Cleavage Positions Research Articles

Application of N-Terminal Labeling Methods Provide Novel Insights into Endoproteolysis of the Prion Protein in Vivo.

Alternative α- and β-cleavage events in the cellular prion protein (PrPC) central region generate fragments with distinct biochemical features that affect prion disease pathogenesis, but the assignment of precise cleavage positions has proven challenging. Exploiting mouse transgenic models expressing wild-type (WT) PrPC and an octarepeat region mutant allele (S3) with increased β-fragmentation, cleavage sites were defined using LC-MS/MS in conjunction with N-terminal enzymatic labeling and chemical in-gel acetylation. Our studies profile the net proteolytic repertoire of the adult brain, as deduced from defining hundreds of proteolytic events in other proteins, and position individual cleavage events in PrPC α- and β-target areas imputed from earlier, lower resolution methods; these latter analyses established site heterogeneity, with six cleavage sites positioned in the β-cleavage region of WT PrPC and nine positions for S3 PrPC. Regarding α-cleavage, aside from reported N-termini at His110 and Val111, we identified a total of five shorter fragments in the brain of both mice lines. We infer that aminopeptidase activity in the brain could contribute to the ragged N-termini observed around PrPC's α- and β-cleavage sites, with this work providing a point of departure for further in vivo studies of brain proteases.

SARS-CoV-2 NSP1 induces mRNA cleavages on the ribosome.

In severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), the non-structural protein NSP1 inhibits translation of host mRNAs by binding to the mRNA entry channel of the ribosome and, together with the 5'-untranslated region (UTR) of the viral mRNAs, allows the evasion of that inhibition. Here, we show that NSP1 mediates endonucleolytic cleavages of both host and viral mRNAs in the 5'UTR, but with different cleavage patterns. The first pattern is observed in host mRNAs with cleavages interspersed regularly and close to the 5' cap (6-11 nt downstream of the cap). Those cleavage positions depend more on the position relative to the 5' cap than on the sequence itself. The second cleavage pattern occurs at high NSP1 concentrations and only in SARS-CoV-2 RNAs, with the cleavages clustered at positions 45, 46 and 49. Both patterns of cleavage occur with the mRNA and NSP1 bound to the ribosome, with the SL1 hairpin at the 5' end sufficient to protect from NSP1-mediated degradation at low NSP1 concentrations. We show further that the N-terminal domain of NSP1 is necessary and sufficient for efficient cleavage. We suggest that in the ribosome-bound NSP1 protein the catalytic residues of the N-terminal domain are unmasked by the remodelling of the α1- and α2-helices of the C-terminal domain.

Emerging roles of tRNA-derived small RNAs in cancer biology.

Transfer RNAs (tRNAs) play an essential role in mRNA translation by delivering amino acids to growing polypeptide chains. Recent data demonstrate that tRNAs can be cleaved by ribonucleases, and the resultant cleavage products, tRNA-derived small RNAs (tsRNAs), have crucial roles in physiological and pathological conditions. They are classified into more than six types according to their size and cleavage positions. Since the initial discovery of the physiological functions of tsRNAs more than a decade ago, accumulating data have demonstrated that tsRNAs play critical roles in gene regulation and tumorigenesis. These tRNA-derived molecules have various regulatory functions at the transcriptional, post-transcriptional, and translational levels. More than a hundred types of modifications are found on tRNAs, affecting the biogenesis, stability, function, and biochemical properties of tsRNA. Both oncogenic and tumor suppressor functions have been reported for tsRNAs, which play important roles in the development and progression of various cancers. Abnormal expression patterns and modification of tsRNAs are associated with various diseases, including cancer and neurological disorders. In this review, we will describe the biogenesis, versatile gene regulation mechanisms, and modification-mediated regulation mechanisms of tsRNA as well as the expression patterns and potential therapeutic roles of tsRNAs in various cancers.

