Collar Rot Research Articles

Lipoxygenase-related defense response induced by Trichoderma viride against Aspergillus niger Van Tieghem, inciting collar rot in groundnut (Arachis hypogaea L.)

Groundnut varieties grown in non-infested soil (T1), pathogen (Aspergillus niger)-infested soil (T2), and seed treatment with Trichoderma viride JAU60 followed by challenge with fungal pathogen (T3), showed significant differences in percent disease incidence of collar rot in pot culture. Percent disease incidence was higher in GG-13, GG-20 (susceptible) followed by GAUG-10 (moderate), and minimum in J-11, GG-2 (tolerant varieties) in A. niger-infested pot culture at 15 days after sowing (DAS). Seed treatment (T3) of T. viride reduced approximately 51% to 58% disease incidence in different groundnut varieties. The lipid peroxidation product – malondialdehyde (MDA) – content was found to be higher in susceptible varieties grown in pathogen-infested soil (T2) and it was significantly reduced to 56% under T. viride treatment (T3) at 12 DAS. However, tolerant varieties reduced the MDA content by 60% in T3 as compared with the T2 at an earlier stage (9 DAS). The lipoxygenase (LOX) activity rose approximately 3.5-fold in tolerant varieties upon infection (T2) and groundnut seed treated with T. viride (T3) at 12 DAS. Trichoderma treatment (T3) maintained a high level of LOX compared with T2, particularly in tolerant varieties. The pathogen infection ability was positively correlated with LOX activity in tolerant and moderately tolerant varieties of T2 seedlings. MDA content was positively correlated with disease incidence in susceptible varieties followed by induction of LOX activity under T. viride JAU60 treatment (T3). T. viride JAU60 signifies induction of a LOX-related defense response to combat the collar rot disease incidence in groundnut seedlings.

First Report of Fusarium equiseti Causing Damping-Off Disease on Aleppo Pine in Algeria.

The Aleppo pine (Pinus halepensis Mill.) is a conifer native to the Mediterranean region. In 2008 and 2009, a survey of Aleppo pine seedling diseases was performed in three forest nurseries from Relizane, Sidi Bel Abbes, and Tlemcen provinces in northwestern Algeria. Aleppo pine seedlings showed symptoms of pre- and post-emergence damping-off disease, with an incidence of 64 to 77%. Four composite samples were taken from each location. Disinfested root and root collar segments, approximately 5 mm in length, were cultured on potato dextrose agar (PDA) and incubated at 25°C, and hyphal tips were transferred to PDA. Fusarium equiseti (Corda) Sacc. (teleomorph: Gibberella intricans Wollenw.) was identified from roots of two seedlings from the Sidi Bel Abbes nursery. Morphological identification was done according to Fusarium keys (2). PDA colonies with abundant, loosely floccose, whitish aerial mycelium and beige pigmentation were observed. Macroconidia with usually 5 to 6 septa, 31 to 45 μm long. A pronounced dorsiventral curvature, tapered and elongated apical cell, and prominent foot shape were observed. Microconidia were absent. Chlamydospores were produced in hyphae, most often intercalary, solitary, in pairs, frequently forming chains or clusters, globose (7 to 13 μm). To confirm the identity of this fungus, the internal transcribed spacer of F3RS1 and F19RS1 isolates of F. equiseti were amplified and sequenced using ITS1 and ITS4 primers (4), GenBank accession nos. JX114784 and JX114791, respectively. Those sequences bore 100% (HQ671182) similarity with sequences of F. equiseti in GenBank. Pathogenicity tests were performed to fulfill Koch's postulates. Inoculum was produced by adding a 5-mm-diameter plug from a 7-day-old CMA petri dish culture to a previously sterilized 500 ml flask (237.5 g sand, 12.5 g cornmeal, 80 ml sterile distilled water), shaken over 9 days at 25°C, and mixed with sterile sandy clay soil at 1:3 (v:v). Infested soil was then transferred to 500 ml pots, and 10 Aleppo pine seeds were planted per pot. A completely randomized design was used with three replicates per isolate and three control pots with a similar non-infested soil. After 1 month at 25°C the two tested isolates caused typical damping-off symptoms (collar rot) on seedlings and were re-isolated from recently infected tissues. The percentages of the inoculated plants that became infected were 59 to 65% among isolates (0% in control pots). To our knowledge, infection by F. equiseti is a first report on Aleppo pine in northwestern Algeria, Northern Africa, and globally, and on conifers in the Mediterranean region (1,3). In Algeria, F. equiseti is associated with black pepper (Piper nigrum L.) (3). These findings highlight the moderate impact of F. equiseti on the production of Aleppo seedling stock for reforestation activities in northwestern Algeria.

