Commercial Products Research Articles

Evaluation of the Efficacy of a Full-Spectrum Low-THC Cannabis Plant Extract Using In Vitro Models of Inflammation and Excitotoxicity

Evidence has accumulated that Cannabis-derived compounds have the potential to treat neuroinflammatory changes present in neurodevelopmental conditions such as autism spectrum disorder. However, research is needed on the specific brain health benefits of strains of whole Cannabis extract that are ready for commercial production. Here, we explore the anti-inflammatory and neuroprotective effects of NTI-164, a genetically unique high-cannabidiol (CBD), low-Δ9-tetrahydrocannabinol extract, and also CBD alone on BV-2 microglia and SHSY-5Y neurons. Inflammation-induced up-regulation of microglial inflammatory markers was significantly attenuated by NTI-164, but not by CBD. NTI-164 promoted undifferentiated neuron proliferation and differentiated neuron survival under excitotoxic conditions. These effects suggest the potential for NTI-164 as a treatment for neuropathologies.

Ultra-High-Performance Liquid Chromatography–Tandem Mass Spectrometry Analysis of Δ9-Tetrahydrocannabinol and Cannabidiol in Commercial Suk-Saiyasna Herbal Remedy: Applying Hansen Solubility Parameters for Sample Extraction to Ensure Regulatory Compliance

Background: Suk-Saiyasna is a traditional Thai herbal remedy that comprises 12 distinct herbs. Among these, cannabis leaves constitute 12 of the total 78 components in this formulation. This study specifically examines the portion of the cannabis plant, which accounts for approximately 15.8% of the overall herbal composition used in the entire remedy. According to the Thailand Narcotics Act of 2022, the Δ9-tetrahydrocannabinol (Δ9-THC) concentration in herbal extracts must not exceed 0.2% by weight. This study aims to quantify the levels of Δ9-THC and cannabidiol (CBD) in commercial Suk-Saiyasna products. Methodology: This research utilizes Hansen Solubility Parameters (HSPs) to identify the optimal solvent for ultrasonic extraction, thereby maximizing cannabinoid yield. An advanced method was developed employing ultra-high-performance liquid chromatography–tandem mass spectrometry (UHPLC-MS/MS), compliant with AOAC standards to meet regulatory guidelines. The method validation emphasized specificity, linearity, sensitivity, accuracy, and precision. Results: Dichloromethane was chosen due to its favorable HSP values, enabling highly efficient extraction of Δ9-THC and CBD, achieving recovery rates of over 99.9% after the second extraction. This investigation benefits from the accuracy of the UHPLC-MS/MS technique in quantifying cannabinoids in commercial products, with Δ9-THC concentrations observed between 0.00231% and 0.14218%, and CBD concentrations ranging from 0.00002% to 0.01541%, all remaining below the legal limit. Conclusions: The variability in cannabinoid concentrations among various commercial products highlights the need for standardization in the herbal industry. This finding underscores the critical role of rigorous quality control measures in ensuring the safety and efficacy of cannabis-derived products.

Relationship Between Age and Condensed Tannin Content in the Bark of Two Forest Species Grown in Northeast Brazil

Objective: This research aimed to evaluate the influence of tree age on the condensed tannins content in the bark of two forest species. Theoretical Framework: Tannins are phenolic compounds present in various parts of plants and have consolidated applications in the market. This way, silvicultural studies of different species with the potential to produce are relevant. Method: Barks of Azadirachta indica at 5, 6, and 7 years and Mimosa caesalpiniaefolia at 6, 7, and 9 years were collected from an experimental plantation located in a forest area in Rio Grande do Norte, Brazil. The barks were then air-dried and ground to obtain a material subjected to extraction. Total solids content, Stiasny index, and condensed tannin content were determined from the hot-water extracts. Results and Discussion: The condensed tannins content in A. indica bark did not vary as tree age increased, while for M. caesalpiniaefolia, the most productive age was determined to be six years old. Research Implications: The experimental approach showed that A. indica presented stable tannin content in the bark regardless of age, allowing continuous and flexible management to produce these extractives. In contrast, M. caesalpiniifolia presented condensed tannins, with their reactivity decreasing with age, indicating that younger trees are more suitable for high-quality extractions and commercial production. Originality/Value: Tannins content in Azadirachta indica bark remains stable over time, facilitating continuous management and Mimosa caesalpiniifolia bark, the concentration of tannins is higher in younger trees.

