Comparative Sequence Analysis Research Articles

Functional genomic analysis of K+ related salt-responsive transporters in tolerant and sensitive genotypes of rice.

Salinity is a complex environmental stress that affects the growth and production of rice worldwide. But there are some rice landraces in coastal regions that can survive in presence of highly saline conditions. An understanding of the molecular attributes contributing to the salinity tolerance of these genotypes is important for developing salt-tolerant high yielding modern genotypes to ensure food security. Therefore, we investigated the role and functional differences of two K+ salt-responsive transporters. These are OsTPKa or Vacuolar two-pore potassium channel and OsHAK_like or a hypothetical protein of the HAK family. These transporters were selected from previously identified QTLs from the tolerant rice landrace genotype (Horkuch) and sensitive genotype (IR29). In silico comparative sequence analysis of the promoter sequences of two these genes between Horkuch and IR29 was done. Real-Time expression of the selected genes in leaves and roots of IR29 (salt-sensitive), I-14 and I-71 (Recombinant Inbred Lines of IR29(♀)× Horkuch), Horkuch and Pokkali (salt-tolerant) under salt-stress at different time points was analyzed. For further insight, OsTPKa and OsHAK_like were chosen for loss-of-function genomic analysis in Horkuch using the CRISPR/Cas9 tool. Furthermore, OsTPKa was chosen for cloning into a sensitive variety by Gateway technology to observe the effect of gain-of-function. The promoter sequences of the OsTPKa and OsHAK_like genes showed some significant differences in promoter sequences which may give a survival advantage to Horkuch under salt-stress. These two genes were also found to be overexpressed in tolerant varieties (Horkuch and Pokkali). Moreover, a coordinated expression pattern between these two genes was observed in tolerant Horkuch under salt-stress. Independently transformed plants where the expression of these genes was significantly lowered, performed poorly in physiological tests for salinity tolerance. On the other hand, positively transformed T0 plants with the OsTPKa gene from Horkuch consistently showed growth advantage under both control and salt stress. The poor performance of the transgenic plants with the down-regulated genes OsTPKa and OsHAK_like under salt stress supports the assumption that OsTPKa and OsHAK_like play important roles in defending the rice landrace Horkuch against salt stress, minimizing salt injury, and maintaining plant growth. Moreover, the growth advantage provided by overexpression of the vacuolar OsTPKa K+ transporter, particularly under salt stress reconfirms its important role in providing salt tolerance. The QTL locus from Horkuch containing these two transporters maybe bred into commercial rice to produce high-yielding salt tolerant rice.

Heating-mediated purification of active FGF21 and structure-based design of its variant with enhanced potency

Fibroblast growth factor 21 (FGF21) has pharmaceutical potential against obesity-related metabolic disorders, including non-alcoholic fatty liver disease. Since thermal stability is a desirable factor for therapeutic proteins, we investigated the thermal behavior of human FGF21. FGF21 remained soluble after heating; thus, we examined its temperature-induced structural changes using circular dichroism (CD). FGF21 showed inter-convertible temperature-specific CD spectra. The CD spectrum at 100 °C returned to that at 20 °C when the heated FGF21 solution was cooled. Through loop swapping, the connecting loop between β10 and β12 in FGF21 was revealed to be associated with the unique thermal behavior of FGF21. According to surface plasmon resonance (SPR) experiments, in vitro cell-based assays, and model high-fat diet (HFD)-induced obesity studies, heated FGF21 maintained biological activities that were comparable to those of non-heated and commercial FGF21s. Based on sequence comparison and structural analysis, five point-mutations were introduced into FGF21. Compared with the wild type, the heated FGF21 variant displayed improved therapeutic potential in terms of body weight loss, the levels of hepatic triglycerides and lipids, and the degree of vacuolization of liver in HFD-fed mice.

Quantification of chlamydiae in the endangered Houston toad (Anaxyrus houstonensis).

