Coat Protein Gene Sequences Research Articles

Generation of transgenic rootstock plum ((<i>Prunus pumila</i> L.×<i>P. salicina</i> Lindl.)×(<i>P. cerasifera</i> Ehrh.)) using hairpin-RNA construct for resistance to the Plum pox virus

The use of Prunus rootstocks that are resistant to plum pox virus (PPV) is an important agronomic strategy to combat the spread of the Sharka disease in nurseries and orchards. Despite remarkable progress in developing stone fruit rootstocks to adapt to various stresses, breeding that ensures durable virus resistance has not yet been achieved. For this reason, the engineering of PPV resistant plants through genetic transformation is a very promising approach to control sharka disease. The aim of the present study is to produce transgenic plants of the clonal rootstock `Elita`, which is resistant to PPV using ribonucleic acid interference (RNAi) technology. The genetic construct containing the self-complementary fragments of the Plum pox virus coat protein (PPV-CP) gene sequence were used to induce the mechanism of post-transcriptional gene silencing to ensure virus resistance. Transgenic plants have been produced after agrobacterium-mediated transformation of in vitro explanted leaves. The results of polymerase chain reaction (PCR) and Southern blotting analyses confirmed the stable genomic integration of the PPV-CP sense and antisense intronhairpin-RNA sequence. Th e functionality of the introduced expression cassette was confirmed by the activity of including the uidA gene into the transferring T-DNA. To our knowledge, this is the first interspecific plum rootstock produced by genetic engineering to achieve PPV resistance.

Use of the Plum pox virus coat protein gene sequence to create resistant forms of plum (Prunus domestica L.)

Plum pox virus (PPV), the causative agent of plum Sharka disease, is currently considered the most dangerous pathogen of apricots, plums and peaches. The transformation of plum with viral genes, such as coat protein, can provide novel virus resistant forms or gene resources for breeding new resistant varieties. For improving the plants resistance to Plum pox virus (PPV) two technologies were used. One based on co-suppression and another on RNA-silencing. Binary vector pCamPPVcp that contained the selective hpt gene and ppv-cp gene in sense-orientation (driven by double 35S promoter) was used for realization post-transcriptional gene silencing. Vector pCamPPVRNAi contained self-complementary fragments of gene ppv-cp (698bp) driven by double 35S promoter and the hpt and gus genes.The fragments of ppv-cp gene were separated by pdk-intron to produce a “hairpin” RNA structure in antisense-sense orientation. Seven independent transgenic lines with ppv-cp gene and five transgenic lines with a two inverted repeats of ppv-cp gene fragment were produced. Stable integration of genes into genome of plants was confirmed by PCR analyses. The accumulation of coat protein was evaluated by Western blot assay in five from six analyzed lines. The transgenic shoots were rooted and acclimatized to the greenhouse. After grafting by PPV infected buds in all control and ppvcp transformed plants were detected by Western blot analysis lines corresponding PPV coat protein, whereas no any spots corresponding PPV coat protein were observed in samples from plants transformed “hairpin” construct. These preliminary results confirmed the efficiency of RNAi strategy for protection plants from virus attack in general, and for stone fruits from PPV in particular.

Molecular evidence for the occurrence of Pumpkin yellows virus (PuYV), a new polerovirus species associated with pumpkin plants.

In India, cucurbit aphid-borne yellows virus, a cucurbit-infecting polerovirus, is emerging in the recent past with respect to its occurrence on different crops and geographical locations. This emphasized the need for an investigation to search for the possible occurrence of the other related species Polerovirus. In this view, different cucurbit hosts exhibiting severe chlorosis, bleaching, and yellowing symptoms were collected from the Vegetable Experimental Fields of IARI, New Delhi. The samples exhibiting yellowing and bleaching symptoms were associated with small isometric virions measuring ~ 25nm under transmission electron microscope. The RT-PCR assays using generic (covering the partial RdRp, intergenic region and partial CP region) andcomplete coat protein (CP) gene-specific primers confirmed the association of a polerovirus. Further, complete CP genesequence analyses revealed the association of a distinct species of Polerovirus with the pumpkin samples. These isolates showed the CP gene sequence identities below the species demarcation limit (90%) with the corresponding gene sequences of already reported polerovirus isolates. The results of this study provide the molecular evidence for the occurrence of a new species of Polerovirus, named tentatively as Pumpkin yellows virus (PuYV) in India.

