Cohort Of Faculty Research Articles

Diversity in Otolaryngology Residency Programs: A Survey of Otolaryngology Program Directors.

Objective As the population of the United States becomes increasingly racially and ethnically diverse, it is important that the medical profession reflect these changes. Otolaryngology has previously been identified as one of the surgical subspecialties with the smallest presence of those underrepresented in medicine. In the context of this study, the term underrepresented in medicine is defined as blacks, Latinos, Native American, and Native Hawaiians. The purpose of this study was to describe the current state of otolaryngology residency programs in terms of diversity of resident and faculty cohort, explore general interviewing practices, and investigate recruitment of underrepresented in medicine applicants. Study Design Survey via electronic questionnaire. Setting Academic otolaryngology residency programs. Subjects and Methods A 14-item survey was distributed to 105 program directors asking them to consider their program's past 15 years of existence. Results With a response rate of roughly 30%, we found that over one-third of responding programs had matriculated 1 or fewer underrepresented in medicine residents. There was a statistically significant association between the number of underrepresented in medicine faculty and the number of underrepresented in medicine residents matriculated ( P = .02). Conclusion The authors stress the importance of underrepresented in medicine faculty mentorship. Although not statistically significant in this study, increasing the number of underrepresented in medicine applicants interviewed, as well as recommending outreach programs, may help to improve underrepresented minority matriculation into residency programs as demonstrated in the literature.

The End of Concern: Maoist China, Activism, and Asian Studies by Fabio Lanza

Reviewed by: The End of Concern: Maoist China, Activism, and Asian Studies by Fabio Lanza Maggie Clinton Fabio Lanza. The End of Concern: Maoist China, Activism, and Asian Studies. Durham, NC: Duke University Press, 2017. 262 pp. $94.95 (cloth), $25.95 (paper). In what ways do the trenchant critiques generated by the 1968-founded Committee of Concerned Asian Scholars (CCAS) speak to our present historical moment? How did the activism of a "concerned" cohort of graduate students and junior faculty, galvanized by China's Great Proletarian Cultural Revolution and US-wrought carnage in Vietnam, reshape the field of East Asian (especially China) studies in the United States? How did the efforts of these young activist-scholars to "take Maoism seriously" dovetail with those of their Maoist contemporaries in France, and what can the comparatively deeper French engagement with Marxism tell us about the limits of CCAS analyses? These are among the many questions raised by Fabio Lanza's provocative new book, The End of Concern: Maoist China, Activism, and Asian Studies. Lanza's thoughtful examination of the formation, dissolution, and afterlives of the CCAS and its Bulletin of Concerned Asian Scholars sheds vital light on an important US New Left intervention and constitutes necessary reading for scholars of modern China and the global 1960s. The book's introduction and four chapters examine the decade-long existence of CCAS, from its 1968 founding through its 1970s demise amid the "Thermidor" of the Deng Xiaoping era and the waning of antiwar activism. To reconstruct the organization's history, Lanza carefully mined CCAS archives and publications; he also conducted interviews with former CCAS members, including John Berninghausen, Saundra Sturdevant, and Marilyn Young (Sturdevant and Young both passed away before the book was published). Each chapter illuminates a set of concerns articulated by these "concerned scholars" and relates them to the structuring conditions that rendered their articulation possible in the first place. Lanza makes clear from the start that "to both concerned scholars and French radicals, Maoism had configured itself as a theory that found expression and realization in localized practice, not as a set of rules to follow, nor as a model that could be exported and replicated" (27). He underscores that the era's Maoist sympathies should be attributed not merely to youthful naïveté or to an orientalism now dressed in revolutionary garb but to a newly shared political horizon. Maoism "traversed the sixties" as a means for reflecting on and transforming differing yet intertwined sets of historical circumstances (5). To understand the emergence and dissolution of CCAS (which was not a Maoist organization), Lanza insists that we must consider it in relation to the abrupt opening and then equally abrupt reconfiguration of this shared political horizon. Chapter 1, "America's Asia," examines how the graduate students who founded CCAS in 1968 linked the American war in Vietnam to the "ideological blinders" of reigning authorities in the field of Asian studies, that is, to professors including John King Fairbank under whose direction they were pursuing PhDs. McCarthyist purges of the 1950s not only had drained the field of critical thought but also had facilitated the rise to prominence of scholars seemingly unconcerned about the ways in which their scholarship lent itself to anti-Communist war making. CCASers came to insist that "new intellectual production based on a humane approach to Asian people (i.e., on the political foundation of equality) required . . . the dismantling of the assumption of objectivity and neutrality behind the existing structure of learning and the unveiling of the political character of that assumption, in the name of politics" (53). Lanza explores this "humane approach" from [End Page E-27] another angle in chapter 2, highlighting how this approach was enabled by "one of the perceived, declared, and probably unrealized possibilities of the 1960s: the capacity of the oppressed to speak for themselves, denounce their oppression, and subvert the mechanisms of domination" (70). Further emboldened by the ways in which China's Cultural Revolution was upending entrenched hierarchies of knowledge and power, CCASers confronted what they perceived to be gulfs between academia and activism in their contemporary US context. Here, Lanza also illuminates the sharp...