Trichoderma viride induces phenolics in groundnut (Arachis hypogaea L.) seedlings challenged with rot pathogen (Aspergillus niger Van Tieghem)

The study showed significant differences in percent collar rot disease incidence in groundnut varieties grown in non-infested soil (T1), challenged with pathogen – Aspergillus niger (T2), and pathogen + Trichoderma viride 60 (T3) treatments. Total phenols revealed a significantly higher content in tolerant varieties (J-11, GG-2) of groundnut compared with moderately susceptible (GAUG-10, GG-13) and susceptible (GG-20) varieties. The phenol content accumulated at a higher rate (193%) in GG-20, followed by GG-2 (146%) and J-11 (107%) varieties during disease development stages. HPLC analysis detected six major phenolics, viz., hydroquinone, gallic, chlorogenic, ferulic, salicylic and cinnamic acids. Among six peaks, hydroquinone was found highest in GG-2 at 3 days in T3. Gallic and salicylic acids increased up to 9 days, while ferulic acid continued to induce up to 15 days in tolerant varieties (J-11, GG-2) of Trichoderma-treated (T3) seedlings. A correlation study indicated that Trichoderma treatment induced five phenolics – except gallic acid – with a higher level of significance in a susceptible variety to reduce disease incidence compared with tolerant varieties. Results demonstrate the T. viride 60 mediated systemic induction of phenolics for biologic control and their probable role in protecting groundnut against A. niger infection.

Virulence of Spanish Phytophthora nicotianae isolates towards Capsicum annuum germplasm and pathogenicity towards Lycopersicum esculentum

The virulence of six northwestern Spanish Phytophthora nicotianae Breda de Haan isolates towards the pepper (Capsicum annuum) cultivars commonly used for the determination of P. capsici Leonian pathotype (SCM 334, PI201234 and Yolo Wonder), was similar to that of the latter oomycete but different to that of the German reference isolate P. nicotianae 411.87. When nine local C. annuum cultivars were inoculated with a P. nicotianae isolate of well known pathogenicity, the virulence recorded was significantly different to that recorded for P. capsici. Though the average level of resistance of the northwestern Spanish Capsicum germplasm to P. nicotianae was incomplete and weaker than that recorded for the SCM 334 and PI201234 cultivars, genotypes Co 12B and Co 3.25 showed high resistance to this oomycete. None of the six northwestern Spanish P. nicotianae isolates tested were pathogenic towards Lycopersicum esculentum cv. S. Pedro, unlike P. capsici, which produced clear collar and root rot in this host.

Management of collar rot of tomato caused by Sclerotium rolfsii

Collar rot of tomato (Lycopersicum esculentum Miller) caused by Sclerotium rolfsii Sacc. is one of the most destructive diseases in tomato throughout the world. Effective and efficient management of the crop disease is generally achieved by the use of synthetic pesticides. These pesticides are known to pollute the environment, soil and water besides causing deleterious effects on human health and biosphere.Amendments (Neem cake, oil cake, cow dung, rabbit manure and chicken manure) were used in tomato seedlings to observe growth promotion and percentage increase in shoot length in healthy and treated tomato seedlings of two varieties, F1 Hybrid Arjuna and Pahuza S-22. Results revealed that growth of the tomato seedlings was significantly increased following amendment with neem cake and oil cake in the treated Sclerotium rolfsii inoculated plants than in untreated uninoculated plants as recorded. Oil cake had better effect than neem cake. Similarly, amendment with cow dung, rabbit manure and chicken manure it has been observed that the growth of tomato seedlings increased in treated uninoculated than treated inoculated tomato seedlings. Among the three treatments, cow dung gave better growth of tomato seedlings than that of rabbit manure and chicken manure. DOI: http://dx.doi.org/10.3126/bibechana.v11i0.10393 BIBECHANA 11(1) (2014) 136-140