Rapid and Visual Detection of Barley Yellow Dwarf Virus by Reverse Transcription Recombinase Polymerase Amplification with Lateral Flow Strips.

Barley yellow dwarf virus (BYDV) has been a major viral pathogen causing significant losses of cereal crops including oats worldwide. It spreads naturally through aphids, and a rapid, specific, and reliable diagnostic method is imperative for disease monitoring and management. Here, we established a rapid and reliable method for isothermal reverse transcription recombinase polymerase amplification (RT-RPA) combined with a lateral flow strips (LFS) assay for the detection of BYDV-infected oat samples based on the conserved sequences of the BYDV coat protein gene. Specific primers and a probe for RT-RPA reacted and optimally incubated at 42°C for 10 min, and the end-labeled amplification products were visualized on LFS within 10 min. The RT-RPA-LFS assay showed no cross-reactivity with other major cereal viruses, including barley mild mosaic virus, barley yellow mosaic virus, and rice black streaked dwarf virus, indicating high specificity of the assay. The sensitivity of the RT-RPA-LFS assay was similar to that of reverse transcription polymerase chain reaction, and it was successfully validated to detect BYDV in oat samples from six different regions and in individual aphids. These results confirm the outstanding potential of the RT-RPA-LFS assay for rapid detection of BYDV.

First report of Apium virus Y infecting Petroselinum crispum in Turkey

Apium virus Y (ApVY) is one of the most important potyviruses that infect apiaceous crops. In January-February 2021, parsley plants (Petroselinum crispum) with mild mosaic and vein clearing symptoms on their leaves were observed during field studies in the Balıkesir province of Turkey (Figure 1). Leaf samples from ten different diseased plants from two commercial fields in the province of Balıkesir were sampled. The samples were brought to the laboratory in a cold box and stored on silica gel at 4°C. Total nucleic acid (TNA) isolation was performed using 100 mg of leaf tissue with the CTAB method (Li et al., 2008). The obtained TNA (adjusted to 1000 ng/μl) from each sample was tested by RT-PCR using universal potyvirus primers as described previously (Zheng et al., 2010). Fragments of the expected size (350 bp) belonging to the nuclear inclusion b (NIb) region of potyviruses were amplified from all ten samples. Amplicons from two randomly chosen samples, once from each field, were subjected to Sanger sequencing. BLASTN analysis of the nucleotide sequences (GenBank Accession nos. OL741312-OL741313) had the highest sequence identify (90%) with the corresponding region of an ApVY isolate (HM363516) from the USA. A new primer pair (ApVYCP-F 5'-CATCCAAAGACGTGTCAGAT-3') and (ApVYCP-R 5'-GCTATGGTGCAATTTGAACG-3') was designed to detect ApVY infection in all samples, producing a 1066 bp amplicon including the complete ApVY coat protein (CP) gene. Each PCR reaction was prepared in a total volume of 25 μl including 2 μl cDNA (50 ng/μl), 12.5 μl 2x EmeraldAmp MAX PCR Mastermix (Takara, Japan), 0.5 μl primer mix (stock concentration 20 pmol/μl) and 10 μl nuclease-free water. The PCR conditions were 94°C for 5 min for initial denaturation, 40 cycles of 30 s at 94°C, 30 s at 55°C, and 30 s at 72°C; and a final extension for 5 min at 72°C. Fragments of the expected size were obtained from all samples. Amplicons from four samples, two from each field, were sequenced bi-directionally. The assembled sequences were submitted to GenBank (OL741314-OL741317). The identity of the isolates from this study with each other and the isolates from other countries were determined at the nucleotide and amino acid level by ClustalW alignment in the Sequence Demarcation Tool V.1.2 software (Muhire et al., 2014). Sequence analyses using the obtained CP gene sequences revealed that Turkish ApVY isolates had 88–100% nucleotide and 95–100% amino acid identities between each other. Nucleotide and amino acid identities between the Turkish isolates and those from other countries were 88–100% and 93–100%, respectively (Figure 2). Phylogenetic analyses of the ApVY CP gene sequences of the four Turkish isolates in this study and isolates from other countries revealed that three Turkish isolates were closely related to Slovenian isolates and clustered together in the same branch of the phylogenetic tree, while one Turkish isolate grouped with the isolates from the USA (Figure 3). ApVY has been shown to be transmitted experimentally in 17 plant species in the family Apiaceae by mechanical inoculation, and by Myzus persicae with a transmission efficiency of 10–20 % (Xu et al. 2011). Seed transmission has not been shown (Xu et al. 2011; Koike et al. 2012) but we suspect it might be possible since aphid populations were not found in the ApVY-infected fields in this case. Alternatively, it is possible that some other insect vector is spreading this virus, thus further studies are needed to understand the transmission of this virus under Turkish conditions. To the best of our knowledge, this is the first report of ApVY in Turkey. This study was supported by a grant from TUBITAK-TOVAG (project # 120O802).

