Complete Coat Protein Gene Research Articles

Molecular characterization of the coat protein gene of prunus necrotic ringspot virus infecting peach in Montenegro

In 2011 and 2012, two major peach-growing areas in Montenegro were surveyed for the occurrence of eleven peach viruses. Samples collected from 105 peach and nectarine trees were tested by Reverse transcription-polymerase chain reaction (RT-PCR) using sets of primers specific for the detection of Apple chlorotic leaf spot virus (ACLSV), Apple mosaic virus (ApMV), Cherry mottle leaf virus (CMLV), Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), Peach mosaic virus (PMV), Peach rosette mosaic virus (PRMV), Tobacco ringspot virus (TRSV) and Tomato ringspot virus (ToRSV). The occurrence of Strawberry latent ringspot virus (SLRSV) was examined using nested RT-PCR, while a Real-time quantitative RT-PCR method was applied for detection of Plum pox virus (PPV). PPV, PNRSV and PDV were detected in 42.9, 24.8 and 0.9 % of samples. Mixed viral infections were recorded in 6.7 % of samples, while results showed the absence of ACLSV, ApMV, PMV, CMLV, SLRSV, PRMV, TRSV and ToRSV from all assayed samples. In particular, the PCR products of complete coat protein (CP) gene was cloned and sequenced from fourteen PNRSV isolates. A high identity (87.5–100 %) was found between CP nucleotide sequences of Montenegrin isolates and other PNRSV isolates from different hosts and geographic regions retrieved from GenBank. CP nucleotide sequence comparison, as well as phylogenetic reconstruction confirmed the clustering of the isolates into three molecular groups (PV-96, PV-32 and PE-5), whereby Montenegrin isolates were separated into two phylogroups (PV-96 and PE-5). Comparative sequence and phylogenetic analysis showed that clustering of various isolates was not associated with geographic and host origin.

Biological and Molecular Characterization of Alfalfa Mosaic Virus Infecting Trumpet Creeper (Campsis radicans) in Iran

AbstractSamples of trumpet creeper (Campsis radicans) leaves showing mottling and mosaic were collected from plants growing in a private garden in Tehran province, Iran, in 2012. Symptomatic leaf samples were tested for Alfalfa mosaic virus (AMV), Cucumber mosaic virus (CMV) and Peanut stunt virus (PSV) infection in enzyme‐linked immunosorbent assay (ELISA), using specific antibodies. None of the samples were positive for CMV and PSV; however, all reacted positively with that of AMV antiserum. In biological assay, systemic infection was found on Datura stramonium, Nicotiana tabacum cvs., White Burley, and Xanthi, 21 days postinoculation (DPI), while necrotic local lesions were obtained following inoculation of Phaseolus vulgaris and Vigna unguiculata within three to four DPI. Using a pair of primers specific for AMV, a DNA fragment of 880 bp was RT‐PCR‐amplified. Analysis of the sequences revealed the presence of 657 nucleotides of AMV complete coat protein (CP) gene (translating 218 amino acid residues). Phylogenetic analysis using neighbour‐joining (NJ) method clustered AMV isolates into two main types and the IRN‐Tru (GenBank Accession No. JX865593) isolate fell into type I. Pairwise nucleotide distances also confirmed two main types with the highest and lowest similarities for type I and II, respectively. The association of AMV with mosaic disease of C. radicans represents the first record from the world.

Association of a distinct strain of Chilli veinal mottle virus with mottling and distortion disease of Datura inoxia in India

Association of a distinct strain of Chilli veinal mottle virus (ChiVMV) with severe mottling and distortion disease of Datura inoxia was investigated based on the presence of flexuous filamentous particles of ~800 × 11 nm and sequence analyses of ~1.5 kb amplicons obtained during RT-PCR from two representative samples, designated as GMT (accession JN692501) and JNP (JN624776). Both GMT and JNP isolates contained partial polyprotein gene comprising of partial nuclear inclusion b gene, complete coat protein gene and 3′ un-translated region, a hallmark gene array of genus Potyvirus. The isolates under study shared 99% nucleotide sequence identities with each other and 83–85% identities (marginal value for species demarcation recommended by ICTV) during basic local alignments and distant phylogenetic relationships with strains of ChiVMV, hence identified as isolates of a distinct strain of ChiVMV. Association of ChiVMV strain with mottling and distortion disease of D. inoxia is being reported for the first time from India.