DISEASE INCIDENCE AND ITS MANAGEMENT ON OPIUM POPPY: A GLOBAL PERSPECTIVE

Opium poppy (Papaver somniferum L.) of the family Papaveraceae is cultivated in different parts of the world such as Tasmania, Afghanistan, Egypt, India and Pakistan for the production of pharmaceutically important alkaloids including morphine, codeine, thebaine and papaverine. These alkaloids are frequently used as an analgesic, anti-tussive and anti-spasmodic in modern medicine. Besides, it is also grown in India as a source of edible seed and seed oil. The Central Institute (CIMAP), Lucknow has carried out detailed investigations on important diseases of opium poppy such as downy mildew (Peronospora arborescencearborescens), collar rot (Rhizoctonia solani), damping off (Pythium aphanidermatum), root rot (Fusarium semitectum), stem and capsule rot (Erwinia carotovora subsp. carotovora) and poppy mottle/mosaic (Potyvirus). Disease incidence, etiology and methods to control diseases caused by different pathogens have been described. Resistant cultivars of opium poppy against downy mildew have been developed. Thirty landraces of opium poppy originating in the Indian states of Rajasthan, Madhya Pradesh, Uttar Pradesh and Tamil Nadu, and four Indian commercial cultivars were screened over four cropping seasons for their reaction to downy mildew under both field and artificial inoculation conditions. The landraces I-14 and N3 were resistant to downy mildew disease. Opium poppy germplasm for disease resistance against important fungal, bacterial and viral pathogens were screened and a disease resistant and high yielding cultivar 'Rakshit' was developed. It has shown disease rating in between 1 and 2 on 0-9 scale of downy mildew and served as highly resistant source against this most destructive disease. The use of resistant cultivars has been recommended for commercial cultivation to minimize disease incidence in northern India.

Rapid and sensitive detection of Sclerotium rolfsii associated with collar rot disease of Amorphophallus paeoniifolius by species-specific polymerase chain reaction assay.

Collar rot disease caused by Sclerotium rolfsii is an economically important disease prevailing in all Amorphophallus growing areas. The pathogen propagules surviving in soil and planting material are the major sources of inoculum. A nested PCR assay has been developed for specific detection of S. rolfsii in soil and planting material. The PCR detection limit was 10 pg in conventional assay whereas 0.1 pg in nested assay. The primers designed were found to be highly specific and could be used for accurate identification of pathogen up to species level. The protocol was standardized for detection of the pathogen in artificially and naturally infected field samples.

First Report of Diplodia pinea on Pseudotsuga menziesii in Turkey

Diplodia pinea is a latent, opportunistic pathogen of Pinus and other coniferous species, including Pseudotsuga menziesii (3). The fungus causes twig blight, branch cankers, tree and seedling collar rot, root rot, and can also infect cones (1). D. pinea has often been reported causing tip and shoot blight on various Pinus spp. in different parts of Turkey. During disease surveys on Pinus spp. carried out in May 2012 in Izmit in the Marmara Region (37°36'54″N, 31°20'00″E), typical shoot blight symptoms of D. pinea infection were also observed on the neighboring P. menziesii trees. Shoots and cones of P. menziesii were investigated for the presence of D. pinea pycnidia. Pycnidia from cones and shoots were placed on potato dextrose agar (PDA) and incubated at 23°C. Three isolates were obtained from shoot and cone samples. Identification of the pathogen was based on morphological characteristics of the conidia and by PCR of the ITS region of nuclear rDNA. Colonies on PDA were woolly, whitish at first turning black, sometimes partly or entirely turning light gray. Micromorphological characteristics of the Diplodia isolates were similar to those described in (2): conidia width 18.4 μm (SD ± 2.8) (range 11 to 22 μm) × length 34.0 μm (SD ± 5.3) (range 20 to 41 μm) (n = 100). Conidia were at first hyaline, later becoming brown to dark brown, oblong ellipsoid, bicellular with a distinct septum. To confirm the identity of the isolates, genomic DNA was extracted and the internal transcribed spacer (ITS) region of the rDNA was amplified using primers ITS1 and ITS4 (4). Amplicons were 483 bp in length (GenBank Accession No. KF372874) and shared 98% nucleotide identity with HM100285.1 and 97% nucleotide identity with JX981458.1 of D. pinea. Inoculation tests were performed on 2-year-old P. menziesii seedlings by placing mycelial plugs of three isolates obtained from pycnidia on the main stem after wounding with a cork borer. Control seedlings were inoculated with PDA plugs without mycelium. All seedlings were incubated at 24°C for 3 weeks in a climate chamber. Following incubation, the seedlings displayed dark brown-to-black discoloration, measuring on average 10.7 ± 0.6 cm, of the bark and wood tissues around the inoculation points on the stems. The pathogen was successfully re-isolated from symptomatic stem tissues, thus fulfilling Koch's postulates. To our knowledge, this is the first report of P. menziesii as a host of D. pinea in Turkey. P. menziesii is not endemic to Turkey and to date has a limited distribution (approximately 140 ha), but it is an important fast growing tree species for new industrial plantations.