Two primer set/probe combinations targeting variable regions on the 23S rRNA gene were designed to detect and quantify chlamydiae in DNA extracted from brain swabs of the endangered Houston toad (Anaxyrus houstonensis) using SYBRGreen- and Taqman-based quantitative polymerase chain reaction (qPCR). Prevalence and abundance values for samples were generally different between SYBRGreen- and Taqman-based detection methods, with higher specificity observed for Taqman-based detection. Of the 314 samples analyzed, initial screening with SYBRGreen-based qPCR retrieved 138 positive samples, of which 52 were confirmed by Taqman-based analyses as chlamydiae. All of these samples were subsequently identified as C. pneumoniae by specific qPCR and confirmed by comparative sequence analyses of 23S rRNA gene amplicons. These results demonstrate the usefulness of our developed qPCR methods to screen for and verify prevalence of chlamydiae in DNA of brains swabs, and ultimately specifically identify and quantify chlamydiae and specifically C. pneumoniae in these samples.

Co-factor independent oxidases ncnN and actVA-3 are involved in the dimerization of benzoisochromanequinone antibiotics in naphthocyclinone and actinorhodin biosynthesis.

Streptomyces produce complex bioactive secondary metabolites with remarkable chemical diversity. Benzoisochromanequinone polyketides actinorhodin and naphthocyclinone are formed through dimerization of half-molecules via single or double carbon-carbon bonds, respectively. Here we sequenced the genome of S. arenae DSM40737 to identify the naphthocyclinone gene cluster and established heterologous production in S. albus J1074 by utilizing direct cluster capture techniques. Comparative sequence analysis uncovered ncnN and ncnM gene products as putative enzymes responsible for dimerization. Inactivation of ncnN that is homologous to atypical co-factor independent oxidases resulted in the accumulation of fogacin, which is likely a reduced shunt product of the true substrate for naphthocyclinone dimerization. In agreement, inactivation of the homologous actVA-3 in S. coelicolor M145 also led to significantly reduced production of actinorhodin. Previous work has identified the NAD(P)H-dependent reductase ActVA-4 as the key enzyme in actinorhodin dimerization, but surprisingly inactivation of the homologous ncnM did not abolish naphthocyclinone formation and the mutation may have been complemented by an endogenous gene product. Our data suggests that dimerization of benzoisochromanequinone polyketides require two-component reductase-oxidase systems.

Gynogenetic Cirrhinus mrigala produced using irradiated sperm of Cyprinus carpio exhibit better cold tolerance

Artificial gynogenesis is an important method for accelerating the selective breeding of varieties and populations. In this study, ultraviolet-irradiated sperm of Common carp (Cyprinus carpio) was used to activate the mature eggs of mrigal carp (Cirrhinus mrigala, MC), after cold shock at 4–8 °C for 16 min to double the chromosomes, a population of gynogenetic mrigal carp (GMC) was obtained. The fertilization rate, hatching rate and survival rate of GMC exceeded 62.2%, 6.3% and 2.9%, respectively. Comparative analyses of morphological traits, DNA content, chromosome numbers and 5S rDNA sequences showed no significant differences between MC and GMC. However, microsatellite (MFW1, CCA15) analysis revealed that paternal DNA fragments were inserted and a parent DNA fragment was deleted in the GMC. The GMC population survived the natural winter for more than 50 days with a temperature below 10 °C, while all the normal MC individuals perished. In addition, lower critical thermal minimum (CTMin) and lethal temperature (TLD50) values were detected in GMC than that in MC. Our results indicated that the artificial gynogenesis method improved the cold tolerance of mrigal carp. The results of this study are of great significance for fish breeding and application.

Genomic analysis as a tool to infer disparate phylogenetic origins of dysembryoplastic neuroepithelial tumors and their satellite lesions

Dysembryoplastic neuroepithelial tumor (DNET) is a low-grade brain tumor commonly associated with drug-resistant epilepsy. About half of DNETs are accompanied by tiny nodular lesions separated from the main mass. The existence of these satellite lesions (SLs) has shown a strong association with tumor recurrence, suggesting that they are true tumors. However, it is not known whether SLs represent multiple foci of progenitor tumor cell extension and migration or a multifocal development of the main DNET. This study was designed to elucidate the histopathology and pathogenesis of SLs in DNETs. Separate biopsies from the main masses and SLs with DNET were analyzed. We performed comparative lesion sequencing and phylogenetic analysis. FGFR1 K656E and K655I mutations or duplication of the tyrosine kinase domain was found in all 3 DNET patients and the main masses and their SLs shared the same FGFR1 alterations. The phylogenic analysis revealed that the SLs developed independently from their main masses. It is possible that the main mass and its SLs were separated at an early stage in oncogenesis with shared FGFR1 alterations, and then they further expanded in different places. SLs of DNET are true tumors sharing pathogenic mutations with the main masses. It is plausible that multifocal tumor development takes place in the dysplastic cortex containing cells with a pathogenic genetic alteration.

