Citrus Yellow Vein Clearing Virus Research Articles

First report of citrus yellow vein clearing virus (CYVCV) on citrus in Italy.

In March 2024, symptoms of vein clearing (Fig. S1) were observed on leaves of six lemon (Citrus limon (L.) Burm. f.) trees grown in a private garden in Palma Campania (Campania region, Italy). Symptoms strongly resembled those of yellow vein clearing disease, caused by Potexvirus citriflavivenae (citrus yellow vein clearing virus, CYVCV), genus Potexvirus, sub-genus Mandarivirus (Loconsole et al., 2012; Cui et al., 2018). CYVCV was reported in Pakistan, India, China, Iran, Turkey, Korea and USA (Abrahamian et al., 2024; Catara et al., 1993; EPPO, 2024; Sun and Yokomi, 2024; Jin et al., 2024). Since 2022, considering the potential impact of this emerging virus, CYVCV has been included in the EPPO alert list and it has not been reported in any European Union (EU) Member State where the virus is not regulated. To ascertain possible infection with CYVCV, leaf samples were collected and tested by reverse transcription polymerase chain reaction (RT-PCR). Total nucleic acids (TNAs) from leaves of the symptomatic lemon and non-symptomatic lemon and sweet orange (Citrus sinensis (L.) Osbeck) trees grown in the same garden, were extracted using the silica-capture extraction method (Foissac et al. 2001). TNAs were tested by RT-PCR using CYVCV specific primers (Table S1) designed by Chen et al., (2014) targeting the coat protein gene. All symptomatic trees and an asymptomatic sweet orange from the same garden tested positive generating an amplicon of the expected size (612 bp). Direct Sanger sequencing of amplicons obtained from two symptomatic lemons and one non-symptomatic sweet orange (An PP842725-PP842727) followed by BLAST search showed 97.9-98.08% sequence identity (query coverage 100%) with CYVCV isolates previously reported from a mandarin (An OQ418501) and a lemon (An OQ418493) in California. In contrast, no amplicons were detected in samples from non-symptomatic lemon trees. Virus identity was confirmed by RT-PCR with different primers (Table S1) targeting the RNA-dependent RNA polymerase gene of CYVCV. Amplicons of the expected size (832 bp) were obtained only from samples previously tested positive to the virus and their sequences determined by Sanger sequence (An PQ284953-PQ284955) showed 97.98-98.11% identity (query coverage 100%) with CYVCV sequence previously reported from a mandarin (An OR251443) in New Delhi. Since CYVCV is transmitted by insects (Önelge et al., 2011a, 2011b, Zhang et al., 2018, 2019), TNAs (Foissac et al., 2001) from Aphis aurantii infesting symptomatic lemons, and of A. spiraecola and Dialeurodes citri infesting symptomatic lemon and non-symptomatic sweet orange trees were assayed by RT-PCR with primer pairs designed by Chen et al., (2014). Three samples of 15 specimens from three different trees were tested for each insect. In contrast to D. citri, which tested negative, an amplicon of 612 bp was detected from A. aurantii and A. spiraecola and Direct sequencing of amplicons (An PP842721-PP842724) confirmed the nature of the virus and showed that insect-derived viral sequences shared nucleotide identity of 99.3-100% with those from the infected trees. Altogether, these data support that CYVCV is present in Southern Italy. Likely, it has been introduced illegally through infected citrus propagation material. Given the large A. aurantii and A. spiraecola populations in the areas where CYVCV has been detected, a fast spread of the virus to other areas of Campania region can be expected. Even if the impact of CYVCV on citrus production in Italy remains to be assessed, prompt and extensive surveys may be helpful to establish the actual distribution of the virus. This would allow for a better evaluation of appropriate measures to be adopted to achieve sustainable citrus production. At the best of our knowledge, this is the first report of CYVCV in Italy and in the EU territory.

Citrus yellow vein clearing virus infection triggers phloem remobilization of iron- and zinc-nicotianamine in citrus.

