown to exist as many isoforms, including three C-terminal isoforms that are produced by alternative splicing. Because the C-terminal domain is responsible for sequence-nonspecific binding and regulation of p53 binding, we have analyzed DNA recognition by these C-terminal isoforms. Using atomic force microscopy, we show for the first time that all C-terminal isoforms recognize superhelical DNA. It is particularly noteworthy that a sequence-specific p53 consensus binding site is bound by p53α and β isoforms with similar affinities, whilst p53α shows higher binding to a quadruplex sequence than both p53β and p53γ, and p53γ loses preferential binding to both the consensus binding sequence and the quadruplex-forming sequence. These results show the important role of the variable p53 C-terminal amino acid sequences for DNA recognition.

Crystal Structure of the Recombination Mediator Protein RecO from Campylobacter jejuni and Its Interaction with DNA and a Zinc Ion.

Homologous recombination is involved in repairing DNA damage, contributing to maintaining the integrity and stability of viral and cellular genomes. In bacteria, the recombination mediator proteins RecO and RecR are required to load the RecA recombinase on ssDNA for homologous recombination. To structurally and functionally characterize RecO, we determined the crystal structure of RecO from Campylobacter jejuni (cjRecO) at a 1.8 Å resolution and biochemically assessed its capacity to interact with DNA and a metal ion. cjRecO folds into a curved rod-like structure that consists of an N-terminal domain (NTD), C-terminal domain (CTD), and Zn2+-binding domain (ZnD). The ZnD at the end of the rod-like structure coordinates three cysteine residues and one histidine residue to accommodate a Zn2+ ion. Based on an extensive comparative analysis of RecO structures and sequences, we propose that the Zn2+-binding consensus sequence of RecO is CxxC…C/HxxC/H/D. The interaction with Zn2+ is indispensable for the protein stability of cjRecO but does not seem to be required for the recombination mediator function. cjRecO also interacts with ssDNA as part of its biological function, potentially using the positively charged patch in the NTD and CTD. However, cjRecO displays a low ssDNA-binding affinity, suggesting that cjRecO requires RecR to efficiently recognize ssDNA for homologous recombination.

SOXE group transcription factors regulates the expression of FoxG1 during inner ear development

The transcription factor FOXG1 plays an important role in inner ear development; however, the cis-regulatory mechanisms controlling the inner-ear-specific expression of FOXG1 are poorly understood. In this study, we aimed to identify the element that specifically regulates FoxG1 expression in the otic vesicle, which develops into the inner ear, through comparative genome analysis between vertebrate species and chromatin immunoprecipitation. The cis-regulatory element (E2) identified showed high evolutionary conservation among vertebrates in the genomic DNA of FoxG1 spanning approximately 3 Mbp. We identified core sequences important for the activity of the otic-vesicle-specific enhancer through in vitro and in vivo reporter assays for various E2 enhancer mutants and determined the consensus sequence for SOX DNA binding. In addition, SoxE, a subfamily of the Sox family, was simultaneously expressed in the otic vesicles of developing embryos and showed a similar protein expression pattern as that of FoxG1. Furthermore, SOXE transcription factors induced specific transcriptional activity through the FoxG1 Otic enhancer (E2b). These findings suggest that the interaction between the otic enhancer of FoxG1 and SOXE transcription factor, in which the otic expression of FoxG1 is evolutionarily well-conserved, is important during early development of the inner ear, a sensory organ important for survival in nature.