Culture-independent detection and quantification of Fusarium circinatum in a pine-producing seedling nursery

The primary symptoms associated with Fusarium circinatum infection in pine seedling nurseries are root and collar rot, shoot and tip die-back and seedling mortality. Management of this pathogen in nurseries usually involves the integration of various strategies relating to sanitation, insect control and fungicide treatment. The overall goal of this study was to use quantitative real-time PCR (qPCR) to detect and quantify the airborne inoculum of F. circinatum in a commercial pine seedling nursery. For this purpose, an existing qPCR method was optimised and evaluated for its efficacy to quantify and monitor airborne conidia over a one-year period. Results showed that F. circinatum occurred at relatively low levels in the nursery throughout the year and that its distribution was spatially sporadic. The data suggest that standard nursery sanitation practices in the test nursery maintained the airborne inoculum of F. circinatum at low levels. The uneven distribution of infection also suggests that airborne inoculum does not represent the primary source of inoculum for the F. circinatum-associated seedling disease.

Molecular Cloning and Characterization of a Group II WRKY Transcription Factor fromJatropha curcas, an Important Biofuel Crop

The WRKY family of transcription factors (TFs) play an intricate role in regulating the stress signaling pathways by autoregulation or may be by cross regulation through interaction with other proteins. Although WRKY TFs are considered to be plant specific, however, their presence has been reported from unicellular algae, slime mould, and gymnosperms. We have isolated the JcWRKY cDNA from an important biofuel crop Jatropha curcas growing in the wastelands of India. The JcWRKY gene has an ORF of 693 bp and encodes a 230 amino acids protein with estimated molecular mass of 25.25 kDa. JcWRKY shows close homology to FaWRKY1 and St-WRKY1. The JcWRKY contains seven potential phosphorylation sites, which might be involved in regulating its function. The transcript analysis revealed that the JcWRKY transcript gets upregulated in response to salinity, dehydration, salicylic acid (SA), methyl jasmonate (MeJa), and collar rot fungus Macrophomina. However, maximum expression is observed under SA, highlighting its role in enhancing systemic acquired resistance for disease tolerance. The JcWRKY recombinant protein showed binding to W-box of pathogenesis related-1 (PR-1) and iso1 (encoding isoamylase1) promoters. Overexpression of JcWRKY in Escherichia coli enhanced the growth of cells in NaCl, KCl, mannitol, sorbitol, SA, and MeJa treatments, indicating that it protects and promotes growth under ionic, osmotic, and chemical stresses. The enhancement in growth can be due to the regulation of stress responsive genes. Therefore, it can be used as an important gene for enhancing abiotic and biotic resistance in plants and to facilitate faster growth of E. coli cells under stress conditions for efficient expression.

Silver nanoparticles, a potential alternative to conventional anti-fungal agents to fungal pathogens affecting crop plants

Metallic silver nanoparticles have been reduced from silver nitrate by employing the extracellular enzymatic machinery of edible White button Mushroom (Agaricus bisporus). The physical properties of these particles, size and shapes have been determined using techniques like TEM, FTIR and XRD and were reported in our earlier report. But, what stands of paramount importance in the present context is the ability of these nanoparticles to successfully combat and nullify the pathogenic fungal strains affecting crop plants. Our study has shown that these silver nanoparticles are successful antifungal agents and can replace the conventional antifungal synthetic chemicals as we tested their efficacy against different rot causative fungi in ground nut. The experimental pathogenic fungi include Stem rot causing diseases Sclerotium rolfsii, Dry root rot causing Rhizoctonia bataticola, Collar rot causing Aspergillus niger in agricultural plants.