In silico comparative analysis of the complete chloroplast genome sequences in different jewel orchid species

Abstract. Nguyen MP, Trinh TH, Ngo TKA, Widiarsih S, Ho VT. 2023. In silico comparative analysis of the complete chloroplast genome sequences in different jewel orchid species. Nusantara Bioscience 15: 12-21. Jewel orchid is the common name of several orchid species which can be alike in morphological characteristics but variable in medicinal properties. As these plants are utilized to treat several diseases, their natural existence in the wild habitat is rapidly diminished. Therefore, a better understanding of the genetic information of this plant for better genetic conservation and development of these plants is necessary. In this study, a total of 18 published chloroplast genomes of 18 jewel orchid species determined by the next-generation sequencing method were retrieved from NCBI GenBank and targeted for genomic characterization and phylogenetic analyses. Different bioinformatics tools were utilized to characterize these genomes’ genomic structure, repetitive sequences, interspecific variation, divergence, and phylogenetic relationships. The obtained data revealed that the chloroplast genomes of different jewel orchid species varied in length between 151,414 (Anoectochilus formosanus MN880624.1) and 154,375 (Goodyera biflora OM314910.1). Each species contains 34-87 SSR loci which could be useful as molecular markers for further genetic diversity study of this plant. Structural variations in the expansion and contraction of inverted repeat regions were also considered. Phylogenetic analysis identified a close relationship among species belonging to the Goodyera genus, and this genus is distinctive from other genera such as Anoectochilus, Cystorchis, Dossinia, Ludisia, and Macodes. The obtained results show a high potential of deeper characterizing the chloroplast genome of jewel orchids for species classification, identification, molecular breeding, and evolutionary exploration of these important herbal plants.

Cloning, homology modelling and expression analysis of Oryza sativa WNK gene family

With No Lysine kinases (WNKs) represents a gene family that encodes Ser/Thr kinases, with anomalous disposition of catalytic lysine residue in subdomain I. In plants, WNKs had been linked to circadian rhythm, photoperiodic response and abiotic stress tolerance with mechanism yet undeciphered. In the present study, full-length CDS sequences of rice WNKs (OsWNK1 to 8) were cloned from indica cultivar IR64. A total of six highly conserved kinase subdomains were identified. Comparative analysis of protein sequences from six different species of rice showed varying magnitudes of substitution (76.2 %), deletion (15.4 %), and addition (8.4 %) events. ConSurf analysis coupled with CASTp results identified functional residues that were clustered together in modelled 3-D structures. Among post-translational modifications (PTMs) studied, 87.7 % of phosphorylation sites were predicted. Mined protein-protein interactions (PPIs) depicted OsWNKs to interact notably with other OsWNK members and with key proteins like PRR95 involved in photoperiodic response and protein phosphatase like PP2C involved in ABA signalling. Gene duplication analysis revealed two paralogous duplicated gene pairs: WNK6-WNK9 and WNK7-WNK8. Oryza sativa showed maximum syntenic relationship with Sorghum bicolor among the compared species. OsWNKs showed differential transcript expression profiles on treatment with plant growth regulators indicating its versatile role in plant growth and development.

Phylogenetic analysis of coccidia (Apicomplexa: Eimeriorina) in the belica Leucaspius delineatus (Heckel, 1843)

This study was aimed to carry out a comparative analysis and reconstruction of the phylogenetic position of coccidia from the intestine of the belica Leucaspius delineatus (Heckel, 1843) from the Irkutsk Reservoir. Determination and comparative analysis of the nucleotide sequences of the cox1 gene fragment, obtained and available in genetic databases, demonstrated paraphilia of the genera Eimeria and Goussia. The sequences in the phylogenetic tree formed a distinct cluster at the base of the tree. Thus, the hypothesis that fish coccidia were ancestors of coccidia of other vertebrates was indirectly confirmed. The need for additional research and revision of coccidia in fishes from the Angara River and Lake Baikal is discussed.