Incidência de vírus em videiras no Nordeste brasileiro e caracterização molecular parcial de isolados virais locais

Os objetivos deste trabalho foram identificar as espécies virais presentes em vinhedos comerciais de duas regiões do Nordeste do Brasil e realizar a caracterização molecular parcial de isolados de três espécies virais. A diagnose foi realizada por meio de RT-PCR em tempo real para a detecção de Grapevine rupestris stem pitting-associated virus (GRSPaV), Grapevine virus A (GVA), Grapevine virus B (GVB), Grapevine leafroll-associated virus 2, 3 e 4 (GLRaV-2, -3 e -4), Grapevine fleck virus (GFkV), Grapevine rupestris vein feathering virus (GRVFV) e Grapevine fanleaf virus (GFLV). Exceto para GFLV, os vírus avaliados estão amplamente disseminados nas áreas amostradas, frequentemente em altas incidências e em infecções múltiplas, de até 98% e 76,4%, na Zona da Mata e no Vale do São Francisco, respectivamente. Isolados locais de GVA, GVB e GLRaV-3 foram parcialmente caracterizados com base na sequência completa de nucleotídeos do gene da proteína capsidial e apresentaram alta porcentagem de identidade de nucleotídeos com outros isolados brasileiros: 91,2% (GVA), 99,8% (GVB) e 99,7% (GLRaV-3)

Wild roses as natural reservoirs of Cherry necrotic rusty mottle virus

Cherry necrotic rusty mottle virus (CNRMV) is a graft transmitted virus, known to infect sweet cherries and some other Prunus species. Recently, this virus has been explored for its natural hosts and has emerged as a significant virus in India, infecting many species of bamboos with a high incidence of 65 %, thereby expanding its host range. A wild rose shrub (Rosa brunonii) growing near the already reported CNRMV infected bamboo, in the campus of CSIR-IHBT Palampur (India), was observed to display disease symptoms such as chlorosis and necrotic spots on the leaves. The plant was tested for CNRMV infection by reverse transcription polymerase chain reaction (RT-PCR) using the detection primers and was found to be infected. In order to widen the survey, 32 different samples of wild roses were collected from the floriculture division (CSIR-IHBT), where the institute maintains a germplasm of domesticated wild roses. The samples were tested by Double antibody sandwich-Enzyme linked immunosorbent assay (DAS–ELISA) and dot-blot hybridization and the results were validated by RT-PCR which confirmed the presence of CNRMV in 34 % of the tested samples, belonging to the species: R. brunonii, R. multiflora, R. cathayensis and R. alba. The complete coat protein (CP) gene of the virus was characterized from five positive samples. In the phylogenetic analysis it was seen that the three isolates (HPWRRA3, HPWRRC6 and HPWRRB31) were closely related to the Chilean sweet cherry isolate while two other isolates (HPWRRM2 and HPWR27) were closely related to the Indian bamboo isolate of the virus. The multiple sequence alignment revealed variation in the length of CP gene amongst the Indian isolates due to a missing triplet codon towards its 3′ end. The percentage identity matrix computed at nucleotide level revealed that the present wild rose isolates are 97.5 to 100 % identical to each other while the overall identity with other isolates of CNRMV characterized from different hosts and geographical regions was 85.1 to 100 %. To the best of our knowledge this is the first report of CNRMV infection in wild roses. Infected wild roses may act as reservoir of the virus during the dormant season and identification of new hosts will help us understand biological characteristics of the virus.

Himalayan wild cherry (Prunus cerasoides) as a new natural host of Cherry necrotic rusty mottle virus (CNRMV) and a possible role of insect vectors in their transmission

AbstractA Himalayan wild cherry (Hwc) tree (Prunus cerasoides) growing in the vicinity of an already reported Cherry necrotic rusty mottle virus (CNRMV) infected bamboo (Dendrocalamus hamiltonii) showed severe virus‐like symptoms on the leaves consisting of marginal chlorosis, mosaic, shot holes and necrotic spots. Reverse transcription‐polymerase chain reaction (RT‐PCR) using virus specific primers confirmed the presence of the virus. In order to assess the prevalence of this virus, 40 symptomatic and asymptomatic Hwc plants along with four different suspected insect vectors were analysed by double antibody sandwich‐enzyme linked immunosorbent assay (DAS‐ELISA), dot blot hybridisation and RT‐PCR. CNRMV was detected in 57% of the wild cherry samples, two aphid species Astegopteryx bambusae and Tinocalloides montanus, and in a delphacid of Bambusiphaga sp. Complete coat protein (CP) gene of CNRMV was sequenced from two randomly selected samples. The isolates characterised from Hwc shared 99% similarity to the already characterised isolates of CNRMV from India, suggesting a conserved nature of the CP gene. This study represents the first report of CNRMV infection in Himalayan wild cherry and its possible insect vectors.

Sequence analysis and genetic diversity of five new Indian isolates of cucumber mosaic virus.

Cucumber mosaic virus (CMV) is an important virus since it causes severe losses to many economically important crops worldwide. Five new isolates of CMV were isolated from naturally infected Hippeastrum hybridum, Dahlia pinnata, Hemerocallis fulva, Acorus calamus and Typhonium trilobatum plants, all exhibiting severe leaf mosaic symptoms. For molecular identification and sequence analyses, the complete coat protein (CP) gene of these isolates was amplified by RT-PCR. The resulting amplicons were cloned and sequenced and isolates were designated as HH (KP698590), DP (JF682239), HF (KP698589), AC (KP698588) and TT (JX570732). For study of genetic diversity among these isolates, the sequence data were analysed by BLASTn, multiple alignment and generating phylogenetic trees along with the respective sequences of other CMV isolates available in GenBank Database were done. The isolates under study showed 82-99% sequence diversity among them at nucleotide and amino acid levels; however they showed close relationships with CMV isolates of subgroup IB. In alignment analysis of amino acid sequences of HH and AC isolates, we have found fifteen and twelve unique substitutions, compared to HF, DP and TT isolates, suggesting the cause of high genetic diversity.