The associations between adenosine triphosphate binding cassette subfamily G member-2 single nucleotide polymorphism and hyperuricemia in a Chinese tertiary hospital faculty cohort

Objective: To investigate gender specific association between single nucleotide polymorphism rs2231142 and hyperuricemia. Method: A matched case-control study was conducted in a faculty cohort of a tertiary hospital in Beijing. The enrollment criteria were faculty member of the hospital with signed consent. The exclusion criteria were tumor, previous renal diseases, renal function damage, pregnancy, currently taking medicines that could increase or decrease serum uric acid level, and those who had gout. Males with serum uric acid>416.4 μmol/L and females with serum uric acid> 359.6 μmol/L were enrolled as hyperuricemia group. Subjects with normal serum uric acid were randomly enrolled at 1∶2 ratio after matching for gender, age, renal function and body mass index. Rs2231142(C>A) was assayed by amplification refractory mutation system polymerase chain reaction, with common forward primer: 5' GGCTTTGCAGACATCTATGG 3', C specific reverse primer: 5'CGAAGAGCTGCTGAGAAATG 3', and A specific reverse primer: 5' CGAAGAGCTGCTGAGAAATT 3'.Association between rs2231142 and hyperuricemia was analyzed in the general study group, as well as different gender and age groups. Results: A total of 198 subjects with hyperuricemia and 370 controls were enrolled. The A allele frequency of rs2231142 was significantly higher in the hyperuricemia group than control group (38.38% vs 26.62%, P<0.001), with an OR for hyperuricemia of 2.89 (95%CI 1.91-4.37, P<0.001). After adjustment for hypertension, hyperglycemia and dyslipidemia, the OR was 2.99 (95%CI 1.94 - 4.62, P<0.001). Subgroup analysis showed that the ORs were 3.83 (95%CI 2.03-7.24, P<0.001) in male and 2.30 (95%CI 1.32-4.00, P=0.003) in female. In those 55 years or older, the gender differences of ORs were decreased, with ORs of 3.23 (95%CI 1.02-10.29, P=0.047) in male and 3.06 (95%CI 1.37-6.84, P=0.006) in female. While in those less than 55 years, the gender differences of ORs were enlarged, with ORs of 4.11 (95%CI 1.92-8.79, P<0.001) in males and 1.73 (95%CI 0.80-3.76, P=0.165) in females. Interaction study between gender and rs2231142 did not reach significant level in both the gender group and two age groups. Conclusion: Single nucleotide polymorphism rs2231142 A allele is an independent risk factor for hyperuricemia in this tertiary hospital faculty cohort. The ORs are higher in male than those in female, especially in those less than 55 years old.