Diagnosis of Important Virus Diseases of Ornamental Anthurium in Screen- Houses in Tehran Province

Introduction: One of the limiting factors for Anthurium production is its infection with various viruses. During the year 2014- 2015, a total of 504 symptomatic ornamental Anthurium leaf samples with virus-like symptoms including leaf and flower blister, dwarfing, mosaic, yellowing, leaf marginal chlorosis, and deformity were collected from Varamin and Pakdasht (Tehran province) Screen-houses. Aim: Samples were tested for infection to Cucumber mosaic virus (CMV), Tomato spotted wilt virus (TSWV), Impatiens necrotic spot virus (INSV) and Dasheen mosaic viruses (DaMV). Method: Biological, serological (ELISA) and molecular methods (RT-PCR) were performed for the detection and analysis of the important viral agents infecting Anthurium ornamental plants. Results: According to ELISA test results the prevalence of CMV were (31.54%) followed by TSWV (25%) and DaMV (7.93%) viruses respectively. Results of mechanical inoculation and host range reaction of CMV, TSWV and DaMV isolates were also recorded (fig 2). Coat protein gene sequence of Iranian CMV isolate showed the highest similarity (97%) with a CMV isolate Cucurbit pepo (Acc. No.GU327368.1) from South Korea. DMV on ornamental Anthurium is reported for the first time in this research from Iran. Conclusion: Despite the detection of CMV, TSWV and DaMV in this study, viral pathogens are one of the most economically damaging agents in the ornamental Anthurium plant. Development of research methods for, the detection and study of different isolates of these agents from different hosts, and study of the characteristics of each of these isolates has always been a scientific need.

Phylogenetic Analysis of Okra Enation Leaf Curl Virus (OELCV) Transmitted by Bemisia tabaci Using Coat Protein Gene Fragment of OELCV in Tamil Nadu

Okra enation leaf curl virus (OELCV) is a severe emerging disease of okra, Abelmoschus esculentus in India, causes systemic infections and has a very effective mode of transmission by the sweet potato whitefly, Bemisia tabaci; thus, preventing their spread has been made very complicated. It is essential to understand the OELCV isolates to study the disease reactions in plant accessions. The okra OELCV infected young leaves were collected from the Salem (Northwestern Zone) and Madurai (South Zone) of Tamil Nadu and the DNA was extracted and used to amplify the OELCV utilizing specific primers (JKOE34F, JKOE35R) targeting the OELCV coat protein gene and produced a 796 bp band in the polymerase chain reaction (PCR). The homology analysis of nucleotide sequence was carried out using BLAST programme and the results revealed that the Salem region coat protein gene sequence grouped into OELCV clone 6.2, complete genome (MK084768.1) with 99.71% of homology, and Madurai region coat protein gene sequence grouped into OELCV isolate Vijayawada coat protein (AV1) gene complete cds (KT935487.1) with a 99.38% of homology. The amplified OELCV (Salem and Madurai zone) from the study had aligned in the same cluster along with HG938362.1 and KX710156.1. This study had indicated that the OELCV pathogen alike in these zones successfully being transmitted by B. tabaci.

Whole-Genome Characterization of Alfalfa Mosaic Virus Obtained from Metagenomic Analysis of Vinca minor and Wisteria sinensis in Iran: with Implications for the Genetic Structure of the Virus.