Natural Infection of Citrullus colocynthis by Papaya ringspot virus-W in Iran.

Papaya ringspot virus (PRSV, genus Potyvirus, family Potyviridae) is economically important due to its worldwide distribution and because it can cause serious losses in both cucurbit crops and papaya (3). PRSV has been previously reported from cucurbit crops in Iran (2). In Khuzestan Province, southwest Iran, cucurbit crops, including cucumber, melon, squash, pumpkin, and watermelon, are grown on about 30,000 ha with 720,000 t production annually. To identify possible alternative hosts that may serve as PRSV reservoirs, samples of 36 different common weed species (17 symptomatic and 19 asymptomatic) including Amaranthus sp. (slim amaranth), Carthamus sp. (safflower), Chenopodium album L. (lamb squarters), Citrullus colocynthis (L.) Schrad (colocynth), Convolvulus arvensis L. (field bindweed), Datura stramonium L. (jimson weed), Euphorbia sp. (wart weed), Malva sylvestirs L. (common malva), Solanum nigrum L. (black nightshade), and Sonchus asper (L.) Hill (prickly sow-thistle) were collected in cucurbit open fields during 2012 to 2013 in Khuzestan Province, where PRSV symptoms were observed. Symptoms on weed samples included mottling, mosaic, blistering, cholorosis, vein clearing, interveinal yellowing, yellows, necrosis, leaf distortion, and curling. Samples were tested by DAS-ELISA with specific antisera against PRSV using reagents from Bioreba (Switzerland). Three of the 36 weed samples belonging to C. colocynthis (Cucurbitaceae) with mottling and chlorosis symptoms were positive for PRSV by ELISA. Leaf extracts from PRSV ELISA-positive samples were mechanically inoculated onto indicator host plants, causing local lesions on Chenopodium amaranticolor and systemic symptoms on Cucumis melo, Cucumis sativus, and Cucurbita pepo, but could not produce symptoms on Nicotiana glutinosa, N. tabacum cv. White Burley, or N. tabacum cv. Xanthi. Total RNA was extracted from infected leaves using Tri-reagent (Sigma) and first-strand cDNA synthesis was performed using M-MuLV reverse transcriptase (Fermentas, Lithuania), according to the manufacturer's instructions. The presence of PRSV was confirmed by RT-PCR using primers for the complete coat protein (CP) gene of PRSV-W (forward 5'-GCAGCAATGATAGAGTCATG-3' and reverse 5'-AACACACAAGCGCGAGTATTCA-3') (1). The complete CP nucleotide sequence of three Iranian PRSV isolates consisted of 864 nt, coding for a 288 amino acid (aa) protein. Subsequent analysis showed that the CP nucleotide sequences of Iranian isolates (GenBank Accession Nos. KM047884 to KM047886) from C. colocynthis samples were identical. Furthermore, BLAST analysis of the nucleotide sequence comparisons revealed that the Iranian isolates shared the highest identity (96%) with the Chinese PRSV isolate (DQ449533). PRSV-W has been previously reported from different cucurbits using serological and biological detection (2); however, this result provides the first molecular demonstration, to our knowledge, of PRSV-W on C. colocynthis. C. colocynthis is a perennial weed in West and South Iran. This information on the natural infection of C. colocynthis with PSRV-W will help to better understand PRSV epidemiology and to develop a successful management program for reducing the impact of this disease.

First Report of Cucumber mosaic virus in Tulipa sp. in Serbia.

Tulips (Tulipa sp. L.), popular spring-blooming perennials in the Liliaceae family, are one of the most important ornamental bulbous plants, which have been cultivated for cut flower, potted plant, garden plant, and for landscaping. In May 2013, during a survey to determine the presence of Cucumber mosaic virus (CMV, Cucumovirus, Bromoviridae) on ornamentals in Serbia, virus-like symptoms, including the presence of bright streaks, stripe and distortion of leaves, and reduced growth and flower size, were observed in an open field tulip production in the Krnjaca locality (a district of Belgrade, Serbia). Disease incidence was estimated at 20%. Symptomatic tulip plants were collected and tested for the presence of CMV by double-antibody sandwich (DAS)-ELISA using commercial diagnostic kit (Bioreba, AG, Reinach, Switzerland). Commercial positive and negative controls were included in each ELISA. Of the six tulip plants tested, all were positive for CMV. In bioassay, five plants of each Chenopodium quinoa, Nicotiana tabacum 'Samsun,' and N. glutinosa were mechanically inoculated with sap from selected ELISA-positive sample (79-13) using 0.01 M phosphate buffer (pH 7). Chlorotic local lesions on C. quinoa, and severe mosaic and leaf malformations on N. tabacum 'Samsun' and N. glutinosa, were observed 5 and 14 days post-inoculation, respectively. All mechanically inoculated plants were positive for CMV in DAS-ELISA testing. For further confirmation of CMV presence in tulip, total RNAs from all ELISA-positive symptomatic tulip plants were extracted with the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany). Reverse transcription (RT)-PCR was performed with the One-Step RT-PCR Kit (Qiagen) using specific primer pair CMVCPfwd and CMVCPrev (1), which flank conserved fragment of the RNA3 including the entire coat protein (CP) gene and part of 3'- and 5'-UTRs. Total RNAs obtained from the Serbian watermelon CMV isolate (GenBank Accession No. JX280942) and healthy tulip leaves served as the positive and negative controls, respectively. The RT-PCR products of 871 bp were obtained from all six samples that were serologically positive to CMV, as well as from the positive control. No amplicon was recorded in the healthy control. The amplified product which derived from isolate 79-13 was purified (QIAquick PCR Purification Kit, Qiagen), directly sequenced in both directions using the same primer pair as in RT-PCR, deposited in GenBank (KJ854451), and analyzed by MEGA5 software (4). Sequence comparison of the complete CP gene (657 nt) revealed that the Serbian isolate 79-13 shared the highest nucleotide identity of 99.2% (99% amino acid identity) with CMV isolates from Japan (AB006813) and the United States (S70105). To our knowledge, this is the first report on the occurrence of CMV causing mosaic on Tulipa sp. in Serbia. Taking into account vegetative reproduction of tulips and the large scale of international trade with tulip seeding material, as well as wide host range of CMV including a variety of ornamentals (2,3), this is a very important discovery representing a serious threat for the floriculture industry in Serbia.