Can commercial aquafeeds improve the nutritional value of brine shrimp? Proximal composition and lipid profile of alternative enhancers

Artemia, commonly known as brine shrimp, holds a significant role as live prey in ornamental and commercial fish aquaculture. This study addressed the nutritional deficiency in adult Artemia biomass, exploring alternative enrichers available in Brazil. Evaluating a commercial aquafeed (Polinutre Poli Camarão 400PL) and a lipid emulsion (BioViv HUFA Continum), adult Artemia were subjected to different enrichment protocols, including periods of 1, 12, and 24 hours with each enricher, as well as a test group raised 100% on the commercial feed. Protein content for Artemia exclusively fed the commercial aquafeed (CF100) reached values very similar to those provided by the main commercial products available worldwide and other commonly used live prey. Enrichment time effects were observed from 12 h onwards, showing positive impacts on protein accumulation. Lipid content peaked at 12 h, followed by a decrease at 24 h. Further studies are needed to assess whether the combination of feed-based protocols followed by 12-h lipid emulsion enrichment can surpass the current results, providing high levels of protein content while maintaining a complete lipid profile.

A multimodal in vitro approach to assess the safety of oral care products using 2D and 3D cellular models

IntroductionPeriodontitis, affecting approximately 3.9 billion individuals globally, significantly impacts quality of life and has raised interest in its potential systemic effects. Sodium perborate, a common component in oral care products for biofilm control, is widely used, though concerns about its safety persist. This study aimed to evaluate the in vitro toxicity of six commercial oral care products and varying concentrations of sodium perborate, utilizing human gingival fibroblasts (HGF) and keratinocytes (HaCat) as cell models.MethodsExperiments were performed in both 2D monolayer and 3D cultures using MTT and electrical impedance assays, adhering to the manufacturer’s recommended exposure time of 30–60 s for product testing. For the reconstructed epidermis model, a prolonged exposure time of 42 min was applied, following the Organization for Economic Cooperation and Development (OECD) Test Guideline 439.ResultsResults indicated that all products and sodium perborate at 1 mg/mL were cytotoxic in monolayer cultures. However, at concentrations relevant to commercial formulations (0.06 mg/mL sodium perborate), no significant toxicity was observed. In contrast, the 3D culture models, including spheroids and reconstructed epidermis, exhibited minimal to no cytotoxic effects for the commercial products, with sodium perborate showing no significant toxicity below 0.1 mg/mL. The reconstructed epidermis model, used as surrogate for oral mucosa, further confirmed that the products were non-irritating, in compliance with OECD TG 439 standards.DiscussionThis study highlights the importance of considering exposure time, dosage, and cellular model when assessing the safety of oral care products. While 2D models are useful for preliminary screenings, 3D models provide a more physiologically relevant assessment, emphasizing the need for robust testing protocols to ensure product safety.

Koji amazake produced by double saccharification contains more isomaltose and modifies the gut microbiota in mice

Koji amazake, which is made from rice and rice koji (a product of Aspergillus oryzae), is a traditional Japanese beverage that has glucose as its main component. It also contains isomaltose, which has been reported to have various functionalities related to gut health. In the present study, we attempted to produce amazake with a higher concentration of isomaltose without using any additives by focusing on the saccharification step of rice koji production as a means of creating new value for amazake. Two types of rice koji that were obtained at different fermentation time points were used, and we changed the saccharification process from the usual one step of saccharification to two steps of saccharification using a different type of rice koji for each step. The amazake made by double saccharification (DSA) contained 20 times more isomaltose than the commercial amazake products. In an in vivo study, oral administration of the DSA modified the cecal microbiota in mice. Moreover, changes were seen in the abundances of several gut microorganisms, such as Anaerotignum lactatifermentans, Muribaculum intestinale, and Parabacteroides merdae. These findings indicate that our novel method may be useful for producing amazake with a high isomaltose content that may have health benefits in humans.