Alfalfa mosaic virus (AMV), an economically important pathogen, is present worldwide with a very wide host range. This work reports for the first time the infection of Vinca minor and Wisteria sinensis with AMV using RNA sequencing and reverse transcription polymerase chain reaction confirmation. De novo assembly and annotating of contigs revealed that RNA1, RNA2, and RNA3 genomic fragments consist of 3,690, 2,636, and 2,057 nucleotides (nt) for IR-VM and 3,690, 2,594, and 2,057 nt for IR-WS. RNA1 and RNA3 segments of IR-VM and IR-WS closely resembled those of the Chinese isolate HZ, with 99.23–99.26% and 98.04–98.09% nt identity, respectively. Their RNA2 resembled that of Canadian isolate CaM and American isolate OH-2-2017, with 97.96–98.07% nt identity. The P2 gene revealed more nucleotide diversity compared with other genes. Genes in the AMV genome were under dominant negative selection during evolution, and the P1 and coat protein (CP) proteins were subject to the strongest and weakest purifying selection, respectively. In the population genetic analysis based on the CP gene sequences, all 107 AMV isolates fell into two main clades (A, B) and isolates of clade A were further divided into three groups with significant subpopulation differentiation. The results indicated moderate genetic variation within and no clear geographic or genetic structure between the studied populations, implying moderate gene flow can play an important role in differentiation and distribution of genetic diversity among populations. Several factors have shaped the genetic structure and diversity of AMV: selection, recombination/reassortment, gene flow, and random processes such as founder effects.

High Mutation Frequency and Significant Population Differentiation in Papaya Ringspot Virus-W Isolates.

A total of 101 papaya ringspot virus-W (PRSV-W) isolates were collected from five different cucurbit hosts in six counties of Oklahoma during the 2016–2018 growing seasons. The coat protein (CP) coding region of these isolates was amplified by reverse transcription-polymerase chain reaction, and 370 clones (3–5 clones/isolate) were sequenced. Phylogenetic analysis revealed three phylogroups while host, location, and collection time of isolates had minimal impact on grouping pattern. When CP gene sequences of these isolates were compared with sequences of published PRSV isolates (both P and W strains), they clustered into four phylogroups based on geographical location. Oklahoman PRSV-W isolates formed one of the four distinct major phylogroups. The permutation-based tests, including Ks, Ks *, Z *, Snn, and neutrality tests, indicated significant genetic differentiation and polymorphisms among PRSV-W populations in Oklahoma. The selection analysis confirmed that the CP gene is undergoing purifying selection. The mutation frequencies among all PRSV-W isolates were within the range of 1 × 10−3. The substitution mutations in 370 clones of PRSV-W isolates showed a high proportion of transition mutations, which gave rise to higher GC content. The N-terminal region of the CP gene mostly contained the variable sites with numerous mutational hotspots, while the core region was highly conserved.

Eight Species of Poaceae Are Hosting Different Genetic and Pathogenic Strains of Sugarcane Mosaic Virus in the Everglades Agricultural Area.

Sugarcane mosaic virus (SCMV) was detected by reverse transcription polymerase chain reaction in eight different species of the Poaceae family in the Everglades Agricultural Area (EAA) of south Florida: broadleaf signalgrass (Urochloa platyphylla), Columbus grass (Sorghum almum), goosegrass (Eleusine indica), maize (Zea mays), sorghum (Sorghum bicolor), St. Augustine grass (Stenotaphrum secundatum), southern crabgrass (Digitaria ciliaris), and sugarcane (Saccharum interspecific hybrids). Based on their coat protein (CP) gene sequence, 62 isolates of SCMV from Florida and 29 worldwide isolates representing the known genetic diversity of this virus were distributed into eight major phylogenetic groups. SCMV isolates infecting Columbus grass, maize, and sorghum in Florida formed a unique group, whereas virus isolates infecting sugarcane in the United States (Florida and Louisiana) clustered with isolates from other countries. Based on the entire genome coding region, SCMV isolates infecting sugarcane in Florida were closest to virus isolates infecting sorghum species or St. Augustine grass. Virus isolates from Columbus grass, St. Augustine grass, and sugarcane showed different virulence patterns after mechanical inoculation of Columbus grass, St. Augustine grass, and sugarcane plants, thus proving that these isolates were different pathogenic strains. Sugarcane was symptomless and tested negative for SCMV by tissue blot immunoassay after inoculation with crude sap from SCMV-infected Columbus grass, indicating that Columbus grass was not a reservoir for SCMV infecting sugarcane in the EAA. Close CP sequence identity between isolates of SCMV from Columbus grass, maize, and sorghum suggested that the same virus strain was naturally spreading between these three plants in south Florida.