Geographic distribution of mealybug wilt disease of pineapple and genetic diversity of viruses infecting pineapple in Cuba

Several species of ampeloviruses and badnaviruses infect pineapple plants around the world. Pineapple mealybug wilt-associated ampeloviruses have been associated with mealybug wilt of pineapple (MWP), the major viral disease threatening this crop. Conversely, infection by the badnaviruses Pineapple bacilliform comosus virus (PBCOV) and Pineapple bacilliform erectifolius virus (PBERV) is asymptomatic. To investigate the status of infection of the pineapple crop in Cuba, a diagnostic survey was developed in commercial areas during the period 2009–2012. Incidence of MWP disease was found in up to 100% of the plants in some fields of Central and Eastern regions of the island. Molecular assays revealed the presence of PMWaV-1 for the first time in the Caribbean basin and PMWaV-2, PMWaV-3, either as mixed infections or in combination with PBCOV throughout the country. Furthermore, they revealed for the first time the presence of PMWaV-2 in Bromelia pinguin L., a plant commonly used in Cuba as hedgerow. Sequence analysis of partial heat shock protein 70h and complete coat protein gene of Cuban isolates of PMWaV-1, -2 and -3 showed nucleotide identities above 97% with cognate sequences of viruses isolated from other countries. This work discloses the presence of a complex of viruses associated with the pineapple crop in Cuba, highlights the potential role of B. pinguin in the PMWaV-mealybug-pineapple pathosystem and makes available diagnostic tools for the detection of viruses affecting pineapple for a seed certified production system in Cuba.

First Report of Garlic virus X in Garlic Plants in Brazil.

Garlic is the fifth most economically important vegetable in Brazil and is frequently infected by a complex of different viruses that cause significant degeneration of the crop under field conditions. The species of the genus Allexivirus that infect garlic are: Garlic virus A (GarV-A), Garlic virus B (GarV-B), Garlic virus C (GarV-C), Garlic virus D (GarV-D), Garlic virus E (GarV-E), Garlic virus X (GarV-X), Garlic mite-borne filamentous viru s (GarMbFV), and Shallot virus X (ShVX). So far, only GarV-A, GarV-B, GarV-C, GarV-D, and GarMbFV have been reported in Brazil (3). During the 2010 through 2013 seasons, between April and October, 302 garlic plants with yellow mosaic strips and distorted leaves from the cultivars Caçador, Quitéria, Tropical Bergamota, and Tropical Shangai were collected in the states of Paraná, Minas Gerais, São Paulo, and Goiás and analyzed for the presence of allexiviruses. Total plant RNA was extracted with the Total RNA Purification kit (Norgen Biotek Corp., Canada) according to manufacturer's instructions. RT-PCR reactions were performed initially with the primer pair named Cpallexi-senso2 (5' CTACCACAAYGGNTCVTC 3') and Cpallexi-anti1 (5' CACNGCGTTRAAGAARTC 3') specifically designed to amplify a ~230-bp fragment from all currently known allexiviruses. Positive samples were then analyzed with specific primers for GarV-A, GarV-C, and GarV-D (2), GarMbFV (1) and GarV-B named CPBS2 (5' GCAGAATAARCCCCCYTC 3') and CPBA1 (5' RAAGGGTTTATTCTGTTG 3') obtained in this work. Among the plants analyzed, 50 were positive for the Cpallexi-senso2/Cpallexi-anti1 primers but negative for all the specific primers tested, indicating the presence of a different allexivirus. These samples were then analyzed by RT-PCR for the presence of GarV-X, GarV-E, and ShVX and an amplicon of ~550 bp was obtained only with primers CPXS2 (5' GCCTTCTGAAAATGACTTAG 3') and CPXA1 (5' CTAGGATTTGCTGTTGGG 3') designed in this work to amplify a fragment of the capsid protein gene for GarV-X. Since species demarcation in the genus Allexivirus is based on the coat protein (CP) gene (2), another set of primers, namely PIXS1 (GACGACGGYGCACTACTC) / PIXA1 (YGTGAATCGTGATGATCC) and PFXS2 (CRCTGAGACAATTYYGTGG) / PFXA2 (CAAAGCATCGGCCRTAGCG) derived from conserved regions of ORF4, ORF5 (CP), and ORF 6 sequences of allexiviruses available in the NCBI database, were used in RT-PCR to obtain the complete CP gene nucleotide sequence. A 1,071-nt sequence comprising 108 bp of ORF4 (partial), 732 bp of the CP, and 177 bp of ORF 6 was successfully amplified (GenBank Accession No. KF530328). The complete CP gene showed 98% nucleotide sequence identity with GarV-X from Australia (JQ807994.1). In summary, GarV-X was detected in the 50 samples collected from Minas Gerais, São Paulo, and Paraná, indicating widespread distribution in Brazil. To our knowledge, this is the first report of GarV-X in garlic in Brazil.