PilE G-Quadruplex Is Recognized and Preferentially Bound but Not Processed by the MutL Endonuclease from Neisseria gonorrhoeae Mismatch Repair Pathway

The human pathogen Neisseria gonorrhoeae uses a homologous recombination to undergo antigenic variation and avoid an immune response. The surface protein pilin (PilE) is one of the targets for antigenic variation that can be regulated by N. gonorrhoeae mismatch repair (MMR) and a G-quadruplex (G4) located upstream of the pilE promoter. Using bioinformatics tools, we found a correlation between pilE variability and deletion of DNA regions encoding ngMutS or ngMutL proteins, the main participants in N. gonorrhoeae methyl-independent MMR. To understand whether the G4 structure could affect the ngMutL-mediated regulation of pilin antigenic variation, we designed several synthetic pilE G4-containing oligonucleotides, differing in length, and related DNA duplexes. Using CD measurements and biochemical approaches, we have showed that (i) ngMutL preferentially binds to pilE G4 compared to DNA duplex, although the latter is a cognate substrate for ngMutL endonuclease, (ii) protein binding affinity decreases with shortening of quadruplex-containing and duplex ligands, (iii) the G4 structure inhibits ngMutL-induced DNA nicking and modulates cleavage positions; the enzyme does not cleave DNA within G4, but is able to bypass this noncanonical structure. Thus, pilE G4 may regulate the efficiency of pilin antigenic variation by quadruplex binding to ngMutL and suppression of homologous recombination.

Identification of SARS-CoV-2 Main Protease (Mpro) Cleavage Sites Using Two-Dimensional Electrophoresis and In Silico Cleavage Site Prediction

The main protease (Mpro) of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) plays a crucial role in its life cycle. The Mpro-mediated limited proteolysis of the viral polyproteins is necessary for the replication of the virus, and cleavage of the host proteins of the infected cells may also contribute to viral pathogenesis, such as evading the immune responses or triggering cell toxicity. Therefore, the identification of host substrates of the viral protease is of special interest. To identify cleavage sites in cellular substrates of SARS-CoV-2 Mpro, we determined changes in the HEK293T cellular proteome upon expression of the Mpro using two-dimensional gel electrophoresis. The candidate cellular substrates of Mpro were identified by mass spectrometry, and then potential cleavage sites were predicted in silico using NetCorona 1.0 and 3CLP web servers. The existence of the predicted cleavage sites was investigated by in vitro cleavage reactions using recombinant protein substrates containing the candidate target sequences, followed by the determination of cleavage positions using mass spectrometry. Unknown and previously described SARS-CoV-2 Mpro cleavage sites and cellular substrates were also identified. Identification of target sequences is important to understand the specificity of the enzyme, as well as aiding the improvement and development of computational methods for cleavage site prediction.

Structure-Activity Relationship of 5-mer Catalytides, GSGYR and RYGSG.

We recently discovered JAL-TA9 (YKGSGFRMI), a short hydrolytic peptide that we termed a Catalytide. The catalytic center of JAL-TA9 was modeled using MM2 and MMFF94 parameters and identified as GSGFR. Additionally, a structure-activity relationship study showed that GSGYR cleaved Aβ11-29. Here, we developed a novel Catalytide in silico. Molecular dynamics simulations of GSGYR and RYGSG using MM2 and MMFF94 parameters suggested that both peptides may form catalytic triads and oxyanion holes. The hydrolytic potency of RYGSG was five times higher than that of GSGYR. Moreover, both peptides showed three common cleavage positions for Aβ11-29; namely, L17-V18, V18-F19, and E22-D23. The aggregation ratio analyzed by the thioflavin-T assay correlated well with proteolytic activity, suggesting that the aggregation of Aβ11-29 was suppressed by the cleavage reaction. Docking simulations with the carbonyl carbon of L17 or the carbonyl carbon of E22 in Aβ11-29 were conducted using the secondary structures of GSGYR and RYGSG. The distance between the hydroxyl group of serine and the carbonyl carbon of the two cleavage sites proved that RYGSG was closer to Aβ11-29 than to GSGYR. This study demonstrated that Catalytides are useful for understanding structure-activity relationships.