The genetics of fruit skin separation in date palm

The physical appearance of date palm (Phoenix dactylifera) fruit (dates) is important for its market value. Many date-producing countries experience significant financial losses due to the poor appearance of the fruit, skin separation or puffiness being a major reason. Previous research showed evidence linking the skin separation phenotype to environmental conditions. To investigate this further, a genome-wide association study was conducted using genome data from 199 samples collected from 14 countries. Here, we identified nine genetic loci associated with this phenotype and investigated genes in these regions that may contribute to the phenotype overall. Multiple genes in the associated regions have functional responses to growth regulators and are involved in cell wall development and modification. Analysis of gene expression data shows many are expressed during fruit development. We show that there are both environmental and genetic contributions to the fruit skin separation phenotype. Our results indicate that different date cultivars exhibit varying degrees of skin separation despite genetic similarities or differences. However, genetically different cultivars show extreme differences compared to the phenotype variation between genetically similar cultivars. We demonstrate that beyond environmental factors, genetics is a strong contributor to the most extreme skin separation in some cultivars. Identifying the genetic factors may help better understand the biology and pathways that lead to the environmental effects on skin separation and improve commercial date production. In conclusion, our key finding is that both environmental and genetic factors contribute to skin separation variation, and improvements in environmental factors alone cannot overcome the extreme level of variation observed in some cultivars.

First Report of Root-knot Nematode, Meloidogyne enterolobii, on Luffa cylindrica (L.) in Guangxi, China.

Luffa cylindrica (L.), an annual climbing herb of the Cucurbitaceae family, has a long planting history in China and is deeply loved by people due to its nutritional and medicinal value (Partap S, Kumar A et al., 2012). April 2023, symptoms such as plant dwarfism, decreased yield and serious root-knots appeared on L. cylindrica sampled from a commercial production base in Beihai, Guangxi, China (GPS 21°55'79″ N;109°49'61″ E). The investigated area of L. cylindrica was about 1.3 ha, the incidence of root-knot nematode disease was almost 90%. The roots of 20 L. cylindrica were dug up and many root-knots and egg masses were found. Nematodes in samples at different stages were collected by shallow dish method, and morphological identification was caried out. Males were worm-like, annulated, with the anterior part slightly conical. Females were globular to pyriform. The perineal pattern was oval, with the dorsal arch being moderately high to tall. The tail of the second-stage juvenile (J2) was very slender with a sharp tip. The transparent tail end was clearly visible. Morphological measurements of females (n = 20): body length = 677.2 ± 34.4 μm, body width = 512.8 ± 45.4 μm, stylet = 13.7 ± 0.5 μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 5.7 ± 0.8 μm. The measurements of J2s (n = 20): body length = 412.5 ± 19.4 μm, body wide = 16.2 ± 1.3 μm, stylet lengths = 12.6 ± 0.92 μm, DGO length = 3.1 ± 0.3 μm. Average tail length = 45.44 ± 4.1μm. The observed typical characteristics of M. enterolobii were consistent with those previously described by Yang & Eisenback (1983) and EPPO (2016). J2s hatched by single egg mass were used for DNA extraction and identification of molecular biology. Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), the specific primers of M. enterolobii, was used to validate this pathogen (Long et al., 2006). Consistent with that described before, the target amplification product was about 236 bp, and no product was obtained from the negative control, M. incognita and M. javanica (Chen et al., 2023). Using V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG), the rDNA ITS region was obtained and sequenced (Vrain et al., 1992). The target product was 765 bp (GenBank accession no. PQ205316), which was 100% homologous to those M. enterolobii ITS sequence available in the GenBank (KX823372, KJ146863). Koch's postulates were used to verify the pathogenicity of M. enterolobii on L. cylindrica, twelve 2-week-old L. cylindrica were planted in sterilized soil and inoculated with M. enterolobii J2s at a rate of 3,000 individuals per plant. The plants were grown at 26°C in a greenhouse, with non-inoculated controls set up. After 8 weeks, the roots of the non-inoculated plants (n = 12) showed no root-knot and grew well, while all inoculated plants developed root-knots and exhibited stunted growth. The average reproduction factor of the inoculated plants was 19.5, and the average root-knot rating was 7.2 (on a scale of 0 to 10) (Bridge and Page 1980), confirming the pathogenicity of M. enterolobii on L. cylindrica. We found that this is consistent with the description of M. enterolobii infecting Coriandrum sativum in Shanxi, China (Pan et al., 2024) and the infection of Selenicereus costaricensis in Guangxi, China by M. enterolobii (Wu et al., 2023). To our knowledge, this is the first report of M. enterolobii parasitizing L. cylindrica in Guangxi, China. With the increase of vegetable planting area, root-knot nematodes are becoming more and more serious and have become a limiting factor on vegetable production. This finding is of significant importance for vegetable growers to control M. enterolobii in this region, based on which suitable management measures will be taken.