Perceived Importance of Pursuing Osteopathic Recognition in the Single Accreditation System: A Survey of Medical Students, Residents, and Faculty

As graduate medical education evolves under the single accreditation system, osteopathic residency programs and consortia strive for sustainable ways to achieve and support the Osteopathic Recognition (OR) designation. To determine whether differences existed in perceived importance of OR from 3 cohorts of osteopathic stakeholders: students, residents, and faculty. A nonexperimental quantitative cross-sectional online survey was administered during February and March 2016 to osteopathic medical students at Michigan State University College of Osteopathic Medicine and residents and faculty from the affiliated Statewide Campus System. After examining final working dataset patterns, a series of Kruskal-Wallis tests were conducted to identify statistically significant differences in perceived OR importance response categories across sample subgroups, including program specialty and primary vs non-primary care specialty. The final analytic sample comprised 278 osteopathic medical students, 359 residents, and 94 faculty members. Of 728 respondents, 497 (67.9%) indicated that OR was "somewhat important," "important," or "very important." The overall perceived importance category patterns varied significantly across students, residents, and faculty cohort respondents (, P<.001) and program specialty (, P<.001), as well as between primary care and non-primary care residents and faculty (, P<.001). Based on these initial results, OR is generally valued across osteopathic stakeholder groups, but significant differences may exist between different types of students, residents, and faculty. Pre- and postgraduate educational support structures designed to reduce barriers to OR implementation may help to sustain osteopathic principles and practice in the single accreditation system.

Boyer in the Middle: Second Generation Challenges to Emerging Scholarship

This article reports on an examination of the distinctive second-generation challenges and opportunities faced by an early institutional adopter of the Boyer model of scholarship. Following the first cohort of faculty to be reviewed for tenure and promotion based on these criteria, we report the results of a survey designed to determine the perceptions of faculty and administrators of the degree to which emerging forms of scholarship had been integrated into the university culture including factors such as institutional identity, support structures, and faculty participation. This case study sheds light on the process of adaptation at this single institution and provides glimpses of how cultural change might occur across higher education.

Creation and validation of a simulator for corneal rust ring removal

ObjectiveTo create and validate a simulation model for corneal rust ring removal. MethodsRust rings were created on cadaveric eyes with the use of small particles of metal. The eyes were mounted on suction plates at slit lamps and the trainees practiced rust ring removal. An inexperienced cohort of medical students and first year ophthalmology residents (n=11), and an experienced cohort of senior residents and faculty (n=11) removed the rust rings from the eyes with the use of a burr. Rust ring removal was evaluated based on removal time, percentage of rust removed and incidence of corneal perforation. A survey was administered to participants to determine face validity. ResultsTime for rust ring removal was longer in the inexperienced group at 187±93 seconds (range of 66-408 seconds), compared to the experienced group at 117±54 seconds (range of 55-240 seconds) (p=0.046). Removal speed was similar between groups, at 4847±4355 pixels/minute and 7206±5181 pixels/minute in the inexperienced and experienced groups, respectively (p=0.26). Removal percentage values were similar between groups, at 61±15% and 69±18% (p=0.38). There were no corneal perforations. 100% (22/22) of survey respondents believed the simulator would be a valuable practice tool, and 89% (17/19) felt the simulation was a valid representation of the clinical correlate. ConclusionThe corneal rust ring simulator presented here is a valid training tool that could be used by early trainees to gain greater comfort level before attempting rust ring removal on a live patient.

INTRAOPERATIVE IMAGE NAVIGATION: EXPERIMENTAL STUDY OF THE FEASIBILITY AND SURGEON PREFERENCE BETWEEN A STERILE ENCASED NINTENDO WIITM REMOTE AND STANDARD WIRELESS COMPUTER MOUSE.

Diagnostic imaging plays an important role in the operating room, providing surgeons with a reference and surgical plan. Surgeon autonomy in the operating room has been suggested to decrease errors that stem from communication mistakes. A standard computer mouse was compared to a wireless remote-control style controller for computer game consoles (Wiimote) for the navigation of diagnostic imaging studies by sterile personnel in this prospective survey study. Participants were recruited from a cohort of residents and faculty that use the surgical suites at our institution. Outcome assessments were based on survey data completed by study participants following each use of either the mouse or Wiimote, and compared using an analysis of variance. The mouse was significantly preferred by the study participants in the categories of handling, accuracy and efficiency, and overall satisfaction (P <0.05). The mouse was preferred to both the Wiimote and to no device, when participants were asked to rank options for image navigation. This indicates the need for the implementation of intraoperative image navigation devices, to increase surgeon autonomy in the operating room.