First Report of Zucchini yellow mosaic virus in Watermelon in Bosnia and Herzegovina.

Several potyvirus species cause severe economic losses in cucurbit crops in the Mediterranean region, but Zucchini yellow mosaic virus (ZYMV) is regarded as one of the most destructive (2,3). In June 2012, field-grown watermelon plants (Citrullus lanatus [Thunb.] Matsum and Nakai) showing mild to severe mosaic, mottling, and bubbling followed by leaf deformation with blistering were observed in the Kukulje locality (Region of Banja Luka) in Bosnia and Herzegovina. Incidence of virus infection in the field was visually estimated at 15%. Symptomatic watermelon plants were collected and tested for the presence of the most prevalent watermelon viruses including ZYMV, Cucumber mosaic virus (CMV), Watermelon mosaic virus (WMV), Papaya ringspot virus (PRSV), and Squash mosaic virus (SqMV) (1) using commercial double-antibody sandwich (DAS)-ELISA diagnostic kits (Bioreba AG, Reinach, Switzerland). Commercial positive and negative controls were included in each assay. Of the 14 watermelon plants tested, all were positive for ZYMV and negative for WMV, CMV, PRSV, and SqMV. Sap prepared from an ELISA-positive sample (isolate 314-12) and healthy watermelon plants, using 0.01 M phosphate buffer (pH 7) was mechanically inoculated onto five carborundum-dusted plants of each Chenopodium quinoa and Citrullus lanatus 'Creamson sweet'. Mechanically inoculated C. quinoa plants exhibited chlorotic spots 5 days post-inoculation, while severe mosaic accompanied by crinkling and leaf deformation were observed on all inoculated watermelon plants 12 days post-inoculation. For further confirmation of the virus identity, total RNAs from all 14 naturally and 5 mechanically infected watermelon plants were extracted with the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and subjected by reverse transcription (RT)-PCR. RT-PCR was carried out with One-Step RT-PCR Kit (Qiagen) using ZYMV-specific primer pair, CPfwd and CPrev (4), designed to amplify an 1,100-bp fragment covering the entire coat protein (CP) gene and part of the nuclear inclusion (NIb) and 3'-UTR. Total RNAs obtained from the Serbian ZYMV isolate from winter squash (GenBank Accession No. JN315861) and tissue sample from healthy watermelon leaves were used as positive and negative controls, respectively. The expected size of the RT-PCR product was amplified from each of the watermelon plants assayed confirming serological virus identification. One amplicon derived from isolate 314-12 was purified (QIAquick PCR Purification Kit, Qiagen) and sequenced directly (KF836440). Sequence analysis of the complete CP gene, conducted by MEGA5 software, revealed that watermelon isolate from Bosnia and Herzegovina showed the highest nucleotide identity of 99.8% (99.6% amino acid identity) with 14 ZYMV isolates originating from different hosts from Serbia (HM072431, JF308189 to 90, JN315856 to 57, JN315859 to 61) and Austria (AJ420012 to 17). To our knowledge, this is the first report of ZYMV in Bosnia and Herzegovina, which is an important discovery. It represents expansion of this virus to new geographical area. Considering that the ZYMV is among the most devastating pathogens of cucurbits (3), further survey is needed to determine its distribution in Bosnia and Herzegovina.