Detection of orchid viruses and molecular characterization of odontoglossum ringspot virus (ORSV) isolates

During a survey (2018), 44 orchid samples collected from Sikkim and Darjeeling Hills of West Bengal. The samples were examined under electron microscope (EM) followed by DAC-ELISA and RT-PCR assays were performed. Electron microscopy showed the presence of rigid rods (300 × 18 nm), flexuous rods (475 nm × 13 nm and 800 nm × 12 nm), bacilliform or bullets shaped particles (40 × 100-140 nm) and enveloped quasi-spherical particles (80-110 nm). Based on the particle morphology, DAC-ELISA was performed using the antibodies specific to odontoglossum ringspot virus (ORSV), cymbidium mosaic virus (CymMV), calanthe mild mosaic virus (CalMMV) and groundnut bud necrosis virus (GBNV), which revealed the presence of four viruses namely CymMV, ORSV, GBNV and CalMMV. RT-PCR assays also confirmed the presence of four viruses using their specific primers. The cloning, sequencing and sequence analysis of the coat protein gene sequences of the four ORSV isolates was performed. The sequence analyses revealed up to 100% sequence identity among the ORSV isolates of this study and more than 99% identity with the different ORSV isolates available at NCBI GenBank database. The higher level of sequence homology among ORSV population suggests that they are under least evolutionary pressure. The occurrence of the multiple viruses in different orchids also reflects that the orchid cultivation is under major threat.

Distribution and identification of luteovirids affecting chickpea in Sudan

In Sudan yellowing viruses are key production constraints in pulse crops. Field surveys were carried out to identify luteovirids affecting chickpea crops in the major production regions (Gezira Scheme and River Nile State). A total of 415 chickpea plant samples with yellowing and stunting symptoms were collected during the 2013, 2015 and 2018 growing seasons. Serological results (Tissue-blot immunoassays) showed that Luteoviridae and Chickpea chlorotic dwarf virus (CpCDV, genus Mastrevirus, family Geminiviridae) were the most common viruses, with rare infections with Faba bean necrotic yellows virus (FBNYV, genus Nanovirus, family Nanoviridae). Some samples reacted only with a broad-spectrum luteovirid monoclonal antibody (5G4-MAb), and others showed cross reactions between the specific monoclonal antibodies, suggesting the occurrence of new luteovirid variants. Serological results were confirmed by amplification with reverse transcription-polymerase chain reaction (RT-PCR) and sequencing of the partial coat protein gene. Molecular analyses provided a basic, sufficient and reliable characterization for four viruses affecting chickpea that belong to Polerovirus (family Luteoviridae). These were Cucurbit aphid-borne yellows virus (CABYV), Pepper vein yellows virus (PeVYV), Pepo aphid-borne yellows virus (PABYV) and Cotton leafroll dwarf virus (CLRDV), that shared high similarity with the type sequences. Phylogenetic analyses also revealed high similarity to luteovirid species. This study has established reliable, rapid and sensitive molecular tools for the detection of luteovirid species.

Genetic variability and recombination analysis of papaya infecting isolates of Papaya ringspot virus based on CP gene from Western India

Papaya ringspot disease is caused by Papaya ringspot virus (PRSV-P). The coat protein gene (CP) sequences of 14 isolates of PRSV-P from different papaya growing areas from Western Indian states, Maharashtra and Gujarat, were analysed and compared with previously reported CP gene sequences. The sequence length of CP gene ranged 855–861 nucleotides, encoding 285–287 amino acids. Sequence analysis of CP gene showed that the PRSV-P isolates from Maharashtra and Gujarat shared 80 to 100% and 81 to 98% nucleotide sequence identities, respectively with other Indian isolates. Nine putative recombination sites were identified in CP of PRSV-P isolates analysed. This study contributes in understanding of virus population and genetic recombination.

First report of squash vein yellowing virus naturally infecting butternut squash (Cucurbita moschata) in Texas.