Motif prediction of abemaciclib in a breast cancer cell line using ChIP-Seq data analysis

Introduction: Chromatin immunoprecipitation sequencing (ChIP-Seq) is a DNA sequencing technique for the identification of binding sites in genomic sequences. ChIP-Seq experiments are a combination of immunoprecipitation and sequencing techniques that are used for the identification of chromatin regions that bind molecules such as transcription factors (TFs), histones, and drugs. In this study, computational analysis of ChIP-Seq data was performed to predict the binding sites in breast cancer cells and their association with several molecules, such as TFs and drugs. A complete and comprehensive computational study has been performed to predict the binding sites of abemaciclib. Functional enrichment of selected motifs was performed to identify important motifs that function in breast cancer and show binding with the drug abemaciclib. Methods and Materials: The ChIP-Seq analysis protocol was performed using the Galaxy server (https://usegalaxy.org/). The abemaciclib binding motif was identified using MEME tools. For this research, ChIP-Seq data from a breast cancer cell line was retrieved from the GEO database, accession number GSM4763932. This dataset includes ChIP-Seq of MCF-7 cells exposed to abemaciclib. The ENA browser was used to retrieve the data. Statistical analysis was performed using the default parameters of Fast-QC, Multi-QC, Map with BWA, Filter SAM and BAM, MACS2, and ChIP Seeker tools on the Galaxy server. Results: Computational analysis identifies the abemaciclib consensus binding sequence as TGGCTCACGCCTGTAATCCCAGCACTTT, and this motif occurs 2980 times in the Homo sapiens reference genome hg19. Conclusions: This study identifies the binding sites and affinity of abemaciclib in a breast cancer cell line.

IL-4/IL-13 Axis in Allergic Rhinitis: Elevated Serum Cytokines Levels and Inverse Association With Tight Junction Molecules Expression.

The IL-4/IL-13 axis is involved in the pathogenesis of allergic rhinitis (AR). In this study, we investigated the serum cytokines levels of IL-4, IL-5, IL-6, and IL-13 in AR patients, and the transcript expression levels of their receptors (i.e. IL4R, IL5RA, IL6R, and IL13RA1) in nasal epithelial cells of AR patients versus non-allergic controls. Nasal epithelial cells and blood samples of non-allergic controls (n = 30) and AR patients (n = 30) were collected to examine mRNA expression and serum cytokines levels, respectively. Bioinformatics analyses of IL-4/IL-13 receptor heterodimer association with tight junction (TJ) and JAK/STAT signaling genes were conducted in a gene expression profiling (GEP) dataset (GSE44037) of AR patients (n = 12) and healthy controls (n = 6). Serum IL-4, IL-5, IL-6 or IL-13 levels, and IL13RA1 transcript expression were significantly higher in AR patients compared with non-allergic controls. IL-4 and IL-13 serum levels were positively correlated with IL13RA1 expression in AR patients but not in non-allergic controls. In the GEP dataset (GSE44037), six TJ (CLDN4, CLDN7, CLDN12, CLDN15, TJP1, and TJP2) genes’ expressions were negatively correlated, respectively, with IL-4Rα/IL-13Rα1 heterodimeric receptor expression in AR patients and not in control samples. These six TJ genes contributed to the significant enrichment of tight junction Gene Ontology (GO ID: 0070160). Lastly, STATs DNA binding motif analysis showed that each of these TJ genes contains STATs binding consensus sequence within intronic and intergenic regions. Our results suggest that increased IL-4/IL-13 serum cytokines levels may contribute to decreased TJs expression via IL-4Rα/IL-13Rα1 heterodimeric receptor in nasal epithelium of AR patients.

Congenital idiopathic megaesophagus in the German shepherd dog is a sex-differentiated trait and is associated with an intronic variable number tandem repeat in Melanin-Concentrating Hormone Receptor 2.