Poetry and Place in Hawai'i: Notes from a Writer and Resident

Poetry and Place in Hawai'iNotes from a Writer and Resident Eric Paul Shaffer (bio) Ke One Hānau In Hawaiian, ke one hānau (pronounced "kay owe-nay HA-now") means the sands of one's birth, or one's birthplace. In the islands, connection to place and one's status as native is perhaps more important than it is everywhere else.1 In Hawai'i, more than anywhere else, I have been faced with the truth of my own particular existence. I am a native of nowhere. I have no hometown, no native sands, no place I can legitimately claim as my own, my home. From the moment I was born I've been moved or moving throughout the United States and the world. As far as I know my heritage is a mix of dim and mongrel origins. The most easily identified strain is Irish with a smattering of Scotch (in every sense) and German. My ancestors were eager to strip themselves of the tongues, troubles, and trappings of the homelands they escaped, and they never looked back. To honor them, and because I don't care where I or my family or anyone else is from, I don't look back either. Like my ancestors, I care only and exclusively for where I am, for where I am is who I am. Also, perhaps as a further consequence of all that migration, my father was a rainbow chaser, pursuing every real or imagined new opportunity. Neither of my parents ever liked, let alone knew or loved, the places they were born, and neither saw reason to explore or embrace a place when they might be a thousand miles away from their present abode in one, two, or five years. Like most Americans and twentieth-century denizens, my parents were economically disenfranchised both from the land of the United States and whatever lands their ancestors acknowledged as their origins so long ago that [End Page 277] they did not remember or care. There was a mild touch of patriotism (both were Air Force veterans), but only as loyalty to a nation, not to the actuality of the land. For them, history was over, land was dirt, and money was required for mortgages, food, and raising children. For better or worse, I am an American, I reside in the islands of Hawai'i, and now is the only moment.2 Rootlessness is a fact of my existence, yet surprisingly, that fact compels me to set down roots quickly. Every time I arrive, I learn about my new place. Without a home, I make myself at home where I live by becoming as knowledgeable about my surroundings as I can. As a resident, I study the geography, wildlife, culture, and language. As a writer, I read the local literature to get a sense of the community of writers I hope to join. As I read, I am "grounding" myself, learning about local issues, imagery, concerns, culture, and history, and I begin to write and speak about where I am. Grounding, in the sense of learning what natives know of a place, informs my teaching as well. As part of a Title III grant to Honolulu Community College, a faculty-training program called Ho'āla Hou has been initiated in order to create a sense of place for our students at the college and to help instructors to incorporate culture and place-based learning into our courses.3 I am a member of Ka Papa 'Olani, the second cohort of faculty to undergo this year-long program. Members focus on the history and location of Honolulu Community College on the mokupuni (island) of O'ahu, in the moku (district) of Kona, in the ahupua'a (mountain-to-sea land division) of Kapālama, and in the 'ili (smaller local district) of Niuhelewai. We incorporate into our courses knowledge of the land and local geographic features, such as the hundreds of capped springs beneath the campus, the dredged Kapālama Canal to the west (once a stream), and Lo'i Kalo (taro patch) Park to the north. In our cohort, we work to understand how water in, on, and of...

ACS hosts new faculty workshop

More than 70 first-, second-, and third-year faculty from 58 institutions gathered at the American Chemical Society’s headquarters building in Washington, D.C., on Aug. 4–6 for the Cottrell Scholars Collaborative New Faculty Workshop. During the workshop, faculty facilitators provided guidance on teaching, running a research lab, and managing the many responsibilities required of new faculty. Now in its fifth year, the workshop builds a cohort of young faculty who will continue to interact through monthly webinars supported by the ACS Education Division. This year, the program expanded to include faculty from both research-intensive and primarily undergraduate institutions. “Starting a new faculty position is a stressful time for most people. It entails a lot of new responsibilities and a number of tasks for which we simply are not trained in graduate school,” says Andrew Feig, cofounder of the workshop and a chemistry professor at Wayne State University. “The CSC New Faculty

Cross-Cultural Interprofessional Faculty Development in Japan: Results of an Integrated Workshop for Clinical Teachers