Uncariphyllin A-J, indole alkaloids from Uncaria rhynchophylla as antagonists of dopamine D2 and Mu opioid receptors

Ten new indole alkaloids (1–10) as well as eleven known analogs (11–21) were isolated from the stems and hooks of Uncaria rhynchophylla. Their structure elucidation was based on extensive NMR studies, MS and ECD data, with the essential aid of DFT prediction of ECD spectra. Compound 1 was determined as a 17,19-seco-cadambine-type alkaloid, and compound 3 was confirmed to be a 3,4-seco-tricyclic monoterpene indole alkaloid, which are the first seco-alkaloids possessing such cleavage positions from U. rhynchophylla. All the isolated compounds were evaluated for their bioactivities on dopamine D2 and Mu opioid receptors for discovering natural therapeutic drugs targeting central nervous system (CNS) diseases. Compounds 1, 2, 4, 5, 20 and 21 showed antagonistic bioactivities on the D2 receptor (IC50 0.678–15.200 μM), and compounds 1, 3, 6, 9, 10, 13, 18, 19 and 21 exhibited antagonistic effects on the Mu receptor (IC50 2.243–32.200 μM). Among them, compounds 1 and 21 displayed dual-target activities. Compound 1 showed conspicuous antagonistic activity on D2 and Mu receptors with the IC50 values of 0.678 ± 0.182 μM and 13.520 ± 2.480 μM, respectively. Compound 21 displayed moderate antagonistic activity on the two receptors with the IC50 values at 15.200 ± 1.764 μM and 32.200 ± 5.695 μM, respectively.

Genome Sequence Resource of Sarocladium terricola TR, an Endophytic Fungus as a Potential Biocontrol Agent Against Meloidogyne incognita.

Genome Sequence Resource of Sarocladium terricola TR, an Endophytic Fungus as a Potential Biocontrol Agent Against Meloidogyne incognita.

Proteolytic Profiling of Streptococcal Pyrogenic Exotoxin B (SpeB) by Complementary HPLC-MS Approaches.

Streptococcal pyrogenic exotoxin B (SpeB) is a cysteine protease expressed during group A streptococcal infection that represents a major virulence factor. Although subject to several studies, its role during infection is still under debate, and its proteolytic properties remain insufficiently characterized. Here, we revisited this protease through a set of complementary approaches relying on state of-the-art HPLC-MS methods. After conceiving an efficient protocol to recombinantly express SpeB, the zymogen of the protease and its activation were characterized. Employing proteome-derived peptide libraries, a strong preference for hydrophobic and aromatic residues at P2 alongside negatively charged amino acids at P3′ to P6′ was revealed. To identify relevant in vivo substrates, native proteins were obtained from monocytic secretome and plasma to assess their cleavage under physiological conditions. Besides corroborating our findings concerning specificity, more than 200 cleaved proteins were identified, including proteins of the extracellular matrix, proteins of the immune system, and proteins involved in inflammation. Finally, the cleavage of IgG subclasses was studied in detail. This study precisely depicts the proteolytic properties of SpeB and provides a library of potential host substrates, including their exact cleavage positions, as a valuable source for further research to unravel the role of SpeB during streptococcal infection.

Protease-sensitive regions in amyloid light chains: what a common pattern of fragmentation across organs suggests about aggregation.

Light‐chain (AL) amyloidosis is characterized by deposition of immunoglobulin light chains (LC) as fibrils in target organs. Alongside the full‐length protein, abundant LC fragments are always present in AL deposits. Herein, by combining gel‐based and mass spectrometry analyses, we identified and compared the fragmentation sites of amyloid LCs from multiple organs of an AL λ amyloidosis patient (AL‐55). The positions pinpointed here in kidney and subcutaneous fat, alongside those previously detected in heart of the same patient, were aligned and mapped on the LC’s dimeric and fibrillar states. All tissues contain fragmented LCs along with the full‐length protein; the fragment pattern is coincident across organs, although microheterogeneity exists. Multiple cleavage positions were detected; some are shared, whereas some are organ‐specific, likely due to a complex of proteases. Cleavage sites are concentrated in ‘proteolysis‐prone’ regions, common to all tissues. Several proteolytic sites are not accessible on native dimers, while they are compatible with fibrils. Overall, data suggest that the heterogeneous ensemble of LC fragments originates in tissues and is consistent with digestion of preformed fibrils, or with the hypothesis that initial proteolytic cleavage of the constant domain triggers the amyloidogenic potential of LCs, followed by subsequent proteolytic degradation. This work provides a unique set of molecular data on proteolysis from ex vivo amyloid, which allows discussing hypotheses on role and timing of proteolytic events occurring along amyloid formation and accumulation in AL patients.