Abstract C045: Investigating molecular and genetic contributions to racial disparities in prostate cancer by integrating multi-omic datasets available in public

Abstract African-American males are disproportionately affected by prostate cancer in comparison to other racial and ethnic groups. African-American males have increased risk for the disease, experience higher incidence and mortality rates, and present higher grade and stage prostate tumors than Caucasian men. To determine molecular mechanisms beyond racial disparities in prostate cancer, molecular and genetic profiles of prostate tumor samples from different ethnic groups are developed. For example, DNA sequencing in the form of target-based array or whole exome and genome sequencing revealed SNPs, genetic mutations, deletions, and amplifications linked to prostate cancer subgroups. Comparative analysis of DNA sequences of prostate cancer cells have pinpointed areas of interest that suggest race specific mutations. Moreover, differentially expressed genes between prostate tumor tissue samples from African and Caucasian ancestries are identified using RNA sequencing and microarray-based methods. Abnormal levels of gene expression are measured by the levels of mRNA. Furthermore, epigenetic modifications, such as DNA methylation levels were examined, identifying CpG sites that are differentially methylated among ethnic groups. To comprehensively examine molecular and genetic contributions to racial disparities in prostate cancer, we compiled over 200 published studies that profiled genome, epigenome, and transcriptome in prostate tumor tissues from diverse ethnic groups. Specifically, we categorized studies according to their method and organized the identified features that offer insight into racial disparities in prostate cancer. For instance, we reviewed over 100 studies that identify reproducible genetic alterations found in prostate cancer patients from African ancestry from DNA sequencing experiments. We also reviewed over 50 studies that utilized RNA sequencing to measure gene expression levels in prostate tumor tissues from African-American male samples, identifying genes and signaling pathways abnormally dysregulated in the disease. In addition, we reviewed over 25 studies quantifying epigenetic modifications to determine key and reproducible epigenetic alterations linked to aggressiveness of the disease from African American. Subsequently, we identified socioeconomic factors that are associated with molecular features contributing to the increased risk for prostate cancer in African-American men. Overall, we evaluated multiple molecular and genetic features that contribute to racial disparities in prostate cancer. This may provide researchers with valuable background knowledge and perspective for identifying biomarkers for specific prostate cancer subgroups. Citation Format: Alexandria J. Hightower, Suhn K. Rhie, Sara M. Falzarano, Sarah Buxbaum. Investigating molecular and genetic contributions to racial disparities in prostate cancer by integrating multi-omic datasets available in public [abstract]. In: Proceedings of the 15th AACR Conference on the Science of Cancer Health Disparities in Racial/Ethnic Minorities and the Medically Underserved; 2022 Sep 16-19; Philadelphia, PA. Philadelphia (PA): AACR; Cancer Epidemiol Biomarkers Prev 2022;31(1 Suppl):Abstract nr C045.

Insight into biosorption of hexavalent chromium using isolated species Aspergillus Proliferans LA: A systemic and In silico studies

Background: The wastewater disposal into the water bodies without removing the toxic heavy metals and other industrial impurities is a major issue these days. These heavy metals cause serious health issues to the human and animal life and also harm the environment and reduce the productivity of crops. A potent microorganism resistant to hexavalent chromium was isolated. The activity of this isolated strain was analyzed using in silico studies. Methods: In this study, a chromium-resistant fungus was isolated from the soil of the dumping sites of the tanneries in Kanpur, UP, India, followed by isolation by serial dilution, plating method, and finally, genome sequencing. It was identified as Aspergillus proliferans LA that is submitted to the National Collection for Industrial Microorganisms (NCIM) database with accession no. NCIM-1473. In the current study, the comparative analysis of the protein sequence of A. proliferans (NCIM-1473) was done against the known 53 protein sequences of the fungus and bacterial strains already reported for their chromium-resistant nature. The physical and chemical parameters of the known and isolated chromium-resistant proteins were analyzed using the ProtParam tool. The comparative study on the sequence and structural alignment of known and isolated chromium-resistant protein was done using EMBOSS-NEEDLE and FATCAT, respectively. Results: In this analysis, the top 10 strains showing similarity with A. proliferans (NCIM-1473) were reported and among which ChrI, chromium regulatory protein Cupriavidus metallidurans CH34 was showing maximum similarity with isolated chromium resistant protein for all the analysis, namely ProtParam, sequence, and FATCAT analysis. This strain, Cupriavidus metallidurans CH34, has been reported resistant against eight heavy metals, one of which is chromate, and was first identified in the heavy-metal contaminated sludge in a settling tank of Belgium. Conclusion: These studies conclude that the strain isolated in our laboratory (accession no. NCIM-1473) is potentially chromium resistant and a unique strain.