Virus diseases are major constraints to the production of cucurbits in the Texas Lower Rio Grande Valley. In September 2020, a ~8.1 ha butternut squash (Cucurbita moschata) field in Hidalgo County, Texas, was observed with virus-like symptoms of vein yellowing, leaf curl, mosaic, and foliar chlorosis. The proportion of plants with virus-like symptoms in this field was estimated at 30% and seven samples (symptomatic = 5; non-symptomatic = 2) were collected randomly for virus diagnosis. Initially, equimolar mixtures of total nucleic acid extracts (Dellaporta et. al. 1983) from two symptomatic samples from this field and extracts from 12 additional symptomatic samples from six other fields across south and central Texas was used to generate one composite sample for diagnosis by high throughput sequencing (HTS). The TruSeq Stranded Total RNA with Ribo-Zero Plant Kit (Illumina) was used to construct cDNA library from the composite sample, which was then sequenced on the Illumina NextSeq 500 platform. More than 26 million single-end HTS reads (75 nt each) were obtained and their bioinformatic analyses (Al Rwahnih et al. 2018) revealed several virus-like contigs belonging to different species (data not shown). Among them, 6 contigs that ranged in length from 429 to 3,834 nt shared 96 to 100% identities with isolates of squash vein yellowing virus (SqVYV), genus Ipomovirus, family Potyviridae. To confirm the HTS results, total nucleic acid extracts from the cucurbit samples from all seven fields (n = 46) were used for cDNA synthesis with random hexamers and the PrimeScript 1st strand cDNA Synthesis Kit (Takara Bio). A 1-μL aliquot of cDNA was used in 12.5-μL PCR reaction volumes with PrimeSTAR GXL DNA Polymerase (Takara Bio) and two pairs of SqVYV-specific primers designed based on the HTS derived contigs. The primer pairs SqYVV-v4762: 5'-CTGGATTCTGCTGGAAGATCA & SqYVV-c5512: 5'-CCACCATTAAGGCCATCAAAC and SqYVV-v8478: 5'-TTTCTGGGCAAACAAACATGG & SqYVV-c9715: 5'-TTCAGCGACGTCAAGTGAG targeted ~0.75 kb and ~1.2 kb fragments of the cylindrical inclusion (CI) and the complete coat protein (CP) gene sequences of SqVYV, respectively. The expected DNA band sizes were obtained only from the five symptomatic butternut squash samples from the Hidalgo Co. field. Two amplicons per primer pair from two samples were cloned into pJET1.2/Blunt vector (Life Technologies) and bidirectionally Sanger sequenced, generating 753 nt partial CI specific sequences (MW584341-342) and 1,238 nt that encompassed the complete CP (MW584343-344) of SqVYV. In pairwise comparisons, the partial CI sequences shared 100% nt/aa identity with each other and 98-99% nt/aa identity with corresponding sequences of SqVYV isolate IL (KT721735). The CP cistron of TX isolates shared 100% nt/aa identity with each other and 90-98% nt (97-100% aa) identities with corresponding sequences of several SqVYV isolates in GenBank, with isolates IL (KT721735) and Florida (EU259611) being at the high and low spectrum of nt/aa identity values, respectively. This is the first report of SqVYV in Texas, naturally occurring in butternut squash. SqVYV was first discovered in Florida (Adkins et al. 2007) and subsequently reported from few other states in the U.S. (Adkins et al. 2013; Egel and Adkins 2007; Batuman et al. 2015), Puerto Rico (Acevedo et al. 2013), and locations around the world. The finding shows an expansion of the geographical range of SqVYV and adds to the repertoire of cucurbit-infecting viruses in Texas. Further studies are needed to determine the prevalence of SqVYV in Texas cucurbit fields and an assessment of their genetic diversity.

Genetic variability and molecular evolution of arabis mosaic virus based on the coat protein gene sequence

AbstractArabis mosaic virus (ArMV) is an important pathogen infecting a wide range of plant species worldwide. In the present study, we carried out exhaustive phylogenetic analyses based on the coat protein (CP) sequence of ArMV isolates originating from different host plants and geographic regions. Maximum‐likelihood reconstruction revealed the presence of three distinct, well‐supported phylogroups. BaTS analyses indicated that the diversity of ArMV isolates may be correlated with both host plant and geographic origin. Moreover, population genetic analyses showed significant differences in the level of genetic diversity among variants within ArMV that originated from rhubarb plants, as expected by quasispecies. Further analysis revealed that both selection and recombination are shaping the population structure of ArMV. In total 14 groups of residues were detected as coevolving for different amino acid properties.