Hairpin sequence and structure is associated with features of isomiR biogenesis

ABSTRACT MiRNA isoforms (isomiRs) are single stranded small RNAs originating from the same pri-miRNA hairpin as a result of cleavage by Drosha and Dicer enzymes. Variations at the 5ʹ-end of a miRNA alter the seed region of the molecule, thus affecting the targetome of the miRNA. In this manuscript, we analysed the distribution of miRNA cleavage positions across 31 different cancers using miRNA sequencing data of TCGA project. As a result, we found that the processing positions are not tissue specific and that all miRNAs could be correctly classified as ones exhibiting homogeneous or heterogeneous cleavage at one of the four cleavage sites. In 42% of cases (42 out of 100 miRNAs), we observed imprecise 5ʹ-end Dicer cleavage, while this fraction was only 14% for Drosha (14 out of 99). To the contrary, almost all cleavage sites of 3ʹ-ends (either Drosha or Dicer) were heterogeneous. With the use of only four nucleotides surrounding a 5ʹ-end Dicer cleavage position we built a model which allowed us to distinguish between homogeneous and heterogeneous cleavage with the reliable quality (ROC AUC = 0.68). Finally, we showed the possible applications of the study by the analysis of two 5ʹ-end isoforms originating from the same exogeneous shRNA hairpin. It turned out that the less expressed shRNA variant was functionally active, which led to the increased off-targeting. Thus, the obtained results could be applied to the design of shRNAs whose processing will result in a single 5ʹ-variant.

A deep investigation into the thermal degradation of urethane dimethacrylate polymer

This work investigates in depth the thermal degradation process of a polymer of urethane dimethacrylate (UDMA). UDMA monomer has been widely used in dental restorations and biomaterials. The use of density functional theory (DFT) calculations provided the bases for understanding the structure and reactivity of the UDMA monomer. Simultaneous thermogravimetry–differential thermal analysis, Photovisual Differential Scanning Calorimetry, and mid-infrared spectroscopy (MIR) were used to examine the depolymerization and degradation process. Non-isothermal kinetics made it possible to determine the best fit (n-dimensional nucleation according to Avrami–Erofeev followed by two competitive processes: nth order with autocatalysis by-product and reaction of nth order). Furthermore, the UDMA-P lifetime (5%) was calculated to show a degradation time of 3 years at 100.0 °C. Notwithstanding, techniques such as MIR and nuclear magnetic resonance 13C, 1H linked to DFT calculations helped to elucidate the cleavage positions and possible degradation by-products of UDMA degradation.

Transfer RNA-derived non-coding RNAs (tncRNAs): Hidden regulation of plants' transcriptional regulatory circuits

The emergence of distinct classes of non-coding RNAs has led to better insights into the eukaryotic gene regulatory networks. Amongst them, the existence of transfer RNA (tRNA)-derived non-coding RNAs (tncRNAs) demands exploration in the plant kingdom. We have designed a methodology to uncover the entire perspective of tncRNAome in plants. Using this pipeline, we have identified diverse tncRNAs with a size ranging from 14 to 50 nucleotides (nt) by utilizing 2448 small RNA-seq samples from six angiosperms, and studied their various features, including length, codon-usage, cleavage pattern, and modified tRNA nucleosides. Codon-dependent generation of tncRNAs suggests that the tRNA cleavage is highly specific rather than random tRNA degradation. The nucleotide composition analysis of tncRNA cleavage positions indicates that they are generated through precise endoribonucleolytic cleavage machinery. Certain nucleoside modifications detected on tncRNAs were found to be conserved across the plants, and hence may influence tRNA cleavage, as well as tncRNA functions. Pathway enrichment analysis revealed that common tncRNA targets are majorly enriched during metabolic and developmental processes. Further distinct tissue-specific tncRNA clusters highlight their role in plant development. Significant number of tncRNAs differentially expressed under abiotic and biotic stresses highlights their potential role in stress resistance. In summary, this study has developed a platform that will help in the understanding of tncRNAs and their involvement in growth, development, and response to various stresses. The workflow, software package, and results are freely available at http://nipgr.ac.in/tncRNA.