Study of <i>Myb114</i> Gene Polymorphism in the Cole Crops (<i>Brassica oleracea</i> L.) in Connection with Anthocyanin Biosynthesis Regulation Based on Comparison with the MYB Factors of Vegetable Nightshades (Solanaceae)

In order to study a regulation mechanism for one of the most ancient processes of anthocyanin biosynthesis in plants based on comparison of R2R3-MYB genes in Solanaceae (S. lycopersicum: An1, An2; S. melongena: Myb1; C. annuum: Myb113-like1 и Myb113-like2) and Brassicaeae crops, a search for orthologous sequences in Brassica oleracea was performed. A sequence encoding MYB114 TF was found to be the closest in a nucleotide structure to the previously investigated genes in Solanaceae. Primers were selected and a comparative analysis of Myb114 gene sequences was performed in B. oleracea varieties (white cabbage, red cabbage, kale, cauliflower, broccoli, and kohlrabi) with a wide intraspecies diversity by the anthocyanin accumulation in leaves and various food organs: heads, curds and stems. Alignment of Myb114 sequences revealed a number of gene polymorphisms that closely correlate with high anthocyanin accumulation in B. oleracea leaves, including 3 SNPs in exon regions and a 271 bp deletion in the 1st intron. The identified SNPs lead to the replacement of two amino acids located in the region of DNA-binding domains, which leads to a change in the binding efficiency of this transcription factor with the promoters of structural biosynthesis genes and a decrease in their expression level in the forms without anthocyanin accumulation in leaves compared with the forms with their accumulation in vegetative plant parts. A molecular marker MYB114.2 has been proposed that may be used for the identification of headed cabbages and kales with high/low anthocyanin accumulation. By the amino acid structure and phenotypic manifestation (regulation of anthocyanin accumulation in leaves), Myb114 B. oleracea is the closest to Ant2 tomato, Myb2 eggplant and Myb113-like2 pepper alleles. A high degree of conservatism of the SANT DNA-binding domains of MYB114 TF of B. oleracea and R2R3-MYB TF of nightshades was established.

First report of entomopathogenic fungi, Aspergillus tamarii (Eurotiales: Trichocomaceae) on Musca domestica (Diptera: Muscidae) larvae

A fungus isolated from mango wasp was found to be pathogenic to houseflies. The isolated fungus was identified as Aspergillus tamarii using morphological characteristics and by comparative nucleotide sequence analysis of ITS regions. Fragments covering the region encoding ITS-1, 5.8S rDNA, and ITS-2 were amplified using the universal primers, ITS1 (TCCGTAGGTGAACCTGCGG) and ITS2 (TCCTCCGCTTATTGATATGC). The results of bioassays against early second instar larva showed dose-dependent mortality. Larvicidal activity was carried out at eight different concentrations viz, 1x106, 1x107, 1x108, 2x106, 2x107, 2x108, 3x106, 3x107, and 3x108 spores/ml. Among the two different methods of bioassays, bait method showed highest mortality. Beauveria bassiana was used as a positive control. Tween 80 (0.05%) was used as negative control. Larval mortality commences from day 3 until pupation in both bait and immersion methods. The least LC50 value observed for bait method was 5.28x107 spores/ml followed by immersion method, 5.12x109 spores/ml. On the other hand, the larva treated with commercial fungal strain, Beauveria bassiana showed an LC50 value of 1.26x108 spores/ml and 1.32x108 spores/ml for bait and immersion methods, respectively. Visual observation of mycosis was noticed on treated larva. Treated larvae had extensive growth of fungal hyphae on the larval surface. Scanning Electron Microscopy studies of treated larvae clearly showed the process of fungal infection. Longitudinal section of the treated larva showed fungal hyphae on the haemocoel.