Phylogenetic and Population Analysis of Lettuce mosaic virus Isolates Based on the Coat Protein Gene

Lettuce mosaic virus (LMV) is one of the most important and destructive members of Potyviruses in the family Potyviridae that is transmitted by aphid and seed which cause economic damage and serious yield losses to different crops around the world. To explore phylogenetic relationships, population evolution, and the effect of selection forces on the complete coat protein (CP) gene of LMV isolates, 36 complete coat protein gene sequences retrieved from the GenBank database in several different countries in four continents: Central and East Asia (China, Taiwan, South Korea, and Turkey), Europe (France), Africa (Tunisia), and America (Chile and Brazil). The phylogenetic tree of LMV isolates was grouped into independent clades with the significance of FST values (>0.27). The ratio of dN/dS is calculated less than one and showed that the LMV-CP has been under negative selection. Statistical tests (Tajima’s D, Fu and Li’s D* and F*) were used to estimate non-significantly negative values for all clades and geographic populations except for the Brazilian population and Clade III in a phylogenetic group. The negatives values revealed that there is less polymorphism estimation. All geographic populations in four phylogroups of LMV seem to be at equilibrium because all neutrality test statistics were non-significant. The findings suggested that the dynamics of LMV molecular evolution may be dependent on mutation, recombination, and negative selection. No recombination events were observed in this part of the LMV genome. Therefore, this study provides the first time evolution and differentiation between populations of LMV isolates from around the world and suggested that they may be occurred by the transmission of the virus among lettuce plants by types of aphid species, migration in different geographical areas by infected seeds and plant material, and broad host range which seems that these events have played an important role in shaping the LMV population structure.

Genetic variability and evolutionary dynamics of tomato black ring virus population

AbstractTomato black ring virus (TBRV) is an important pathogen infecting a wide range of plant species worldwide. Phylogenetic studies of TBRV have already been conducted, although limited by the use of short genomic regions or a reduced amount of isolates. In the present study, we carried out an exhaustive phylogenetic and population genetic analysis based on the coat protein gene (CP) sequence of 57 TBRV isolates originating from different host plants and European geographic regions (47 isolates from Poland, 8 from Lithuania, one from the UK, and one from Hungary). Moreover, the selective pressure acting on particular codons and coevolution of amino acid residues in the CP were analysed. The results clearly showed that the TBRV population is being shaped by recombination and both positive and purifying selection. The analyses revealed that the placement of TBRV isolates in the phylogenetic trees was nonrandom, with isolates clustering according to host plant families and geographic origin.

First report of cucurbit chlorotic yellows virus in association with other whitefly-transmitted viruses in squash (Cucurbita pepo) in Georgia.

Viruses transmitted by whiteflies (Bemisia tabaci) cause severe damage to cucurbits in the southern United States. In the fall of 2020, samples of squash plants (Cucurbita pepo) exhibiting symptoms of yellow mottle, interveinal yellowing, and leaf crumple were collected from an insecticide trial in Tifton, Georgia. Total nucleic acid was isolated using the MagMAX 96 Viral RNA Isolation Kit (ThermoFisher Scientific) following the manufacturer's instructions but without DNase treatment. Polymerase chain reaction (PCR) and reverse transcription (RT)-PCR were carried out to determine the presence of whitefly-transmitted viruses. We identified infection by cucurbit chlorotic yellows virus (CCYV) using primers targeting a 953 nt segment of CCYV RNA1 encoding the RNA dependent RNA polymerase gene (RdRp) (CCYV-RDRP-1515F-5'CTCCGAGTAGATCATCCCAAATC3' and CCYV-RDRP-1515R-5'TCACCAGAAACTCCACAATCTC 3') along with other whitefly-transmitted viruses previously reported in Georgia. CCYV was detected from 27 of the 28 samples tested, while cucurbit yellow stunting disorder virus (CYSDV; Polston et al., 2008) and cucurbit leaf crumple virus (CuLCrV; Gadhave et al., 2020) were detected from 23 and 28 squash samples, respectively, with all three viruses regularly occurring as mixed infections. The presence of CCYV was further confirmed by amplification of portions of two different genomic segments from RNA2, including a section of the heat-shock protein (HSP) homolog gene (Bananej et al. 2013) as well as a portion of the coat protein (CP) gene which was amplified using primers CCYV_CPF-5'TCCCGGTGCCAACT GAGACA3' and CCYV_CPR- 5' TACGCGCGGCAGAGGAATTT 3'. The respective 462 bp HSP and 375 bp CP amplicons were cloned and sequenced. The partial coat protein gene sequence (MW251342) was 97.86% identical to a CCYV isolate from Shanghai (KY400633). The partial HSP sequence (MW251341) shared 99.73% identity with the recently identified CCYV isolate from California (MH806868). Criniviruses are an emerging group of whitefly-transmitted viruses responsible for worldwide losses of billions of dollars annually (Tzanetakis et al., 2013). CCYV, a member of the genus Crinivirus, was believed to be restricted to Asia, Africa, and the Mediterranean regions of Europe (Bananej et al., 2013; Orfanidou et al., 2014) until it was recently identified in the Imperial Valley of California (Wintermantel et al., 2019). Southern Georgia has been experiencing high whitefly populations, resulting in the emergence of CuLCrV and CYSDV on vegetables in recent years. Because CCYV can produce symptoms virtually identical to those of CYSDV and occurs in mixed infections in cucurbits with other whitefly-transmitted viruses, its epidemiology, role in disease incidence, severity, and impact on economically important crops in the southeastern United States will require further investigation.