BackgroundFaculty development programs, studied both home and abroad, have been shown to be helpful for enhancing the scholarly and academic work of nonacademic clinicians. Interprofessional education and faculty development efforts have been less well studied. This project investigated the effect of a well-studied faculty development program applied in an interprofessional fashion across health profession educators in medicine and nursing. MethodsA faculty cohort of nurse and physician educators at The University of Tokyo underwent training in the Stanford Faculty Development Center (SFDC) model of clinical teaching through a sequence of 7 workshops. The workshops were performed in English with all materials translated into Japanese. A validated, retrospective pretest and posttest instrument was used to measure study outcomes on global assessment of teaching abilities and specific teaching behaviors (STBs) at 1 and 12 months after intervention. Successful completion of Commitment to Change statements were also assessed at 12 months. ResultsIn total, 19 faculty participants completed the study. All participants found the workshops valuable. For global assessment, significant improvement in self-reported teaching abilities was seen comparing the mean pretest scores of 27.26 (maximum score = 55, standard deviation [SD] = 8.61) with mean scores at both 1 month (36.81, SD = 7.48, P < 0.001) and at 1 year (34.67, SD = 7.32, P < 0.001). For STBs, significant improvement was also seen comparing the mean group pretest score of 82.11 (maximum score = 145, SD = 15.72), to the posttest mean score of 111.11 (SD = 14.48, P < 0.001) and the 1-year mean score of 103.76 (SD = 12.87, P < 0.001). In total, 27/42 Commitment to Change statements were successfully completed at 1 year. ConclusionsFaculty development for improving clinical teaching can be performed across the cultures of medicine and nursing, as well as across the cultures of the United States and Japan.

The Center for Inquiry: Anatomy of a Successful Progressive School

Describes the work of the Center for Inquiry Schools in Indianapolis, Indiana. Authors Leland, Wackerly, and Collier were part of the original cohort of teachers and university faculty who founded a progressive magnet school. Premised on inquiry-based teaching and learning, the Center for Inquiry has grown from one to four schools.

Comprehensive Cocurricular Support Promotes Persistence of Community College STEM Students

ABSTRACTDespite good career prospects in science, technology, engineering, and mathematics (STEM) fields, persistence of students in STEM fields of study at the community college and transfer to universities to pursue STEM majors is often quite low. Theories of persistence emphasize the importance of engagement, integration, validation, and financial assistance. The DCCCD STEM Institute is a comprehensive cocurricular program for community college STEM students. It illustrates the application of persistence theories in a multicollege urban district with a diverse student body. The STEM Institute uses a student/faculty cohort model with mentoring, professional skills programming, and scholarship support to transform student perceptions of themselves, integrate them into a STEM educational community, and validate their membership within that community. Institute membership also reduces isolation and financial concerns as potential barriers to persistence. STEM faculty also participate in professional skill development through a cross-college and cross-disciplinary cohort. Data on students who participated in the DCCCD STEM Institute from 2010 through 2014 show that 92% remain in a STEM educational or career pathway. Important practice implications for community college professionals include (1) forming student and faculty cohorts, (2) facilitating the development of mentoring relationships, (3) providing adequate centralized staffing, and (4) integrating resources and opportunities into a unified cocurricular program.

Longitudinal Analysis of Gender Differences in Academic Productivity Among Medical Faculty Across 24 Medical Schools in the United States

To examine gender differences in academic productivity, as indicated by publications and federal grant funding acquisition, among a longitudinal cohort of medical faculty from 24 U.S. medical schools, 1995 to 2012-2013. Data for this research were taken from the National Faculty Survey involving a survey with medical faculty recruited from medical schools in 1995, and followed up in 2012-2013. Data included surveys and publication and grant funding databases. Outcomes were number of publications, h-index, and principal investigator on a federal grant in the prior two years. Gender differences were assessed using negative binomial regression models for publication and h-index outcomes, and logistic regression for the grant funding outcome; analyses adjusted for race/ethnicity, rank, specialty area, and years since first academic appointment. Data were available for 1,244 of the 1,275 (98%) subjects eligible for the follow-up study. Men were significantly more likely than women to be married/partnered, have children, and hold the rank of professor (P < .0001). Adjusted regression models documented that women had a lower rate of publication (relative number = 0.71; 95% CI = 0.63, 0.81; P < .0001) and h-index (relative number = 0.81; 95% CI = 0.73, 0.90; P < .0001) relative to men, but there was no gender difference in grant funding. Women faculty acquired federal funding at similar rates as male faculty, yet lagged behind in terms of publications and their impact. Medical academia must consider how to help address ongoing gender disparities in publication records.