Biological inductions of systemic resistance to collar rot of peppermint caused by Sclerotium rolfsii

The efficacy of eight fungal and eight bacterial isolates was tested for their ability to inhibit the growth of Sclerotium rolfsii, the causal agent of collar rot of peppermint. In vitro studies revealed that Trichoderma harzianum (THA) and Pseudomonas fluorescens (PFM) showed the highest inhibition of mycelial growth (68.28; 74.25 %) of S. rolfsii. The antagonists T. harzianum and P. fluorescens were compatible with each other and they were tested alone and together in in vivo for the control of S. rolfsii. Besides, the induction of defense-related enzymes such as peroxidase, polyphenoloxidase, phenylalanine ammonia-lyase, and the accumulation of phenolics in peppermint plants due to the application of bioagents were also studied. Combined application of talc-based formulation of bioagents and challenge inoculation with S. rolfsii recorded maximum induction of defense-related enzymes, and accumulation of phenolics as compared with individual application. This study suggests that the increased induction of defense-related enzymes (two- to threefold) and phenolic content (threefold) due to the combination treatment of bioagents might be involved in the reduction of collar rot incidence.

First Report of Phytophthora plurivora Causing Collar Rot on Common Alder in Spain.

Phytophthora decline of riparian alder (Alnus spp.) has been reported in several European countries (2). Death of common alder (Alnus glutinosa) due to Phytophthora alni has also been reported in Spain (4). During several surveys of alder trees in September 2012, typical dieback symptoms, including sparse small yellowish foliage and the presence of rusty exudates on the bark at the collar and lower stem were observed in A. glutinosa growing on the banks of the river Tera (Langa de Duero, Soria, 41°36'34″ N, 3°25'10″ W, elevation 851 m) and the river Tormes (La Maya, Salamanca, 40°41'42″ N, 5°35'36″ W, elevation 833 m). Bark samples plus cambium were taken from the active lesions at collar region, cut into small pieces, dried on filter paper, and plated on V8-PARPH agar (2). The samples were incubated for 4 days at 20°C in the dark before obtaining the Phytophthora isolates. Colonies developed on V8 juice agar (V8A) had limited aerial mycelium at the center and displayed radiate and slightly chrysanthemum-like growth pattern. Mycelial growth was optimal at 25°C (radial growth rate, 8.2 mm d-1), whereas no growth was observed at 32°C. Isolates were homothallic with paragynous antheridia, smooth-walled spherical (very rarely elongated) oogonia (22.8 to 30.6 μm diam.) and both plerotic and aplerotic golden brown oospores (21.3 to 28.5 μm diam.). In non-sterile soil extracts, the isolates produced abundant sporangia (31.5 to 57.2 × 21.3 to 38.4 μm; length:breadth ratio 1.2 to 1.6) borne terminally on unbranched or sympodial sporagiophores, occasionally attached laterally to the sporangiophores. Sporagia were non-caducous, semipapillate, mainly ovoid and obpyriform, obovoid to limoniform but sometimes distorted with two apices. On the basis of the morpho-physiological features, the isolates resembled P. plurivora (formerly identified as P. citricola) (3). To confirm this, genomic DNA was extracted and subjected to PCR. The internal transcribed spacer (ITS) region of the rDNA was amplified using the ITS-6 (5' GAAGGTGAAGTCGTAACAAGG 3') and ITS-4 (5' TCCTCCGCTTATTGATATGC 3') primers before sequencing (Secugen, Madrid, Spain). The sequences were deposited in the EMBL/GenBank database (Accession Nos. KF413074 and KF413075). In order to perform the pathogenicity test, 10 A. glutinosa seedlings (2 years old) per isolate were inoculated by using the under-bark inoculation technique (1) and 10 control seedlings were inoculated with V8A. Seedlings were incubated in a growth chamber at 22.5°C with a 14-h photoperiod. Three months after inoculation, all inoculated plants wilted and died, whereas the control plants showed no disease symptoms. To fulfill Koch's postulates, the pathogen was re-isolated from the necrotic lesions developed around inoculation points, thus confirming its pathogenicity. P. plurivora has been found to be present in rhizosphere soil beneath Alnus spp. and to cause aerial canker and collar rot on alder trees in Austria, Germany, and Romania (2,3). Further studies and surveys are essential to determine the distribution, extent of damage, and potential interactions with other alder pathogens (e.g., P. alni). To our knowledge, this is the first record of P. plurivora affecting A. glutinosa in Spain.