Congenital idiopathic megaesophagus (CIM) is a gastrointestinal (GI) motility disorder of dogs in which reduced peristaltic activity and dilation of the esophagus prevent the normal transport of food into the stomach. Affected puppies regurgitate meals and water, fail to thrive, and experience complications such as aspiration pneumonia that may necessitate euthanasia. The German shepherd dog (GSD) has the highest disease incidence, indicative of a genetic predisposition. Here, we discover that male GSDs are twice as likely to be affected as females and show that the sex bias is independent of body size. We propose that female endogenous factors (e.g., estrogen) are protective via their role in promoting relaxation of the sphincter between the esophagus and stomach, facilitating food passage. A genome-wide association study for CIM revealed an association on canine chromosome 12 (P-val = 3.12x10-13), with the lead SNPs located upstream or within Melanin-Concentrating Hormone Receptor 2 (MCHR2), a compelling positional candidate gene having a role in appetite, weight, and GI motility. Within the first intron of MCHR2, we identified a 33 bp variable number tandem repeat (VNTR) containing a consensus binding sequence for the T-box family of transcription factors. Across dogs and wolves, the major allele includes two copies of the repeat, whereas the predominant alleles in GSDs have one or three copies. The single-copy allele is strongly associated with CIM (P-val = 1.32x10-17), with homozygosity for this allele posing the most significant risk. Our findings suggest that the number of T-box protein binding motifs may correlate with MCHR2 expression and that an imbalance of melanin-concentrating hormone plays a role in CIM. We describe herein the first genetic factors identified in CIM: sex and a major locus on chromosome 12, which together predict disease state in the GSD with greater than 75% accuracy.

Exosomal microRNAs array sensor with a bioconjugate composed of p53 protein and hydrazine for the specific lung cancer detection

For the early diagnosis of lung cancer, a novel strategy to detect microRNAs encapsulated in exosomes with immunomagnetic isolation was demonstrated for the selective extraction of exo-miRNAs from patient serum. Here, miRNA was captured from lysed exosomes in specially designed capture probe modified magnetic beads, followed by T4 DNA polymerase-mediated in situ formation of chimeric 5′-miRNA-DNA-3′ (Target). The poly-(2,2′:5′,2′′-terthiophene-3′-(p-benzoic acid)) (pTBA)-modified electrode harbors Probe-1 DNA that hybridizes to the 5′ end of the chimera, followed by hybridization of Probe-2 DNA to the 3′ end of the chimera, resulting in the formation of a 20-nucleotide-long dsDNA consensus sequence for p53 protein binding. A bioconjugate composed of p53 and hydrazine assembled on AuNPs (p53-AuNPs-Hyd) recruits the p53 protein to recognize a specific sequence, forming the final sensor probe (pTBA-Probe-1:Target/Probe-2:bioconjugate), where hydrazine functions as an electrocatalyst to generate amperometric signal from the reduction of H2O2. This sensor has double specificity via selective capture of the target in Probe-1 and p53 recognition, which shows excellent analytical performance, revealing a dynamic range between 100 aM and 10 pM with a detection limit of 92 (±0.1) aM. For practical applications, we prepared a multiplexed array sensor to simultaneously detect four exo-miRNAs (miRNA-21, miRNA-155, miRNA-205, and miRNA-let-7b) up to femtomolar levels from 1.0 mL to 125 μL of cell culture (A549, MCF-7 and BEAS-2B) media and lung cancer patient serum samples, respectively.

C11orf21, a novel RUNX1 target gene, is down-regulated by RUNX1-ETO

The fusion protein RUNX1-ETO is an oncogenic transcription factor generated by t(8;21) chromosome translocation, which is found in FAB-M2-type acute myeloid leukemia (AML). RUNX1-ETO is known to dysregulate the normal RUNX1 transcriptional network, which should involve essential factors for the onset of AML with t(8;21). In this study, we screened for possible transcriptional targets of RUNX1 by reanalysis of public data in silico, and identified C11orf21 as a novel RUNX1 target gene because its expression was down-regulated in the presence of RUNX1-ETO. The expression level of C11orf21 was low in AML patient samples with t(8;21) and in Kasumi-1 cells, which carry RUNX1-ETO. Knockdown of RUNX1-ETO in Kasumi-1 cells restored C11orf21 expression, whereas overexpression of RUNX1 up-regulated C11orf21 expression. In addition, knockdown of RUNX1 in other human leukemia cells without RUNX-ETO, such as K562, led to a decrease in C11orf21 expression. Of note, the C11orf21 promoter sequence contains a consensus sequence for RUNX1 binding and it was activated by exogenously expressed RUNX1 based on our luciferase reporter assay. This luciferase signal was trans-dominantly suppressed by RUNX1-ETO and site-directed mutagenesis of the consensus site abrogated the reporter activity. This study demonstrated that C11orf21 is a novel transcriptional target of RUNX1 and RUNX1-ETO suppressed C11orf21 transcription in t(8;21) AML. Thus, through this in silico approach, we identified a novel transcriptional target of RUNX1, and the depletion of C11orf21, the target gene, may be associated with the onset of t(8;21) AML.