Chemical analysis and concentrations of cannabidiol substances used for refractory epilepsy in Chilean patients. An underestimated worldwide risk.

The purpose of this study is to analyze composition of HMS (homemade CBD), NLS (non-licensed commercial products), and bioequivalent CBD (BES) collected from Chilean patients that voluntary accepted to analyze the "CBD-substance." Samples were collected through an open invitation for different patients to anonymously and free of charge participate in the analysis of CBD oil. The analysis of the active principle was performed using High-Resolution Liquid Chromatography (HPLC). A total of 35 samples were collected between March 2020 and September 2021, including two BES, six NLS, and 27 HMS products. The BES had an average CBD concentration of 89.15 mg/mL and an average THC concentration of 0.015 mg/mL, which complied with the maximum THC levels required by regulatory authorities (<0.2% THC.). The NLS (six samples) exhibited significant variability in CBD concentrations, ranging from a maximum of 78.5 mg/mL to a minimum of 0.1 mg/mL, with an average of 25.41 mg/mL. The THC concentrations ranged from 0 mg/mL to 2.43 mg/mL with an average of 0.62 mg/mL. The HMS products exhibited even higher variations of CBD concentrations, ranging from 0 to a maximum of 6.6 mg/mL. THC concentrations were even more variable, ranging from 0 mg/mL to 388 mg/mL. The medical community and patients involved should be aware that Hemp products are not pure and/or innocuous. HMS are likely to have high levels of THC and very low CBD, far away from therapeutic doses of CBD. CBD used in epilepsy should be restricted to licensed products, especially in children where THC toxicity is much more harmful. The study analyzed three types of CBD (cannabidiol) oils: homemade, non-licensed, and bioequivalent. Homemade and non-licensed products showed nonacceptable variance of CBD and THC concentration (tetrahydrocannabinol), in some cases with 0 mgs of CBD and many beyond THC maximum accepted. The THC is another component found in cannabis and is responsible for the neurotoxic effects. Only bioequivalent products showed concentrations of CBD and THC acceptable for epilepsy treatment, therefore are the only products recommended for such purpose.

Valorizing Waste Streams to Enhance Sustainability and Economics in Microbial Oil Production.

Driven by demand for more sustainable products, research and capital investment has been committed to developing microbially produced oils. While researchers have shown oleaginous yeasts and other microbes can produce low-carbon footprint oils by leveraging waste streams as energy sources, previous analyses have not fully explored the quantity of available waste streams and in turn economy-of-scale enabled on capital and operating expenses. This paper makes parallels to 2G ethanol facilities, enabling a data-driven understanding of large-scale production economics. Production costs are broken down for a variety of scenarios. The analysis finds that reaching price parity with large-scale commodity oils (e.g., palm oil, high-oleic cooking oils, biofuels feedstock oils, lauric acid) is not possible today and unlikely even under aggressive future assumptions about strain productivity. Instead, commercial production must be targeted at end markets where sustainability-conscious consumers are willing to pay the price premiums identified in this paper.

Zinc outperforms other foliar fertilisers in enhancing lentil yield and harvest index in semi-arid regions

ABSTRACT Lentil yield in semi-arid regions is limited by heat, drought stress and nutrient deficiencies induced by high soil pH and water scarcity. In this study, we investigated the effect of foliar fertiliser treatments on lentil yield and yield components in a semi-arid region of South-East Anatolia, Türkiye. The control treatment and six foliar treatments were as follows: (i) Control: non-amended control, (ii) Zn: zinc sulphate, (iii) K: potassium sulphate, (iv) Zn + K (zinc sulphate + potassium sulphate), (v) Flo: Florea-UPL (containing boron and molybdenum), (vi) Mac: Macarena-UPL, an organomineral foliar fertiliser and (vii) Flo + Mac. Foliar fertilisers were applied at the first blooming stage of field-grown lentils. Total biomass yield was largely unaffected across treatments except in the K treatment. However, foliar Zn supply was the only treatment that significantly increased grain yield (55% higher), harvest index and total grain N uptake compared to the control, likely due to enhanced translocation of nitrogen-containing assimilates. SPAD values and total N analysis showed that stover N content depleted more rapidly in the Zn treatment than in other treatments during the grain-filling phase. The tested commercial products slightly increased SPAD values, biomass and grain yield. Among the treatments, Zn, as a foliar fertiliser, was the most cost-effective solution for improving grain yield in this region.