Citrus yellow vein clearing virus (CYVCV) is a worldwide and highly destructive disease of citrus, but the mechanisms involved in CYVCV-inhibited plant growth are not well understood. This study examined nutrient levels and their cellular distribution in different organs of healthy and CYVCV-affected citrus (Citrus reticulata 'Kanpei') plants. We found that CYVCV-infected plants exhibit characteristic symptoms, including a significant reduction in iron (Fe) and other elemental nutrients in the shoots. Our data suggest that CYVCV-induced chlorosis in citrus leaf veins is primarily due to iron deficiency, leading to reduced chlorophyll synthesis. Further analysis revealed a marked decrease in iron concentration within the pith and xylem of citrus petioles post-CYVCV infection, contrasting with increased Fe and zinc (Zn) concentrations in the phloem. Moreover, a substantial accumulation of starch granules was observed in the pith, xylem, and phloem vessels of infected plants, with vessel blockage due to starch accumulation reaching up to 81%, thus significantly obstructing Fe transport in the xylem. Additionally, our study detected an upregulation of genes associated with nicotinamide metabolism and Fe and Zn transport following CYVCV infection, leading to increased levels of nicotinamide metabolites. This suggests that CYVCV-infected citrus plants may induce nicotinamide synthesis in response to Fe deficiency stress, facilitating the transport of Fe and Zn in the phloem as nicotinamide-bound complexes. Overall, our findings provide insight into the mechanisms of long-distance Fe and Zn transport in citrus plants in response to CYVCV infection and highlight the role of nutritional management in mitigating the adverse effects of CYVCV, offering potential strategies for cultivating CYVCV-resistant citrus varieties.

Glycerophosphodiester phosphodiesterase 1 mediates G3P accumulation for Eureka lemon resistance to citrus yellow vein clearing virus

Abstract Glycerophosphodiester phosphodiesterase 1 (GDPD1) plays an important function in the abiotic stress responses and participates in the accumulation of sn-glycerol-3-phosphate (G3P) in plants, which is key to plant systemic acquired resistance (SAR). However, the role of GDPD1 in plant responses to biotic stress remains poorly understood. This study characterized the antivirus function of the GDPD1 gene (designated as ClGDPD1) from Eureka lemon. ClGDPD1 is located in the membrane and endoplasmic reticulum, where it interacts with the citrus yellow vein clearing virus (CYVCV) coat protein (CP). Compared to individually express ClGDPD1 or co-expressed ClGDPD1 + CP140-326, transiently co-expressed ClGDPD1 + CP or ClGDPD1 + CP1-139 significantly up-regulated the key substance contents and genes expression involved in glycerophospholipid metabolism. Over-expression of ClGDPD1 significantly facilitated the accumulation of G3P, up-regulated the expression of SAR-related genes, and increased the resistance of transgenic Eureka lemon to CYVCV infection. Furthermore, exogenous glycerol treatment and over-expression of ClGPDH increased the G3P content and reduced CYVCV titers in plants or hairy roots. These results indicated that the enhanced resistance of ClGDPD1 transgenic Eureka lemon to CYVCV may be due to facilitating G3P accumulation through the interaction of ClGDPD1 with CP. Our findings provide novel insights into the role of ClGDPD1 as an important regulatory center in mediating the citrus defense response to viral infections.

The Discovery of a Citrus Yellow Vein Clearing Virus Hacienda Heights Isolate Diversifies the Geological Origins of the Virus in California, United States.