Abstract 2450: A systemic approach to decipher the interactome of RET receptor isoforms

Abstract The REarranged during Transfection (RET) receptor tyrosine kinase is pivotal for normal tissue development, but is also an oncogene driver involved in several human cancers. Alternative splicing at the 3' end of the RET gene leads to expression of two conserved protein isoforms, RET9 and RET51, that differ in their subcellular localization and protein trafficking, as well as their functional roles in tumorigenesis and metastatic processes. Importantly, RET9 and RET51 have unique C-terminal phospho-tyrosine binding sites, suggesting that they may also differ in their interactomes. We used a combination of cell-based screening and in silico approaches to identify novel potential interaction partners of RET isoforms. We performed a Mammalian Membrane Two-Hybrid (MaMTH) screen using a library of SH2 domain-containing adaptor and signaling proteins, to identify interactions with each RET isoform. We complemented these studies by using sequence homology detection models (HMM, PSSM), based on SH2 domain sequences known to interact with RET, to rank the SH2 library members and predict novel interactions. Independently, we compared published consensus binding sequences for each SH2 domain library member with predicted RET phosphotyrosine motifs to identify potential interactors. Predicted interactions were validated in co-immunoprecipitation assays. We confirmed previously known interactions of RET with SH2 domain proteins including SHC1, GRB2 and GRB10, and identified additional novel RET-binding proteins, a subset of which showed differential interactions that were mediated through RET isoform-specific docking sites. Our results suggest that combinations of distinct interaction partners may contribute to RET isoform-specific functions. Together, our research has developed a systematic approach to map and characterize RET isoform interactions. Our data suggest that no single method identified all confirmed RET interactions, and that a combination of multiple approaches improves characterization of growth factor receptor interactomes. Citation Format: Samira Kheitan, Annika E. Pedersen, Brandy D. Hyndman, Luka Drecun, Punit Saraon, Igor Stagliar, Lois M. Mulligan. A systemic approach to decipher the interactome of RET receptor isoforms [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2021; 2021 Apr 10-15 and May 17-21. Philadelphia (PA): AACR; Cancer Res 2021;81(13_Suppl):Abstract nr 2450.

Aberrant HCK Survival Signaling By Mutated MYD88 Requires PAX5 in Waldenstrom's Macroglobulinemia and ABC DLBCL Cells