Seven faculties in search of a mission: A proposed interdisciplinary course on water literacy

ABSTRACTIn this article we will describe the development of an interdisciplinary general education course focusing on water. As part of a faculty cohort charged with teaching and studying this topic, we considered a number of projects, including community outreach, teacher professional development, and collaborative research. We decided on an interdisciplinary course after examining the relevant issues and recognizing numerous sources of water expertise available within our region.

Scholarly research productivity is not related to higher three-year licensure pass rates for physical therapy academic programs.

BackgroundIn the domain of academia, the scholarship of research may include, but not limited to, peer-reviewed publications, presentations, or grant submissions. Programmatic research productivity is one of many measures of academic program reputation and ranking. Another measure or tool for quantifying learning success among physical therapists education programs in the USA is 100 % three year pass rates of graduates on the standardized National Physical Therapy Examination (NPTE). In this study, we endeavored to determine if there was an association between research productivity through artifacts and 100 % three year pass rates on the NPTE.MethodsThis observational study involved using pre-approved database exploration representing all accredited programs in the USA who graduated physical therapists during 2009, 2010 and 2011. Descriptive variables captured included raw research productivity artifacts such as peer reviewed publications and books, number of professional presentations, number of scholarly submissions, total grant dollars, and numbers of grants submitted. Descriptive statistics and comparisons (using chi square and t-tests) among program characteristics and research artifacts were calculated. Univariate logistic regression analyses, with appropriate control variables were used to determine associations between research artifacts and 100 % pass rates.ResultsNumber of scholarly artifacts submitted, faculty with grants, and grant proposals submitted were significantly higher in programs with 100 % three year pass rates. However, after controlling for program characteristics such as grade point average, diversity percentage of cohort, public/private institution, and number of faculty, there were no significant associations between scholarly artifacts and 100 % three year pass rates.ConclusionsFactors outside of research artifacts are likely better predictors for passing the NPTE.

Mapping Norms of Academic Integrity as an Aid to Proactive Regulation

This study investigates whether it is possible to map norms of professionalism among medical student and faculty cohorts. The purpose is to provide ongoing information regarding the validity of this approach in multiple settings both within the United Kingdom (UK) and internationally. Its methodology is based on the Dundee Polyprofessionalism Inventory I: Academic Integrity, which solicits recommended sanctions as an indication of the severity with which particular lapses are regarded. The inventory was administered to cohorts in the UK, and results were compared with previously reported results from Saudi Arabia, Pakistan and Egypt. There are a great number of similarities — or congruence — between staff and students within institutions and also across institutions (and indeed countries). However there are also a number of areas in which there are notable differences between median sanctions suggested by staff and students for particular “lapses.” There are fewer areas in which there are greater than two levels of difference of median suggested sanction for students and staff across national boundaries (London and Scotland) or staff across the same national boundaries. The paper presents data from three UK schools and three other countries that indicate a broad base of congruence but also important inter-school and regional differences that may be a function of different national and ethnic cultures. The applicability of the resource needs to be further explored to confirm its usefulness as a tool in professionalism learning.

ARCHITECTURE AND HIGH PERFORMANCE BUILDING AT GEORGIA TECH: TEACHING DESIGN + TECHNOLOGY IN THE ENVIRONMENTAL CONTEXT

INTRODUCTION Integrative approaches to architectural design + environmental technology pedagogy are essential in educating future generations to respond to impending building energy use challenges. This paper will describe new approaches to incorporating building physics and building technology in the design studio via a diverse cohort of students and faculty, with strong emphasis placed on the development of innovative architectural strategies operating at the intersection of urban demographics, house and housing design, building performance, and sustainability. The United States Department of Energy reports that our buildings account for forty percent of all energy consumed nationally. Our focus on high performance buildings at the Georgia Tech College of Architecture aims to reduce that percentage and meet the rising demand for design and building performance professionals to evaluate the environmental impact of design decisions. Continuing a twenty-five-year trajectory of research leadership, Tech stu...