Management of collar rot of bell pepper (Capsicum annuum L.) by extracts and dry biomass of Coronopus didymus shoot

Bioassays were performed to assess the potential of Coronopus didymus for managing collar rot disease of bell pepper, caused by Sclerotium rolfsii. In laboratory bioassays, methanolic shoot extract of C. didymus was partitioned with n-hexane, chloroform, ethyl acetate and n-butanol. Concentrations from 3.125 to 200 mg ml− 1 of each fraction were evaluated against the target fungal species. All concentrations of the ethyl acetate fraction gave complete inhibition of fungal growth. Thin layer chromatography of the ethyl acetate fraction yielded two unidentified compounds 1 and 2 with Rf values of 0.531 and 0.787, respectively. Antifungal activity of these compounds was assessed using the minimum inhibitory concentrations (MICs) technique. Mancozeb was used as a reference compound. Compound 2 was found to be highly effective against S. rolfsii with MIC value 7.81 μg ml− 1 which was at par with the MIC of mancozeb. In a pot trail, dried powdered shoots of C. didymus were mixed at 1%, 2% and 3% (w/w) in soil already inoculated with the target fungal pathogen. A negative control with no fungal inoculation or soil amendment and a positive control with S. rolfsii inoculation but no soil amendment were also included. The treatment with 3% soil amendment significantly suppressed the collar rot disease. There was 50% and 13% disease incidence and mortality, respectively, with 3% treatment compared with 91% and 40%, respectively, in the positive control. This study suggests that collar rot of bell pepper can effectively be managed by exploiting the antifungal potential of C. didymus.

Phylogeny, identification and pathogenicity of the Botryosphaeriaceae associated with collar and root rot of the biofuel plant Jatropha curcas in Brazil, with a description of new species of Lasiodiplodia

The global expansion of cultivation areas of Jatropha has contributed to the emergence of various diseases. Currently in Brazil, the occurrence of a new disease has been reported that not only reduces the productivity but also causes the death of Jatropha. This disease is associated with collar and root rot of plants. From morphological and phylogenetic studies (based on Internal Transcribed Spacers, β-tubulin and Translation Elongation Factor 1-α sequences), nine species of Botryosphaeriaceae were identified. These species include Lasiodiplodia egyptiacae, L. pseudotheobromae, L. theobromae, Macrophomina phaseolina, Neoscytalidium hyalinum and four Lasiodiplodia spp. that are proposed as new species (L. euphorbicola, L. jatrophicola, L.macrospora and L. subglobosa). All the species in this study, except M. phaseolina, are pathogenic. The results show that root rot of physic nut plants is caused by complex pathogens. This study provides new information for future studies of disease management, quarantine programs and, especially, the development of resistant varieties for collar and root rot disease in J. curcas.

First report of collar and root rot caused by Phytophthora hedraiandra on Viburnum in the UK

Viburnum is a popular shrub grown mainly for its flowers, fragrance, berries, autumn colour, and it is also used as a hedge. In 2011, samples of Viburnum showing symptoms of collar and root rot collected in North Yorkshire (RHS166247) were…

Techniques for screening of chickpea genotypes against collar rot, its management through host plant resistance and fungicides

The experiments were conducted during 2009 and 2010 to find out the most effective screening techniques for identifying host plant resistance against chickpea collar rot caused by Sclerotim rolfsii in pot house. Out of four techniques employed, chickpea ‘grain inoculation techniques’ was found best. The minimum post emergence mortality (6.7%) occurred at 4.0 percent concentration of Pyraclostrobin which is significantly relatively less in comparison to control (26.8%) during the two consecutive year of testing. Among 88 chickpea desi genotype GNG 1958 was found resistant to disease whereas , 13 entries viz., NDG 9-21, PG 97030, BG 3004, JG 14-11, H 04-68, PG 054, BGD 1058, GJG 0724, RSG 931, JG1307, GJG 0504, JG 14-110, H05-24 were moderately resistant. Among Kabuli types, two entries i.e GNG 1969, BG 2086 were resistant and 9 as moderately resistant (IPCK 2005-23, Phule G 0027, JGK 2003-304, IPCK 02, BG 3001, MNK 1, BG 3000,Vihar, HK 06-168).