Activating mutations in MYD88 are present in 95% and 40% of patients with WM and ABC DLBCL, respectively. MYD88 mutations are known to trigger growth and survival of WM and ABC DLBCL cells through BTK/IRAK1/IRAK4 directed NF-kB signaling (Ngo et al, Nature 2011; Yang et al, Blood 2013). Recently, we identified that mutated MYD88 can trigger the SRC family member HCK, a kinase that is downregulated in later stages of B-cell ontogeny (Yang et al, Blood 2016). HCK promotes malignant cell survival through activation of BTK, as well as AKT and ERK1/2, whereas knockdown of HCK leads to decreased survival in WM and ABC DLBCL cells. The regulatory mechanisms that promote mutated MYD88 directed HCK signaling are unknown, and may permit therapeutic advances for MYD88 mutated diseases. To clarify whether HCK expression is regulated by TLRs / MYD88 or BCR signaling, we performed activation studies using triggers of TLR9 (ODN-2006) and TLR4 (LPS-EP) signaling, and BCR (anti-IgM/IgG) signaling in MYD88 wild-type or mutated B-cell lymphoma cells. Stimulation of TLRs but not BCR increased HCK transcription, particularly in wild-type MYD88 expressing B-cell lymphoma cells thereby demonstrating the importance of TLR/MYD88 signaling in driving HCK expression. To better understand the mechanism for the aberrant upregulation of HCK transcription in MYD88 mutated B-cell lymphoma cells, we performed promoter-binding TFs profiling, and observed that among the TFs, PAX5 signal was reduced the most by the addition of HCK promoter into BCWM.1 cell nuclear extracts. The signals of many other TFs that can be regulated by NF-kB (AP1, C\\EBP, Myb, NF-kB), MAPK (AP1, C\\EBP, CREB, HNF4, NF-1) and STAT3 signaling were also reduced. These results indicate that PAX5 and mutated MYD88 directed TFs including NF-kB, AP-1 and STAT3 bind to endogenous HCK promoter sequence. HCK promoter binding consensus sequence analysis and ChIP studies confirmed the presence of PAX5, as well as AP-1, NF-kB and STAT3 binding sites on the HCK promoter. Knockdown of PAX5 reduced HCK mRNA level in BCWM.1 and TMD-8 cells indicating an activating function of PAX5 in the regulation of HCK expression. The deletion of AP-1, NF-kB and STAT3 binding sites on HCK promoter reduced HCK promoter activity, thereby supporting a role for AP-1, NF-kB and STAT3 in HCK gene expression in MYD88 mutated cells. Treatment of BCWM.1 and TMD-8 cells with inhibitors of AP-1, NF-kB and STAT3 decreased HCK promoter activities by luciferase reporter assay, as well as endogenous HCK mRNA transcription levels in MYD88 mutated cells. Our data indicate PAX5 along with mutated MYD88 triggered transcription factors NF-kB, AP-1 and STAT3 orchestrate aberrant HCK expression. The findings provide a framework for efforts directed at blocking MYD88 triggered HCK survival signaling in MYD88 mutated B-cell lymphomas. DisclosuresCastillo:Abbvie: Research Funding; Pharmacyclics: Consultancy, Research Funding; Janssen: Consultancy, Research Funding; Millennium: Research Funding. Treon:Pharmacyclics: Consultancy, Research Funding.

Investigation of potential inhibitor properties of ethanolic propolis extracts against ACE-II receptors for COVID-19 treatment by molecular docking study.

The angiotensin-converting enzyme (ACE)-related carboxypeptidase, ACE-II, is a type I integral membrane protein of 805 amino acids that contains 1 HEXXH-E zinc binding consensus sequence. ACE-II has been implicated in the regulation of heart function and also as a functional receptor for the coronavirus that causes the severe acute respiratory syndrome (SARS). In this study, the potential of some flavonoids presents in propolis to bind to ACE-II receptors was calculated with in silico. Binding constants of ten flavonoids, caffeic acid, caffeic acid phenethyl ester, chrysin, galangin, myricetin, rutin, hesperetin, pinocembrin, luteolin and quercetin were measured using the AutoDock 4.2 molecular docking program. And also, these binding constants were compared to reference ligand of MLN-4760. The results are shown that rutin has the best inhibition potentials among the studied molecules with high binding energy − 8.04 kcal/mol, and it is followed by myricetin, quercetin, caffeic acid phenethyl ester and hesperetin. However, the reference molecule has binding energy of – 7.24 kcal/mol. In conclusion, the high potential of flavonoids in ethanolic propolis extracts to bind to ACE-II receptors indicates that this natural bee product has high potential for COVID-19 treatment, but this needs to be supported by experimental studies.Supplementary InformationThe online version contains supplementary material available at 10.1007/s00203-021-02351-1.

Explainability in transformer models for functional genomics.

The effectiveness of deep learning methods can be largely attributed to the automated extraction of relevant features from raw data. In the field of functional genomics, this generally concerns the automatic selection of relevant nucleotide motifs from DNA sequences. To benefit from automated learning methods, new strategies are required that unveil the decision-making process of trained models. In this paper, we present a new approach that has been successful in gathering insights on the transcription process in Escherichia coli. This work builds upon a transformer-based neural network framework designed for prokaryotic genome annotation purposes. We find that the majority of subunits (attention heads) of the model are specialized towards identifying transcription factors and are able to successfully characterize both their binding sites and consensus sequences, uncovering both well-known and potentially novel elements involved in the initiation of the transcription process. With the specialization of the attention heads occurring automatically, we believe transformer models to be of high interest towards the creation of explainable neural networks in this field.