Gel Cleaning in Heritage: Comparison of the Water Release among Gels and Traditional Pads

Water release is a crucial aspect when considering cleaning effects on water-sensitive materials. In conservation practice, a water-based cleaning method which limits water release is very often needed. Unfortunately, this is not accompanied by an appropriate measure of the effectively released water. In this paper, water release has been measured by comparing traditional cleaning formulations, such as paper pulp and sepiolite, with several gar gel formulations, used by both Italian and European conservators. The assessment has been carried out by the gravimetric method, using three different stone material specimens as reference: Noto calcarenite, Manciano sandstone and Black Bergamo limestone, whose porosity values and distributions are known. Moreover, water distribution has been evaluated by portable NMR tests. Different commercial agar gel products (Bresciani, CTS, Sigma), having different concentrations (3, 4, and 5%), application modes (rigid at room T or fluid warm gels, with and without inserting Japanese tissue paper), and geometry (horizontal in gravity force direction or vertical), have been compared to obtain a full scenario among different water release mechanisms present in real conservation works. The paper faces the important issue of preparing reproducible chemical or water pads as well, useful for further research aimed at comparing cleaning effects in heritage conservation. The most interesting quantitative results can be summarized as follows. The water release measured from paper pulp and sepiolite was found to be 2 to 4 times higher than from any tested agar gel. Water release decreases by increasing agar concentration; an increase in the agar concentration by 1% induces a decrease in water release in the range 16.98–66.88 g depending on the stone; the increase from 4% to 5% is more obvious with respect to that from 3% to 4%. It is possible to assess the effect of the presence of Japanese paper, which is able to reduce the water release from 18 to 76%, depending on the stone and on the agar used. The gravimetric results were also used in the preliminary calibration tests of a contact probe named System Unit Salinity Index (SUSI), recently patented and useful in providing humidity and salinity indexes in a given porous material.

Determination of Dried Root Extract of Rheum emodi and its Commercial Products Using Rhein and Chrysophanol as Standard Markers by HPTLC Densitometric Analysis

Determination of Dried Root Extract of Rheum emodi and its Commercial Products Using Rhein and Chrysophanol as Standard Markers by HPTLC Densitometric Analysis

Novo plant-based mosquito repellent shows promise for exclusion of Aedes mosquitoes from "window" entry.

Mosquitoes threaten over half of the world's population through vectored diseases such as malaria, zika, yellow fever, dengue, and chikungunya. Mosquitoes have a highly developed olfactory system attuned to chemotaxis relating to host-seeking, mating, and oviposition behavior. In this study, we aimed to determine the spatial efficacy of 2 plant-based repellent blends (Blend3 and Blend4that had previously been found to successfully repel Aedes, Anopheles and Culex mosquitoes in wind tunnel assays)in excluding Aedes aegypti from the window entry. A new cage system was developed for parallel "no-choice" and "choice" olfactometric assays. In the no-choice trial, Blends 3 and 4, as well as commercial products (N, N-diethyl-3-methylbenzamide, p-menthane-3,8-diol [PMD], 3-(N-n-butyl-N-acetyl)-amino-propionic acid ethyl ester, and 2-(2-hydroxyethyl)-1-methylpropylstyrene 1-piperidine carboxylate), were adsorbed into filter papers of different sizes and placed in a window created between 2 attached bug dorms. Then, the number of mosquitoes entering the window was counted through a 6-min period. In choice olfactometric assays, Blends 3, 4, and PMD were adsorbed into filter paper and the number of mosquitoes moving away from Blend 3 and PMD were compared. No-choice assays showed that Blend3 (P < 0.001) and Blend4 (P = 0.0012) were more repellent than the best commercial product PMD. Additionally, while Blend 4 was significantly more repellent than Blend 3 (P = 0.012) in the choice assay, overall, these 2 blends show promise as new repellents for the spatial exclusion of Aedes aegypti from window entry alone or as part of a "push-pull'' strategy.