Characterization of Turnip mosaic virus from the Asian‐BR Population in Iran

AbstractBrassicaceae crops in eight provinces of the North‐west Iran were surveyed for Turnip mosaic virus (TuMV) infection during 2011 and 2012. Many symptomatic plants (38%; 226 of 598) were found to be infected with TuMV. The highest frequency was in turnip (61%), followed by radish (55%), oilseed rape (38%), and brassica weeds including annual bastard cabbage (42%), small tumbleweed‐mustard (50%) and wild radish (45%), but not Brassica oleracea and Lepidium sativum. Using biological assays, Iranian TuMV isolates grouped in three [B], [B(R)] and [BR] host‐infecting types. Phylogenetic analysis using complete coat protein (CP) gene nucleotide sequences showed that the Iranian isolates belonged to the Basal‐B and Asian‐BR populations. No evidence of recombination was found in these isolates using different recombination‐detecting programmes. To our knowledge, our study shows for the first time the occurrence of TuMV Asian‐BR subpopulation in the mid Eurasian region of Iran. The data suggest that the Asian‐BR subtype population is found across southern Eurasia and might be a continuous population in East Asia (mostly Japan and China) and Minor Asia (Turkey), the places considered to be one of the origins of TuMV populations.

Characterization of a potyvirus associated with yellow mosaic disease of jasmine (Jasminum sambac L.) in Andhra Pradesh, India.

A virus isolate associated with yellow mosaic disease was purified from commercially cultivated jasmine (Jasminum sambac) from Andhra Pradesh, India and it contained flexuous filamentous particles of ~720×13nm. The denatured purified virus had single major polypeptide of molecular weight 32kDa. Complementary DNA representing 1678 nucleotides (nt) of the 3' terminus of viral RNA was cloned and sequenced. Comparisons of complete coat protein (CP) gene nucleotide and amino acid sequences of the present virus isolate with certain reported potyviruses revealed 86.1 and 92.7% identity, respectively with jasmine potyvirus T (JaVT) reported from Taiwan and less than 70% with other potyviruses. Based on the phylogenetic analysis of 3' UTR and CP gene, the present virus isolate was identified as an isolate of JaVT that belongs to the genus Potyvirus and the name Jasmine yellow mosaic virus-Andhra Pradesh (JaYMV-AP) is proposed.

Detection and Molecular Variability of Turnip mosaic virus (TuMV) in Shaanxi, China

AbstractTurnip mosaic virus (TuMV) is one of the most devastating threats to oilseed rape by causing serious crop losses. A total of 86 leaf samples of oilseed rape from eight different locations in Shaanxi, China, were tested by RT‐PCR for TuMV; the results revealed an infection level of 43% by TuMV. The complete coat protein (CP) gene of 32 TuMV isolates was cloned and sequenced. Analysis of the CP gene with sequences from the database allowed the genetic classification of 170 TuMV isolates or sequences. Four genetic clusters were obtained: MB (mostly Brassica isolates), MR (mostly Radish isolates), IBR (mostly Intermediate between Brassica and Radish clusters) and OBR (mostly outside Brassica and Radish clusters). All subgroups were slightly related to the hosts, but unrelated to geographical origins. Most of Shaanxi TuMV isolates were on separate branches, compared with the 138 known isolates originating from other parts of the world. Our results help provide a better understanding of the genetic diversity of TuMV isolates infecting oilseed rape in Shaanxi, China.

First Report of Cowpea mild mottle virus in Cowpea and French Bean in Taiwan.

In 2009, more than 50% of vine type French beans were found bearing severe viral symptoms in a vegetable garden in Nantou County, Taiwan. Infected plants were stunted and exhibited pronounced mottling symptoms on their leaves. The symptomatic plants were mechanically inoculated on Chenopodium quinoa and local lesions developed 7 to 10 days after inoculation. The virus source established by back isolation the single lesion from C. quinoa on French beans developed symptoms similar to those found in the field. Host range test showed that this isolate could only infect leguminous plants, including soybean, mung bean, pea, peanut, asparagus bean, cowpea, adzuki bean, and lima bean, but not cucurbitaceous and solanaceous plants. Since only Cucumber mosaic virus (CMV) has been reported in Taiwan to induce similar symptoms in French beans, we tested both the field collected and inoculated French beans by CMV antiserum in ELISA but obtained a negative result. Due to subsequent electron microscopy studies that found potyvirus and carlavirus like particles in the leaf dips of infected French beans, we conducted reverse transcription (RT)-PCR using generic degenerate primers for potyviruses (Hrp5/Pot1 (2) and PotZ/Pot1 (3)) and carlaviruses (Decarla-u2 (5'-TGCACTGARTCMGAYTATGARGCYTT-3' and Decarla-d1 (5'-GCACATRTCRTCVCCDGCAAA-3') previously designed in our lab. No amplification was found from the potyvirus primers, while the carlavirus one gave an expected amplicon of 285 bp, which was found sharing 81% nucleotide sequence identity with the replicase gene of Cowpea mild mottle virus (CpMMV) (GenBank Accession No. FJ560903). A primer pair (CpMMV-CPu: 5'-TTTACTCTTAggTWATggAgTC-3' and CpMMV-CPd: 5'-CCTATTAAAACACACAAHTCAAA-3') was thus designed to amplify the complete coat protein (CP) gene based on the reported CP sequences and obtained an expected 867-bp product from our French bean isolate. This 867-bp sequence (JX020701) was confirmed to have 97.6% amino acid sequence identities with the CP gene of a Puerto Rican CpMMV isolate (GU191840). In a separate survey, another isolate from asparagus bean (CpMMV-V) causing mild mottling symptom was obtained. Analyses of the CP gene of CpMMV-V (JX070669) confirmed that it shared 88.8% and 97.8% of nucleotide and amino acid sequence identities with the French bean isolate, respectively. Different from most carlaviruses with aphid transmissibility, CpMMV has been shown to be transmitted non-persistently by whiteflies (1). Both CpMMV isolates from Taiwan were confirmed to be transmitted by silver leaf whiteflies (Bemicia argentifolii Bellows and Perring). This is the first record of whitefly transmissible legume virus in Taiwan. Since whitefly has been a problem in agriculture worldwide, CpMMV can be a new emerging threat for Taiwan's legume crop production.