Genetic and epigenetic interplay fine-tunes expression of TGFB1, encoding TGF-Β1, contributing to osteoarthritis risk

Genetic and epigenetic interplay fine-tunes expression of TGFB1, encoding TGF-Β1, contributing to osteoarthritis risk

Nuclear ErbB2 represses DEPTOR transcription to inhibit autophagy in breast cancer cells

ErbB2, a classical receptor tyrosine kinase, is frequently overexpressed in breast cancer cells. Although the role of ErbB2 in the transmission of extracellular signals to intracellular matrix has been widely studied, the functions of nuclear ErbB2 remain largely elusive. Here, we report a novel function of nuclear ErbB2 in repressing the transcription of DEPTOR, a direct inhibitor of mTOR. Nuclear ErbB2 directly binds to the consensus binding sequence in the DEPTOR promoter to repress its transcription. The kinase activity of ErbB2 is required for its nuclear translocation and transcriptional repression of DEPTOR. Moreover, the repressed DEPTOR by nuclear ErbB2 inhibits the induction of autophagy by activating mTORC1. Thus, our study reveals a novel mechanism for autophagy regulation by functional ErbB2, which translocates to the nucleus and acts as a transcriptional regulator to suppress DEPTOR transcription, leading to activation of the PI3K/AKT/mTOR pathway to inhibit autophagy.

The epigenetic pioneer EGR2 initiates DNA demethylation in differentiating monocytes at both stable and transient binding sites

The differentiation of human blood monocytes (MO), the post-mitotic precursors of macrophages (MAC) and dendritic cells (moDC), is accompanied by the active turnover of DNA methylation, but the extent, consequences and mechanisms of DNA methylation changes remain unclear. Here, we profile and compare epigenetic landscapes during IL-4/GM-CSF-driven MO differentiation across the genome and detect several thousand regions that are actively demethylated during culture, both with or without accompanying changes in chromatin accessibility or transcription factor (TF) binding. We further identify TF that are globally associated with DNA demethylation processes. While interferon regulatory factor 4 (IRF4) is found to control hallmark dendritic cell functions with less impact on DNA methylation, early growth response 2 (EGR2) proves essential for MO differentiation as well as DNA methylation turnover at its binding sites. We also show that ERG2 interacts with the 5mC hydroxylase TET2, and its consensus binding sequences show a characteristic DNA methylation footprint at demethylated sites with or without detectable protein binding. Our findings reveal an essential role for EGR2 as epigenetic pioneer in human MO and suggest that active DNA demethylation can be initiated by the TET2-recruiting TF both at stable and transient binding sites.

Zinc Finger Protein SALL4 Functions through an AT-Rich Motif to Regulate Gene Expression

SUMMARYThe zinc finger transcription factor SALL4 is highly expressed in embryonic stem cells, downregulated in most adult tissues, but reactivated in many aggressive cancers. This unique expression pattern makes SALL4 an attractive therapeutic target. However, whether SALL4 binds DNA directly to regulate gene expression is unclear, and many of its targets in cancer cells remain elusive. Here, through an unbiased screen of protein binding microarray (PBM) and cleavage under targets and release using nuclease (CUT&RUN) experiments, we identify and validate the DNA binding domain of SALL4 and its consensus binding sequence. Combined with RNA sequencing (RNA-seq) analyses after SALL4 knockdown, we discover hundreds of new SALL4 target genes that it directly regulates in aggressive liver cancer cells, including genes encoding a family of histone 3 lysine 9-specific demethylases (KDMs). Taken together, these results elucidate the mechanism of SALL4 DNA binding and reveal pathways and molecules to target in SALL4-dependent tumors.