On the expanding roles of tRNA fragments in modulating cell behavior.

The fragments that derive from transfer RNAs (tRNAs) are an emerging category of regulatory RNAs. Known as tRFs, these fragments were reported for the first time only a decade ago, making them a relatively recent addition to the ever-expanding pantheon of non-coding RNAs. tRFs are short, 16–35 nucleotides (nts) in length, and produced through cleavage of mature and precursor tRNAs at various positions. Both cleavage positions and relative tRF abundance depend strongly on context, including the tissue type, tissue state, and disease, as well as the sex, population of origin, and race/ethnicity of an individual. These dependencies increase the urgency to understand the regulatory roles of tRFs. Such efforts are gaining momentum, and comprise experimental and computational approaches. System-level studies across many tissues and thousands of samples have produced strong evidence that tRFs have important and multi-faceted roles. Here, we review the relevant literature on tRF biology in higher organisms, single cell eukaryotes, and prokaryotes.

Position of Deltaproteobacteria Cas12e nuclease cleavage sites depends on spacer length of guide RNA

ABSTRACT Cas12e proteins (formerly CasX) form a distinct subtype of Class II type V CRISPR-Cas effectors. Recently, it was shown that DpbCas12e from Deltaproteobacteria and PlmCas12e from Planctomycetes can introduce programmable double-stranded breaks in mammalian genomes. Thus, along with Cas9 and Cas12a Class II effectors, Cas12e could be harnessed for genome editing and engineering. The location of cleavage points in DNA targets is important for application of Cas nucleases in biotechnology. DpbCas12e was reported to produce extensive 5ʹ-overhangs at cleaved targets, which can make it superior for some applications. Here, we used high throughput sequencing to precisely map the DNA cut site positions of DpbCas12e on several DNA targets. In contrast to previous observations, our results demonstrate that DNA cleavage pattern of Cas12e is very similar to that of Cas12a: DpbCas12e predominantly cleaves DNA after nucleotide position 17–19 downstream of PAM in the non-target DNA strand, and after the 22nd position of target strand, producing 3–5 nucleotide-long 5ʹ-overhangs. We also show that reduction of spacer sgRNA sequence from 20nt to 16nt shifts Cas12e cleavage positions on the non-target DNA strand closer to the PAM, producing longer 6–8nt 5ʹ-overhangs. Overall, these findings advance the understanding of Cas12e endonucleases and may be useful for developing of DpbCas12e-based biotechnology instruments.

Relationship between tRNA-derived fragments and human cancers.

tRNA-derived fragments, a class of small noncoding RNAs (sncRNAs), have been identified in numerous studies in recent years. tRNA-derived fragments are classified into two main groups, including tRNA halves (tiRNAs) and tRNA-derived small RNA fragments (tRFs), according to different cleavage positions of the precursor or mature tRNAs. Instead of random tRNA degradation debris, a growing body of evidence has shown that tRNA-derived fragments are precise products of specific tRNA modifications and play important roles in biological activities, such as regulating protein translation, affecting gene expression, and altering immune signaling. Recently, the relations between tRNA-derived fragments and the occurrence of human diseases, especially cancers, have generated wide interest. It has been demonstrated that tRNA-derived fragments are involved in cancer cell proliferation, metastasis, progression and survival. In this review, we will describe the biogenesis of tRNA-derived fragments, the distinct expression and function of tRNA-derived fragments in the development of cancers, and their emerging roles as diagnostic and prognostic biomarkers and precise targets of future treatments.