The citrus yellow vein clearing virus (CYVCV) is an emerging threat to the U.S. citrus industry. Reports from China shows it cause significant reductions in fruit yield and growth, particularly in lemon trees. In 2022, CYVCV was detected in a wide range of citrus cultivars in localized urban properties in Tulare, California. In 2024, a CYVCV-infected lemon tree was detected in Hacienda Heights in Los Angeles County, California, geographically separated from the Tulare foci. Through long-read sequencing technology, the whole-genome sequence of a CYVCV isolate from Hacienda Heights (designated as CYVCV-CA-HH1, Accession number PP840891.1) was obtained. Sequence alignments and neighbornet analysis strongly suggested that the CYVCV-CA-HH1 isolate has a different origin than the Tulare CYVCV (CYVCV CA-TL) isolates. The CYVCV CA-TL isolates were grouped with those from South Asia (India and Pakistan) and the Middle East (Türkiye), while the CYVCV-CA-HH1 isolate was grouped with isolates from East Asia (China and South Korea). Maximum likelihood phylogenetic analysis further supports this finding, showing that the CYVCV-CA-HH1 isolate shares the most recent common ancestor with a South Korean lineage, which derives from Chinese isolates. Together, our data suggest a diverse geological origin of CYVCV isolates in California.

Lemon zinc finger protein ClSUP induces the accumulation of reactive oxygen species and inhibits citrus yellow vein-clearing virus infection via interactions with ClDOF3.4.

Citrus yellow vein-clearing virus (CYVCV) is an increasing threat to citrus cultivation. Notably, the role of zinc finger proteins (ZFPs) in mediating viral resistance in citrus plants is unclear. In this study, we demonstrate that ZFPs ClSUP and ClDOF3.4 enhance citrus defense responses against CYVCV in Eureka lemon. ClSUP interacted with the coat protein (CP) of CYVCV to reduce CP accumulation and inhibit its silencing suppressor function. Overexpression of CISUP triggered reactive oxygen species (ROS) and salicylic acid (SA) pathways, and enhanced resistance to CYVCV infection. In contrast, ClSUP-silencing resulted in increased CP accumulation and down-regulated ROS and SA-related genes. ClDOF3.4 interacts with ClSUP to facilitate its interactions with CP. Furthermore, ClDOF3.4 synergistically regulated the accumulation of ROS and SA with ClSUP and accelerated the down-regulation of CP accumulation. Transgenic plants co-expressing ClSUP and ClDOF3.4 remarkedly decrease the CYVCV. These findings provide a new reference for understanding the interaction mechanism between the host and CYVCV.

Genetic Analysis of the Emerging Citrus Yellow Vein Clearing Virus Reveals a Divergent Virus Population in American Isolates.

Citrus yellow vein clearing virus is a previously reported citrus virus from Asia with widespread distribution in China. In 2022, the California Department of Food and Agriculture conducted a multipest citrus survey targeting multiple citrus pathogens including citrus yellow vein clearing virus (CYVCV). In March 2022, a lemon tree with symptoms of vein clearing, chlorosis, and mottling in a private garden in the city of Tulare, California, tested positive for CYVCV, which triggered an intensive survey in the surrounding areas. A total of 3,019 plant samples, including citrus and noncitrus species, were collected and tested for CYVCV using conventional reverse transcription polymerase chain reaction, reverse transcription quantitative polymerase chain reaction, and Sanger sequencing. Five hundred eighty-six citrus trees tested positive for CYVCV, including eight citrus species not previously recorded infected under field conditions. Comparative genomic studies were conducted using 17 complete viral genomes. Sequence analysis revealed two major phylogenetic groups. Known Asian isolates and five California isolates from this study made up the first group, whereas all other CYVCV isolates from California formed a second group, distinct from all worldwide isolates. Overall, the CYVCV population shows rapid expansion and high differentiation indicating a population bottleneck typical of a recent introduction into a new geographic area.

Occurrence and Multiplex PCR Detection of Citrus Yellow Vein Clearing Virus in Korea.