Plant growth-promoting fungi improve tobacco yield and chemical components by reassembling rhizosphere fungal microbiome and recruiting probiotic taxa

BackgroundTobacco production faces ongoing challenges due to soil degradation, leading to a persistent decline in yield. Plant growth-promoting fungi (PGPF) have been recognized as an environmentally friendly agricultural strategy. However, many commercial PGPF products exhibit instability due to insufficient environmental compatibility.ResultsIn this study, Penicillium sp. PQxj3 was isolated and assessed for its potential to enhance tobacco productivity under field conditions. The results demonstrated that Penicillium sp. PQxj3 treatment significantly promoted the tobacco growth and improved the crop yield. The height of tobacco in Penicillium sp. PQxj3 treatment group significantly increased by 50.19% and 24.05% compared with CK at exuberant and maturity period (P < 0.05). The average yield of tobacco significantly increased by 36.16% compared to CK (P < 0.05). Fungal microbiome analysis revealed that phylogenetically similar probiotic taxa were recruited by Penicillium sp. PQxj3 and reassembled tobacco rhizosphere fungal microbiome. The key chemical indicators of tobacco such as alkaloid, total sugar, and phosphorus were significantly enhanced in Penicillium sp. PQxj3 treatment. The recruited probiotic taxa (Penicillium brasilianum, Penicillium simplicissimum, Penicillium macrosclerotiorum and Penicillium senticosum) were significantly associated with alkaloid, total sugar etc. (P < 0.05), which were identified as the key drivers for improving the chemical components of tobacco. Transcriptome analysis indicated that Penicillium sp. PQxj3 promoted up-regulation of key functional genes involved in alkaloid, indoleacetic, and gibberellin biosynthesis pathways.ConclusionIn summary, this study assessed the biopromotion mechanism of PGPF Penicillium sp. PQxj3 linking chemical traits, rhizosphere fungal microbiome, and transcriptome profiling. The findings provide a fundamental basis and a sustainable solution for developing fungal fertilizers to enhance agricultural sustainability.

Network and systems biology approaches help investigate gene regulatory interactions between Salmonella disease and host in chickens: Model-based in silico evidence combined with gene expression assays.

Salmonella enteritidis (SE), a previously widespread infectious disease, is still cited as a major factor in economic losses in commercial chicken production. The host's genetic immune system determines the pathogenicity of a particular bacterium. To shed light on this topic, it was necessary to understand the key candidate genes essential for regulating susceptibility and resistance to the target disease. The field of poultry farming in particular has benefited greatly from the connection between quantitative and molecular genetics. This study aims to identify the most important immune-related genes and their signalling pathways (gene ontology, co-expression and interactions) and to analyse their accumulation in host-resistant SE diseases by combining gene expression assays with model-based in silico evidence. A two-step experimental design is followed. To start, we used free computational tools and online bioinformatics resources, including predicting gene function using a multiple association network integration algorithm (geneMania), the Kyoto Encyclopedia of Genes and Genomes, the Annotation, Visualization and Integrated Discovery (DAVID) database and the stimulator of interferon genes. Natural resistance-associated macrophage protein 1 (NRAMP1), Toll-like receptor 4 (TLR4), interferon-γ (IFNγ), immunoglobulin Y (IgY) and interleukin 8 (IL8) were among the five genes whose expression levels in liver, spleen, and cecum were evaluated at 1107 SE after 48h of inoculation. This molecular study was developed in the second phase of research to validate the in silico observations. Next, we use five promising biomarkers for relative real-time polymerase chain reaction (PCR) quantification: TLR4, IL8, NRAMP1, IFNγ and IgY genes in two case and control assays. The 2-∆∆Ct Livak and Schmittgen method was used to compare the expression of genes in treated and untreated samples. This method normalizes the expression of the target gene to that of actin, an internal control and estimates the change in expression relative to the untreated control. Internal control was provided by the Beta actin gene. Next, statistically, the postdoc test was used for the evaluation of treatments using SAS version 9.4, and p values of 0.05 and 0.01 were chosen for significant level. Interestingly, the results of our study suggest the involvement of various factors in the host immune response to Salmonella. These include inducible nitric oxide synthase, NRAMP1, immunoglobulin light chain (IgL), transforming growth factor B family (TGFb2, TGFb3 and TGFb4), interleukin 2 (IL2), apoptosis inhibitor protein 1 (IAP1), TLR4, myeloid differentiation protein 2 (MD2), IFNγ, caspase 1 (CASP1), lipopolysaccharide-induced tumour necrosis factor (LITAF), cluster of differentiation 28 (CD28) and prosaposin (PSAP). The summary of gene ontology and related genes found for SE resistance was surprisingly comprehensive and covered the following topics: positive regulation of endopeptidase activity, interleukin-8 production, chemokine production, interferon-gamma production, interleukin-6 production, positive regulation of mononuclear cell proliferation and response to interferon-gamma. The role of these promising biomarkers in our networks against SE susceptibility is essentially confirmed by these results. After 48h, the spleen showed significant expression of the tissue-specific gene expression patterns for NRAMP1 and IL8 in the cecum, spleen and liver. Based on this information, this report searches for resistance and susceptibility lineages in most genomic regions for SE. In conclusion, the development of an appropriate selection program to improve resistance to salmonellosis can be facilitated by a comprehensive understanding of the immune responses of the chicken immune system after SE exposure.