Physiological studies of Sclerotium rolfsii Sacc. causing collar rot of peppermint

In vitro studies were conducted on the effect of temperature, pH levels, carbon, nitrogen and amino acids on the mycelial growth and biomass production of Sclerotium rofsii Sacc. causing collar rot of mint. The results reveal that the growth of S. rolfsii was maximum at 30°C which was reduced significantly below 20°C and above 35°C. Of the pH levels tested, acetic pH (5.0) produced maximum mycelial dry weight which was followed by exposing the pathogen to pH 6.0. Among the nine carbon sources tested, sucrose recorded the maximum mycelial growth and dry weight of S. rolfsii, while peptone was the best among the nitrogen sources and tryptophane and phenylalanine was the best amino acids on the mycelial growth and biomass production of S. rolfsii. Key words: Sclerotium rolfsii, pH, mint, collar rot, nutritional studies, temperature.

FIRST REPORT OF APPLE COLLAR ROT INCITED BY SCLEROTIUM ROLFSII IN TUNISIA

Sclerotium rolfsii Sacc. [teleomorph Athelia rolfsii (Curzi) Tu et Kimbrough] is a soil- borne polyphagous phytopatho- genic fungus characterized by prolific growth and ability to produce persistent sclerotia. In Tunisia, S. rolfsii has al- ready been reported on potato (Daami-Remadi et al., 2007) and olive (Boulila, 2001). In spring 2012, a sudden death of 2-year-old apple trees (Malus domestica) cv. Royal Gala grafted on MM106 rootstock was observed in an orchard near Tunis showing leaf chlorosis, root and collar rot. Isola- tions from necrotic wood on PDA medium, yielded consis- tent white fungal colonies, producing only sclerotia and no fruiting bodies or spores. Based on morphological charac- teristics, the fungus was tentatively identified as Sclerotium sp., then confirmed by sequencing the ITS region of rDNA. The obtained sequence (accession No. KF021301) matched the sequence of Athelia rolfsii (ATCC 201126). A pathoge- nicity test was performed on 2-year-old grafted apples of cv. Royal Gala in a glasshouse at 25-28°C and 80% relative hu- midity. Mycelial plugs of S. rolfsii were inoculated into the basal stem of 10 plants, whereas an equal number of non inoculated plants served as controls. Symptoms like those observed in the field developed in inoculated plants, but not in the controls, 35 days post inoculation. S. rolfsii was consistently re-isolated from infected wood tissues fulfill- ing Koch’s postulates. Apple collar tot (ACR) was originally described as apple southern blight in the USA and has also been reported in India, China, Israel and Italy (Corazza et al., 1999). To our knowledge this is the first report of ARC in Tunisia. The Tunisian Apple industry is mostly grown on MM106 rootstocks, and therefore, ACR represents a serious threat.

Characterization of a bacterial collar and rhizome rot of banana (Musa paradisiaca) caused by strains of Erwinia chrysanthemi pv. paradisiaca

A serious collar and rhizome rot disease of banana was observed in the north region of Maharashtra state in post rainy season. The disease was caused by the bacterial strains of Erwinia chrysanthemi pv. paradisiaca identified and characterized by morphological, physiological, biochemical and pathogenicity tests. The infection occurred on new banana plantation of one month old in poorly drained soil. In post rainy season, banana plantations of 8 to 10 weeks were found severely infected. E. chrysanthemi pv. paradisiaca produced soft rot symptom onhealthy banana rhizomes within three weeks. Two strains were isolated from the collar and rhizome rotted diseased samples which were similar in morphological, physiological and biochemical characteristics, however they differed in the virulence aggressiveness to cause the disease in banana. Strain II caused soft rot symptoms within 19 days, however strain I produced it within 23 days of inoculation with suspension of 3×108 CFU ml-1. The result of this study revealed that strain II was more aggressive as compared to strain I of E. chrysanthemi pv. paradisiaca.