The Phylogeography of Potato Virus X Shows the Fingerprints of Its Human Vector.

Potato virus X (PVX) occurs worldwide and causes an important potato disease. Complete PVX genomes were obtained from 326 new isolates from Peru, which is within the potato crop′s main domestication center, 10 from historical PVX isolates from the Andes (Bolivia, Peru) or Europe (UK), and three from Africa (Burundi). Concatenated open reading frames (ORFs) from these genomes plus 49 published genomic sequences were analyzed. Only 18 of them were recombinants, 17 of them Peruvian. A phylogeny of the non-recombinant sequences found two major (I, II) and five minor (I-1, I-2, II-1, II-2, II-3) phylogroups, which included 12 statistically supported clusters. Analysis of 488 coat protein (CP) gene sequences, including 128 published previously, gave a completely congruent phylogeny. Among the minor phylogroups, I-2 and II-3 only contained Andean isolates, I-1 and II-2 were of both Andean and other isolates, but all of the three II-1 isolates were European. I-1, I-2, II-1 and II-2 all contained biologically typed isolates. Population genetic and dating analyses indicated that PVX emerged after potato’s domestication 9000 years ago and was transported to Europe after the 15th century. Major clusters A–D probably resulted from expansions that occurred soon after the potato late-blight pandemic of the mid-19th century. Genetic comparisons of the PVX populations of different Peruvian Departments found similarities between those linked by local transport of seed potato tubers for summer rain-watered highland crops, and those linked to winter-irrigated crops in nearby coastal Departments. Comparisons also showed that, although the Andean PVX population was diverse and evolving neutrally, its spread to Europe and then elsewhere involved population expansion. PVX forms a basal Potexvirus genus lineage but its immediate progenitor is unknown. Establishing whether PVX′s entirely Andean phylogroups I-2 and II-3 and its Andean recombinants threaten potato production elsewhere requires future biological studies.

Rapid and visual detection of tomato spotted wilt virus using recombinase polymerase amplification combined with lateral flow strips

Tomato spotted wilt virus (TSWV) is economically important in Korea as it causes significant losses to a wide range of important ornamental and vegetable crops. Therefore, a rapid detection method is imperative for TSWV diagnosis. Specific primers and probes were designed based on the conserved sequences of the TSWV coat protein gene. In this study, an isothermal reverse transcription recombinase polymerase amplification (RT-RPA) assay, combined with lateral flow strips (LFS), was established for rapid detection of TSWV in pepper infected leaves. The RT-RPA reaction was performed at an optimal condition of 38 °C for 10 min and an LFS incubation time of approximately 5 min. There was no cross-reactivity with other viruses infecting pepper such as cucumber mosaic virus, pepper mottle virus, pepper mild mottle virus, and broad bean wilt virus 2, thus confirming the specificity of RT-RPA-LFS. The sensitivity of the RT-RPA assay was similar to that of RT-PCR, and RT-RPA-LFS was successfully applied to detect TSWV in the pepper samples collected from the field. Thus, RT-RPA-LFS assay might be a promising candidate for quick diagnosis of TSWV-infected pepper plants.