Evidence of polybrominated diphenyl ethers (PBDEs) and alternative halogenated flame retardants (AHFRs) in wild fish species from the remote tropical marine environment, South China Sea

Polybrominated diphenyl ethers (PBDEs) and their alternatives (e.g., dechlorane plus (DPs) and decabromodiphenyl ethane (DBDPE)) are ubiquitous in various environmental media. However, limited data is available on these chemicals in edible fish species from the wide-open South China Sea (SCS). In the present study, ten legacy PBDEs and three substitutions (DBDPE and two DPs) were analyzed in 16 wild fish species sampled from the open SCS to investigate their spatial and species-specific variations. The results showed that the total concentrations of PBDEs, DBDPE, and DPs in fish samples were in the range of 1.69 to 47.6, not detected (nd) to 21.0, and nd to 3.80 ng/g lipid weight (lw), respectively. BDEs 47, 209 and 100 were the dominant target PBDE congeners, representing 49.2%, 17.2% and 9.93% of the total PBDE concentrations, respectively. Higher concentrations of PBDEs, DBDPE, and DPs were found in fish species from the Wanshan Archipelago compared to those from the Mischief Reef and the Yongxing Island, suggesting the significant influence of anthropogenic activities. Species-specific differences in levels of PBDEs were observed, with the order of bathydemersal > demersal > pelagic ≈ reef-associated > benthopelagic species. The average fanti value of all fish samples was 0.68, suggesting commercial DP products as a contamination source. The levels of PBDEs, DPs, and DBDPE in fish samples were relatively low compared with those from other locations around the globe. Finally, the health risks concerning the ingestion of BDEs 47, 99, 153 and 209 via fish consumption collected from the SCS are negligible.

Daylength Influences Time to Harvest and Stem Quality of Pycnosorus globosus and Caryopteris incana Specialty Cut Flowers

As the demand for locally grown specialty cut flowers increases, cultivars of Pycnosorus globosus and Caryotperis incana are becoming more available for growers to produce as cuts. However, protocols for year-round greenhouse production are limited. Therefore, our objective was to determine if the photoperiod influences flower induction and development, time to harvest, yield, and morphology of billy buttons (Pycnosorus globosus) ‘Paintball Globe’ and ‘Paintball Poppy’ and bluebeard (Caryopteris incana) ‘Pagoda Lagoon’ and ‘Pagoda Dark Pink’ to facilitate commercial greenhouse production. Shoot-tip cuttings were rooted and transplanted into bulb crates and placed in a greenhouse with a mean daily air temperature of 20 °C and 9-, 10-, 11-, 12-, 13-, 14-, 15-, or 16-hour photoperiods or a 9-hour short day (SD) with a 4-hour night interruption (NI) from 2200 to 0200 HR for 11 weeks. Billy buttons initiated inflorescences and developed flowers under all daylengths; however, the greatest stem lengths were recorded under long days (LDs). Bluebeard inflorescences initiated under all daylengths were tested. Time to visible inflorescence and flower was hastened under daylengths ≤14 hours, whereas inflorescences under the 16-h photoperiod or 4-h NI never fully developed. For ‘Pagoda Lagoon’ and ‘Pagoda Dark Pink’, the critical daylengths for flower development were 14 hours and 15 hours, respectively. On average, only bluebeard ‘Pagoda Lagoon’ harvested under photoperiods ≥10 hours developed marketable stem lengths (&gt;40 cm). To hasten time to visible inflorescence and harvest and ensure marketable stem lengths, billy buttons should be grown under daylengths ≥13 hours. Based on these results, we recommend growing bluebeard under a 16-hour photoperiod or NI for 4 to 6 weeks to promote vegetative growth, followed by an 11- to 14-hour photoperiod for flower induction and development. We classify billy buttons as a day-neutral plant for flower induction and a facultative LD plant for flower development. Similarly, bluebeard can be classified as a facultative SD plant for flower induction and an obligate SD plant for flower development.