First Report of Cucumber mosaic virus Infecting Peperomia tuisana in Serbia.

Peperomia tuisana C.DC. ex Pittier (family Piperaceae) is an attractive succulent grown as an ornamental. Despite its tropical origins, it can be successfully grown indoors in any climate. In March 2012, three samples of P. tuisana showing virus-like symptoms were collected from a commercial greenhouse in Zemun (District of Belgrade, Serbia) in which estimated disease incidence was 80%. Infected plants showed symptoms including necrotic ringspots and line patterns that enlarged and caused necrosis of leaves. A serious leaf drop led to growth reduction and even death of the plant. Leaves from three symptomatic P. tuisana plants were sampled and analyzed by double-antibody sandwich (DAS)-ELISA using commercial diagnostic kits (Bioreba AG, Reinach, Switzerland) against the most common viral pathogens of ornamentals: Cucumber mosaic virus (CMV), Tomato spotted wilt virus (TSWV), and Impatiens necrotic spot virus (INSV) (1,2). Commercial positive and negative controls were included in each ELISA. Serological analyses showed that all plants were positive for CMV and negative for TSWV and INSV. The ELISA-positive sample (isolate 1-12) was mechanically inoculated onto five plants each of three test species as well as of healthy young P. tuisana using 0.01 M phosphate buffer (pH 7). Chlorotic local lesions on Chenopodium quinoa and severe mosaic and leaf malformations were observed on all inoculated Nicotiana tabacum 'Samsun' and N. glutinosa. Also, the virus was successfully mechanically transmitted to P. tuisana that reacted with symptoms identical to those observed on the original host plants. All mechanically inoculated plants were positive for CMV in DAS-ELISA. For further confirmation of CMV infection, reverse transcription (RT)-PCR was performed on extracts made from symptomatic P. tuisana, N. tabacum 'Samsun,' and N. glutinosa leaf materials. Total RNAs were extracted with the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and RT-PCR was carried out using One-Step RT-PCR Kit (Qiagen). A CMV-specific primer pair, CMVCPfwd and CMVCPrev (3), which amplifies an 871-bp fragment of the entire coat protein (CP) gene and part of 3'- and 5'-UTRs, were used for both amplification and sequencing. Total RNAs obtained from the Serbian CMV isolate (HM065510) and healthy P. tuisana were used as positive and negative controls, respectively. A product of the correct predicted size was obtained in all naturally and mechanically infected plants, as well as positive control. No amplicon was recorded in the healthy control. The amplified product derived from isolate 1-12 was purified (QIAquick PCR Purification Kit, Qiagen), directly sequenced in both directions, deposited in GenBank (KC505441), and analyzed by MEGA5 software (4). Sequence comparison of the complete CP gene (657 nt) revealed that the Serbian isolate 1-12 shared the highest nucleotide identity of 99.1% (99.5% amino acid identity) with the Japanese isolate (AB006813). To our knowledge, this is the first report on the occurrence of CMV in P. tuisana in Serbia. This is also an important discovery since P. tuisana is commonly grown together with other ornamental hosts of CMV, and thus could represent a serious threat for future expansion of CMV in the greenhouse floriculture industry in Serbia.

First Report of Transmission of Little cherry virus 2 to Sweet Cherry by Pseudococcus maritimus (Ehrhorn) (Hemiptera: Pseudococcidae).