Molecular detection of Dirofilaria immitis and its Wolbachia endosymbionts in dogs from Myanmar

Heartworm disease in dogs and cats caused by Dirofilaria immitis continues to be a major clinical issue globally. This study focused on dogs suspicious of having tick-borne diseases (TBD) brought to a clinic and a veterinary teaching hospital in Myanmar. Blood samples were collected and initially screened using SNAP® 4Dx® Plus test kit. All dog blood samples were subjected to conventional PCR to detect both Dirofilaria spp. (cox1 gene) and Wolbachia spp. (16S rDNA) infections. Infection with D. immitis was detected in 14 (28.0%) of 50 examined samples, while the detection rate of TBD causative agents, including Anaplasma phagocytophilum and Ehrlichia canis, was 26.0% (13/50) and 26.0% (13/50), respectively, as determined by ELISA rapid test. In this study, D. immitis infection was moderately but significantly correlated with TBD infections (Pearson’s r = 0.397, P = 0.008). Comparative sequence and phylogenetic analyses provided molecular identification of D. immitis in Myanmar and confirmed the identity of its Wolbachia endosymbiont with Wolbachia endosymbionts isolated from D. immitis, Rhipicephalus sanguineus and Aedes aegypti. The present study contributes to our understanding of the coexistence of D. immitis and Wolbachia endosymbiosis in dogs, and the findings may benefit the future prevention and control of dirofilariasis in dogs.

Diversity of common bean rhizobia in blackland of northeastern China and their symbiotic compatibility with two host varieties.

The common bean (Phaseolus vulgaris L.) is an important crop in the world that forms root nodules with diverse rhizobia. Aiming to learn the rhizobial communities associated with the common bean in the black soil of Northeast China, 79 rhizobia were isolated from root nodules of two host varieties (Cuican and Jiadouwang) grown in two sites of blackland and were characterized by comparative sequence analyses of 16S rRNA, recA, atpD, nodC, and nifH genes, and whole genome. As a result, Rhizobium indigoferae, R. anhuiense, and R. croatiense as minor groups and three dominant novel Rhizobium species were identified based on their average nucleotide identity and DNA-DNA hybridization values to the type strains of relative species. This community composition of rhizobia associated with the common bean in the tested black soils was unique. Despite their different species affiliations, all of them were identified into the symbiovar phaseoli according to the phylogenies of symbiotic genes, nodC and nifH. While the phylogenetic discrepancies found in nodC, nifH evidenced that the evolutions of nodulation (nod) and nitrogen fixation (nif ) genes were partially independent. In addition, only one dominant rhizobial species was shared by the two common bean varieties grown in the two soil samples, implying that both the plant variety and the soil characteristics affected the compatibility between rhizobia and their hosts. These findings further enlarged the spectrum of common bean-nodulating rhizobia and added more information about the interactions among the soil factors, rhizobial species, and host plants in the symbiosis.

Comparative sequence analysis of Meq oncogene of Marek’s disease virus field isolates detected in Marek’s disease affected birds from vaccinated poultry flocks

Comparative sequence analysis of Meq oncogene of Marek’s disease virus field isolates detected in Marek’s disease affected birds from vaccinated poultry flocks

Description and Genomic Characterization of Oceaniferula flavus sp. nov., a Novel Potential Polysaccharide-Degrading Candidate of the Difficult-to-Cultivate Phylum Verrucomicrobiota Isolated from Seaweed.

A novel strain, isolate 5K15T, which belongs to difficult-to-cultivate phylum Verrucomicrobiota, was recovered from kelp collected from Li Island, Rongcheng, China. The genome sequence of the strain (genome size 3.95 Mbp) showed the presence of four putative biosynthetic gene clusters (BGCs), namely, two terpene biosynthetic gene clusters, one aryl polyene biosynthetic cluster, and one type III PKS cluster. Genomic analysis revealed 79 sulfatase-encoded genes, 24 sulfatase-like hydrolase/transferase-encoded genes, and 25 arylsulfatase-encoded genes, which indicated the great potential of 5K15T to degrade sulfated polysaccharides. Comparative analysis of 16S rRNA gene sequence showed that the novel strain was most closely related to Oceaniferula marina N1E253T (96.4%). On the basis of evidence from a polyphasic study, it is proposed that the strain 5K15T (= KCTC 82748T = MCCC 1H00442T = SDUM 810003T) be classified as Oceaniferula flavus sp. nov. The strain has the ability of carbohydrate transport and metabolism. This ability allows it to survive in carbohydrate-rich materials such as kelp. It has the potential to be used in the marine drug industry using seaweed.