Multi-trait selection for mean performance and stability in purple-fleshed sweet potato

Few purple-fleshed sweet potato (PFSP) cultivars are available for Brazilian growers, urging for the development of new and adapted cultivars. PFSP breeding programs should include multiple traits during the selection process to increase the chances of developing an adequate genotype, specially yield-related and quality-related traits. The objective was to select promising PFSP genotypes based on yield and tuberous-roots-related traits exploring genotype x environment interaction (GEI). Four experiments were carried out, in which 23 pre-selected PFSP genotypes were evaluated based on yield and quality traits, after screening among 2500 experimental genotypes. The first experiment adopted an augmented block design, with ‘Luiza’ interspersed as a control. From this first experiment, the 19 experimental genotypes with the best performance were selected for the following three experiments, which were conducted in a randomized block experimental design, with three replications each, including ‘Luiza’ as control. The best genotypes were selected in the first experiment using the multi-trait genotype-ideotype distance index (MGIDI). For the following experiments, the performance of the genotypes was assessed using deviance analysis, genotypic stability through weighted average of absolute scores (WAASB) index, and the multi-trait stability index (MTSI). In the first experiment, three factors were retained, being associated to commercial production of tuberous roots (‘K-104′, ‘K-25′ and ‘U1–29′), total production of tuberous roots (‘K-110′, ‘C-42′, ‘F-16′, and ‘U1–29′), and quality of tuberous roots (‘F-22′), respectively. Desired gains were observed for all traits. For the experiments II, III, and IV five factors were retained, being four related to quality of tuberous roots and one to yield components. The GEI was significant for yield-related traits and desired gains were observed for most traits. Due to high commercial tuberous root yield and low WAASB values, the genotypes ‘U1–29′, ‘K-98′, ‘F-22′, ‘K-57′, ‘C-36′, ‘U1–15′, ‘K-25′, and ‘U2–12′ were highly productive and stable. The genotypes selected by the MTSI index were ‘U1–15′, ‘U2–10′, ‘U1–29′, ‘K-98′, and ‘K-78′. The multi-trait selection enabled the identification of promising genotypes highlighting their strengths and weaknesses.

Cubosomes hydrogel containing silver based organometallic compounds for enhanced wound healing of burns: In vitro and in vivo studies

The aim of this study is to investigate the treatment of burn wounds and bacterial infections, specifically focusing on silver(I) N-heterocyclic carbene (Ag-NHC) loaded into cubosomes. Ag-NHC is an organometallic complex of silver (Ag) and can be considered an active pharmaceutical ingredient for the topical treatment of burns. A novel nanoparticle system, cubosome dispersions, was formulated using high pressure homogenization methods with different concentrations of lipid phase glyceryl monooleate (GMO), surfactants such as poloxamer 407 (F-127), and polyvinyl alcohol (PVA). The optimized formulation (U6) was characterized by in vitro drug release profile (90.54 ± 1.17 %), particle size (126.7 ± 0.98 nm), zeta potential (−21.6 ± 6.83 mV), entrapment efficiency (89.30 ± 1.46 %), and morphology as observed by transmission electron microscopy (TEM). The U6 formulation was incorporated into a hydrogel containing Carbopol 940 to form a cubosomal hydrogel (cubogel). The cubogel was characterized by the in vitro release of Ag-NHC (92 %), entrapment efficiency (>90 %), pH (5.3), viscosity (1.2 cP), spreadability, and TEM. From the in vitro drug release pattern, it was concluded that the U6 formulation showed slow and sustained drug release over 24 h, and demonstrated superior burn healing compared to marketed products. The in vivo wound healing study revealed that the cubogel demonstrated a superior burn healing rate compared to commercially available products (Quench® and Clotrimazole®). The in vivo histopathological results showed that the prepared cubogel was effective in treating second-degree burns, with no side effects or skin irritation, compared to commercial products. Additionally, Ag-NHC-loaded cubogel facilitated sustained release for treating burn wounds without any bacterial infections. The current findings provide a strong basis for the initiating phase 0 clinal trials, highlighting significant potential for the further research to benefit the pharmaceutical industry.