A novel potato microRNA stu-miR856 regulates mitogen-activatedprotein kinase genes contributing to drought tolerance

Mitogen-activated protein kinases (MAPKs) are significant components of MAPK cascades, which play versatile roles in different transduction pathways to mediate stress adaptation. However, little information is known about post-transcriptional regulation of MAPK genes in plant under drought stress. MicroRNAs (miRNAs), a class of newly identified, short non-coding RNAs, regulate the expression of target genes in plant growth, development, and stress responses. In order to investigate the mechanism of miRNA regulating MAPK genes in potato, we identified a novel potato miRNA with the sequence CGGCCTTAATAAGATGGTGAAG and named it as stu-miR856 depending on miRNA deep sequencing and bioinformatic analysis. Target prediction indicates that it can bind to the coding sequence region of two potato MAPK-like genes, and cleavage positions of them were also effectively validated by RNA ligase-mediated 5' rapid amplification of cDNA ends assay. In addition, expressional analysis shows that stu-miR856 and its targets exhibited an opposite expression pattern: stu-miR856 expression significantly decreased while its target genes greatly increased in the different stages of drought treatment. The results indicate that a decreased expression of stu-miR856 might drive overexpression of two StMAPK genes family members, which may contribute to regulation of the drought adaptation of potato plants.

Pep-MS assay: Protease hydrolysis assay system using photo-cleavable peptide array and mass spectrometer

Food processing technology such as protein hydrolysis using proteases has been receiving a lot of attention, and it is important to accurately understand the cleavage specificity of each protease for selecting a protease suited to aims. Although numerous methods have been reported to reveal the substrate specificity of proteases, there is no method to evaluate simply, quickly, reasonably, and accurately. This study set out to devise Pep-MS assay, a novel assay system that can be used to comprehensively clarify positions at which proteases cleave, by combining a mass spectrometer and a photo-cleavable peptide array. First, we evaluated peptide array corresponding to the primary sequences of αS1-casein, αS2-casein and β-casein with trypsin to verify the accuracy of the Pep-MS assay. The evaluation of cleavage positions by the trypsin protease reagent using the Pep-MS assay resulted in a matching rate of about 96.8% to rational cleavage positions. Next, we confirmed the cleavage positions in αS2-casein or β-lactoglobulin by an industrial bacterial protease from Bacillus subtilis at some protease reaction temperatures or reaction times. The Pep-MS assay clarified the differences in the cleavage patterns due to the reaction temperature, and the change in the cleavage strength with the reaction time. Pep-MS assay is a promising method for evaluating the substrate specificity of proteases, which will be useful to find effective production conditions for functional peptide from foods and effective hydrolysis conditions for decreasing allergen of food proteins.

Post-transcriptional 3\xb4-UTR cleavage of mRNA transcripts generates thousands of stable uncapped autonomous RNA fragments

The majority of mammalian genes contain one or more alternative polyadenylation sites. Choice of polyadenylation sites was suggested as one of the underlying mechanisms for generating longer/shorter transcript isoforms. Here, we demonstrate that mature mRNA transcripts can undergo additional cleavage and polyadenylation at a proximal internal site in the 3′-UTR, resulting in two stable, autonomous, RNA fragments: a coding sequence with a shorter 3′-UTR (body) and an uncapped 3′-UTR sequence downstream of the cleavage point (tail). Analyses of the human transcriptome has revealed thousands of such cleavage positions, suggesting a widespread post-transcriptional phenomenon producing thousands of stable 3′-UTR RNA tails that exist alongside their transcripts of origin. By analyzing the impact of microRNAs, we observed a significantly stronger effect for microRNA regulation at the body compared to the tail fragments. Our findings open a variety of future research prospects and call for a new perspective on 3′-UTR-dependent gene regulation.

Roles of tRNA-derived fragments in human cancers

Transfer RNAs (tRNAs) were traditionally considered to participate in protein translation. Recent studies have identified a novel class of small non-coding RNAs (sncRNAs), produced by the specific cleavage of pre- and mature tRNAs, which have been named tRNA-derived fragments. tRNA-derived fragments are classified into diverse subtypes based on the different cleavage positions of the pre- and mature tRNAs. Recently, accumulated evidence has shown that these tRNA-derived fragments are frequently dysregulated in several cancers. Several tRNA-derived fragments were found to participate in cell proliferation, apoptosis, and invasive metastasis in several malignant human tumors. These dysregulated fragments are able to bind both Argonaute proteins and Piwi proteins to regulate gene expression. Some of the newly identified tRNA-derived fragments have been considered as the new biomarkers and therapeutic targets for the treatment of cancer. This review summarizes the biogenesis and biological functions of different subtypes of tRNA-derived fragments and discusses their molecular mechanisms in cancer progression.