Çok Kriterli Karar Verme Problemlerinde Duyarlılık Analizi

The aim of this study is to propose a model of stability and sensitivity for the studies used in the implementation of multi-criteria decision making (MCDM). In this context, it is proposed to use the steps "sensitivity analysis based on the variation of criterion weight, sensitivity analysis based on sequence reversal feature and comparison analysis with results from different sorting methods" for stability and sensitivity analysis. In the implementation part of the method, the Fragile Five countries were used as criteria for the unemployment rate, state budget, GDP growth, inflation, current account balance, risk premium for these countries. The criteria were weighted with MEREC and the ordering of alternatives was carried out with WISP. In the application phase of the method, it was found that the model was sensitive to changes in weight coefficients with different weights assigned to criteria over 22 scenarios. It has been observed that the model provides valid results in a dynamic environment through 4 different scenarios created in the sequence inversion step of the model. For the reliability of the MEREC-WISP-based model, a ranking comparison was made with some commonly used methods such as PIV, CoCoSo, COPRAS, WEDBA, TOPSIS and SAW and the results were found to have a high correlation.

Indigenous diazotrophs and their effective properties for organic agriculture

Nitrogen-fixing microorganisms (diazotrophs) converting the atmospheric N2 into usable form NH4 are considered the key players in the nitrogen cycle, chiefly responsible for the enriching nitrogen content in the soils. Globally, biological fixation of N2 greatly contributes to plant growth, lessens the need for chemical fertilizers, and thus contributes to the mitigation of greenhouse gases NOx. In this study, diazotrophic bacterial strains were isolated from rhizosphere soils and root nodules of legume and non-legume plants in Vietnam. Quantitative analyzes by the acetylene reduction assay showed that the isolates have high nitrogen fixation activity compared with that of reference strain Azospirillum vinelandii KCTC 2426. In addition, other effective capabilities of the isolated strains toward supporting agriculture were investigated, i.e. synthesizing IAA and siderophore for promoting plant growth, or producing exopolysaccharides for maintaining soil moisture. Taxonomic positions of the isolated strains were identified based on the comparative analyses of sequences of the 16S rDNA and gene related to nitrogen fixation (nifH), revealing a high taxonomic diversity among free-living and symbiotic diazotrophic isolates. Direct support of the selected isolates to plant growth was proven in experiments with mung beans under laboratory conditions. Thus, the native diazotrophic strains obtained in this study would be good microbial sources for application in organic agriculture and soil amendment.

Comparative sequence analysis of SARS nCoV and SARS CoV genomes for variation in structural proteins

SARS-nCoV was identified as corona virus had spread worldwide very quickly and affected more than million people worldwide. To halt this acceleration and for efficient control the knowledge on genomic information is of utmost importance. We attempted to determine the nature of variation i.e., insertion, deletion, substitution, among structural sequences required to code for membrane, spike, nucleocapsid, envelope protein and glycosylation variation between SARS CoV and SARS nCoV spike glycoproteins, respectively. Comparative sequence analysis was performed by using retrieved sequences from the NCBI database. The analyzed sequences revealed, that the sequences coding for envelope protein show minor substituting amino acids. SARS CoV showed 94.74 percent amino acid identities with SARS nCoV amino acid sequences coding for envelope protein. In comparison to SARS nCoV, distinct amino acid residues vary in SARS CoV sequences coding for membrane, nucleocapsid, and spike proteins, respectively. S protein coding sequences of SARS CoV exhibited one deletion, six insertion and six hundred three substitutions in SARS nCoV sequence. Insertion of valine was found in receptor binding domain of SARS nCoV at position 487, and NSPR amino acid residues at position 683–686. Deletions and substitutions were also found in nucleotide sequences of strain B.1.617.2 of SARS nCoV. Additionally, binding interaction pattern of ACE2 receptor protein with original wild-type SARS-CoV-2 strain with the recently evolved Omicron variant was also evaluated. The docking results substantiated that the specific variation in binding residues is likely to impact virulence pattern of both variants.