Little cherry virus 2 (LChV2; genus Ampelovirus, family Closteroviridae) is associated with Little Cherry Disease (LCD), one of the most economically destructive diseases of sweet cherry (Prunus avium (L.)) in North America (1). Since 2010, incidence of LCD associated with LChV2 confirmed by reverse transcription (RT)-PCR assays has increased in orchards of Washington State. LChV2 was known to be transmitted by the apple mealybug (Phenacoccus aceris (Signoret)) (3). However, the introduction of Allotropus utilis, a parasitoid platygastrid wasp (2) for biological control, contributed to keeping insect populations below the economic threshhold. In recent years, the population of grape mealybug (Pseudococcus maritimus (Ehrhorn)) increased in cherry orchards of Washington State (Beers, personal observation). Since grape mealybug is reported to transmit Grapevine leafroll associated virus 3 (Ampelovirus) in grapevine (4), this study investigated whether this insect would also transmit LChV2. A colony of grape mealybugs on Myrobalan plum (Prunus cerasifera Ehrh.) trees was identified visually and morphologically from slide mounts. In a growth chamber, first and second instar crawlers were fed on fresh cut shoots of sweet cherry infected with a North American strain (LC5) of LChV2. After an acquisition period of 7 days, 50 crawlers were transferred to each young potted sweet cherry trees, cv. Bing, confirmed free from LChV2 by RT-PCR. This process was repeated in two trials to yield a total of 21 potted trees exposed to grape mealybug. One additional tree was left uninfested as a negative control. After 1 week, the trees were treated with pesticide to eliminate the mealybugs. Two to four months after the inoculation period, leaves were collected from each of the recipient trees and tested by RT-PCR for the presence of LChV2. To reduce the possibility of virus contamination from residual mealybug debris on leaf surfaces, the trees were allowed to defoliate naturally. After a 3-month dormant period, the new foliage that emerged was then tested. Two sets of primers: LC26L (GCAGTACGTTCGATAAGAG) and LC26R (AACCACTTGATAGTGTCCT) (1); and LC2.13007F (GTTCGAAAGTGTTTCTTGA) and LC2.14545R (CATTATYTTACTAATGGTATGAC) (this study) were used to amplify a partial segment of the replicase gene (409 bp) and the complete (1,080 bp) coat protein gene of LChV2, respectively. Of 21 trees tested, 18 yielded positive results for LChV2. The reaction products from six randomly selected trees were cloned and the virus identity was verified by sequencing. The sequences of RT-PCR amplicons from both primer pairs showed ≥99% identity to LChV2, strain LC5 (GenBank Accession No. AF416335). The result confirmed that P. maritimus transmits LChV2, a significant finding for this cherry production region. Grape mealybug is of increasing concern in the tree fruit industry because it is difficult to control in established orchards. The presence of infested orchards that serve as reservoirs of both LCD and this insect vector present a challenge for management. To the best of our knowledge this is the first report to show transmission of LChV2 by grape mealybug.

Detection and Molecular Variability of Apple Stem Grooving Virus in Shaanxi, China

AbstractApple stem grooving virus (ASGV) is one of the economically important latent viruses that are distributed in apple production areas worldwide. The presence of ASGV in apple trees was studied by serological assay and molecular biology methods. A total of 550 apple leaf samples from 14 different areas in Shaanxi were tested by DAS‐ELISA, and the results revealed an ASGV infection level of 55%. Those samples were also examined by RT‐PCR, and an infection level of 67% was found. Fourteen complete coat protein gene sequences of ASGV were obtained; phylogenetic analysis revealed that these 14 sequences separated into two clusters regardless of the geographic origin or host plants. To our knowledge, this is the first report of molecular variability analysis of ASGV in apple trees in China.

First Report of Passiflora virus Y Infecting Macroptilium atropurpureum in Taiwan.

Macroptilium atropurpureum (siratro plants) is a perennial wild legume plant introduced to Taiwan as a forage crop in 1961 (3) and has become a naturalized weed found all over the island. In 2010, siratro plants with virus-like symptoms of mosaic and leaf deformation were observed on the campus of Da-Yeh University in central Taiwan. Flexuous virus-like particles about 750 × 12 nm were observed in the crude sap extracted from symptomatic leaves with a transmission electron microscope. Crude sap was mechanically inoculated to Chenopodium quinoa and local lesions can be observed on inoculated leaves 4 to 5 days after inoculation. Virus was purified from the leaves of inoculated C. quinoa with modified protocols of Gonsalves and Ishii (2). The virus coat protein (CP) consisted of a single major peptide with relative molecular weight of approximately 33 kDa when analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Viral RNA extracted from the purified virus was used as a template and was primed with several primer sets corresponding to potyviruses and carlaviruses in reverse transcription-PCR to amplify possible corresponding cDNA fragments. After several attempts, a cDNA fragment of about 1,300 bp could be amplified with the degenerated primer set of BCMNV-F (5'CCDTGGACDGTWGGVATGAC3') and BCMNV-R (5'CACCAHACCATRAARCCATTCAT3'), which were designed on the basis of the conserved region of the nuclear inclusion b (NIb) and CP genes of some potyviruses including Bean common mosaic necrosis virus, Soybean mosaic virus, Blackeye cowpea mosaic virus, East Asian passiflora virus, and Passion fruit woodiness virus. BLAST analyses showed the amplicon was highly homologous to that of Passiflora virus Y (PaVY). Together with oligo dT, a specific primer (5'GATGACACTCAAATGGCTG3') corresponding to PaVY CP was used to amplify the cDNA fragment of the most 3' region of the viral RNA (about 800 bp). The assembled cDNA fragment of 1,958 bp (Accession No. AB679294) contains a partial NIb gene (877 nt), a complete CP gene (819 nt), and the 3' noncoding region (262 nt). The CP gene shared sequence identities of 89.4 to 98.9% and 92.7 to 98.9% in nucleotide and amino acid, respectively, to that of documented PaVY isolates. PaVY has also been found to be infecting Vigna trilobata, Rhynchosia minima, Clitoria ternatea, and Passiflora foetida in Australia (1). Here we present the first report to our knowledge of PaVY and its infection of siratro (M. atropurpureum) in Taiwan. Additional work is needed to investigate the spread of PaVY and its interaction with other legume plants in Taiwan.