A facilitated peer mentoring program for junior faculty to promote professional development and peer networking.

To explore the design, implementation, and efficacy of a faculty development program in a cohort of early career junior faculty. Interested junior faculty members were divided into interdisciplinary small groups led by senior faculty facilitators. The groups met monthly for 1.5 hours to review a modular curriculum from 2011 to 2013. Using a survey at two time points (September 2011 and 2013) and an interim program evaluation, the authors collected data on participants' demographics, faculty interconnectedness, and self-reported knowledge, skills, and attitudes (KSA) in the domains of professional development and scholarship, including the ability to write career goals and align activities with those goals. A total of 104 junior faculty participated in the program. They demonstrated changes in self-reported KSA in the domains of professional development (P = .013, P = .001) and scholarship (P = .038, P = .015) with an increase in ability to write career goals (P < .001), ability to align activities with those goals (P < .001), and number of and amount of time spent pursuing activities related to those goals (P = .022). These changes were more significant among female faculty and were not affected by academic rank or time since last training. Interconnectedness among faculty increased during the period of study-the number of nodes and ties between nodes within the network increased. This facilitated peer mentoring program for junior faculty was effective in improving the KSA necessary to promote early career advancement and peer networking, especially for women.

Defining a Mismatch: Differences in Usage of Social Networking Sites Between Medical Students and the Faculty Who Teach Them

Background:Use of social networking sites (SNS) by medical students is increasing, and some students lack awareness of pitfalls arising from the intersection of social networking and medicine. Many institutions have developed guidelines on using SNS, but they are insufficient for students. Educators need new methods to train students on the appropriate use of this technology, but more information is needed before implementing change. Purposes: Differences in SNS usage between students and faculty were examined. The goal was to evaluate four content areas: SNS usage patterns, attitudes regarding activity on SNS, experience with patient interactions online, and awareness of institutional guidelines on use of SNS. Methods: A cross-sectional survey took place at Feinberg School of Medicine, Northwestern University, in 2012. Participants included all students and a cohort of faculty who teach them in a class on professionalism. Results: The response rate was 42% by students (300/711) and 78% by faculty (31/40). Of the students, 94% use SNS, compared to 48% of faculty. Students were more likely than faculty to display content they would not want patients to see (57% vs. 27%), report seeing inappropriate content on colleagues’ SNS profiles (64% vs. 42%), and ignore harmful postings by colleagues (25% vs. 7%). Faculty were more likely than students to have been approached by patients on SNS (53% vs. 3%). Most participants were unlikely to conduct Internet searches on patients. Conclusions: Students are more likely than faculty to use SNS and use it very differently than faculty. Students would benefit from training on appropriate use of SNS. Topics that should be addressed include editing one's online presence, managing friend requests from patients, dealing with colleagues who post harmful content, conducting Internet searches on patients, and discussion of boundaries to identify potential harms associated with SNS usage. Differences in usage between students and faculty raise questions if faculty are well suited to provide this training.

Knowing Common Misconceptions About Homeostasis Helps Students' Learning

Homeostasis is a core concept in physiology that students must understand and use as they learn physiology. When students enter a physiology course, they have commonly held ideas about homeostasis that may be inaccurate. If we instructors are aware of students' misconceptions, we can focus our teaching on helping the students correct their misconceptions. We conducted surveys and interviews of physiology students and a cohort of faculty at 2- and 4-year colleges, universities, and medical schools to identify common student conceptions about homeostasis. We wrote multiple-choice questions to assess the conceptual understanding and to diagnosis misconceptions that students have concerning homeostasis. The responses of thirty-one faculty members at a 2012 Human Anatomy and Physiology Annual Conference provided qualitative evidence of clusters of students' misconceptions. These clusters were similar to the misconceptions determined from our previous surveys and interviews. We aligned common clusters of student misconceptions with the conceptual framework we have developed about homeostasis. We will summarize some of the major trends, patterns, and findings that came from this alignment. We will present data about the connections between the challenges that make understanding homeostasis difficult and misconceptions. Supported by NSF DUE1043443.