Citrus yellow vein clearing virus (CYVCV) is a member of the Alphaflexiviridae family that causes yellow vein clearing symptoms on citrus leaves. A total of 118 leaf samples from nine regions of six provinces in Korea were collected from various citrus species in 2020 and 2021. Viral diagnosis using next-generation sequencing and reverse transcription polymerase chain reaction (RT-PCR) identified four viruses: citrus tristeza virus, citrus leaf blotch virus, citrus vein enation virus, and CYVCV. A CYVCV incidence of 9.3% was observed in six host plants, including calamansi, kumquat, Persian lime, and Eureka lemon. Among the citrus infected by CYVCV, only three samples showed a single infection; the other showed a mixed infection with other viruses. Eureka lemon and Persian lime exhibited yellow vein clearing, leaf distortion, and water-soak symptom underside of the leaves, while the other hosts showed only yellowing symptoms on the leaves. The complete genome sequences were obtained from five CYVCV isolates. Comparison of the isolates reported from the different geographical regions and hosts revealed the high sequence identity (95.2% to 98.8%). Phylogenetic analysis indicated that all the five isolates from Korea were clustered into same clade but were not distinctly apart from isolates from China, Pakistan, India, and Türkiye. To develop an efficient diagnosis system for the four viruses, a simultaneous detection method was constructed using multiplex RT-PCR. Sensitivity evaluation, simplex RT-PCR, and stability testing were conducted to verify the multiplex RT-PCR system developed in this study. This information will be useful for developing effective disease management strategies for citrus growers in Korea.

Eureka lemon zinc finger protein ClDOF3.4 interacts with citrus yellow vein clearing virus coat protein to inhibit viral infection

Citrus yellow vein clearing virus (CYVCV) is a new citrus virus that has become an important factor restricting the development of China’s citrus industry, and the CYVCV coat protein (CP) is associated with viral pathogenicity. In this study, the Eureka lemon zinc finger protein (ZFP) ClDOF3.4 was shown to interact with CYVCV CP in vivo and in vitro. Transient expression of ClDOF3.4 in Eureka lemon induced the expression of salicylic acid (SA)-related and hypersensitive response marker genes, and triggered a reactive oxygen species burst, ion leakage necrosis, and the accumulation of free SA. Furthermore, the CYVCV titer in ClDOF3.4 transgenic Eureka lemon plants was approximately 69.4% that in control plants 6 mon after inoculation, with only mild leaf chlorotic spots observed in those transgenic plants. Taken together, the results indicate that ClDOF3.4 not only interacts with CP but also induces an immune response in Eureka lemon by inducing the SA pathways. This is the first report that ZFP is involved in the immune response of a citrus viral disease, which provides a basis for further study of the molecular mechanism of CYVCV infection.

Transcriptomic and Phytohormone Metabolomics Provide Insight into the Changes in Citrus limon Infected by Citrus yellow vein clearing virus

Background: Citrus yellow vein-clearing virus (CYVCV) is a Mandarivirus that causes great economic losses in lemon production. CYVCV infection is associated with obvious yellow vein-clearing disease symptoms and is directly regulated by plant hormone responses. Methods: To understand how lemon plants respond to CYVCV infection, we performed transcriptomic and phytohormone metabolomics. Results: A total of 936 differentially expressed genes were identified, and 773 were downregulated. Salicylic acid and auxin levels increased after CYVCV infection, and phytohormone regulatory systems were also explored. Jasmonic acid and auxin levels decreased after the CYVCV challenge, and jasmonic acid and auxin signaling pathway components were mostly downregulated. The differentially expressed genes (DEGs) involved in the immune response to viral infection, including those related to cell wall integrity, lectin, microtubules, and mildew resistance locus O (MLO), may also provide new candidate targets for CYVCV control. Conclusions: Our findings provide new insights into the molecular changes underlying the pathogenesis of CYVCV in lemon plants.

Comprehensive Assessment of Reference Gene Expression within the Whitefly Dialeurodes citri Using RT-qPCR.

The citrus whitefly, Dialeurodes citri, is a destructive pest that infests citrus plants. It is a major vector in transmitting plant viruses such as citrus yellow vein clearing virus (CYVCV), which has caused severe economic losses worldwide, and therefore efficient control of this pest is economically important. However, the scope of genetic studies primarily focused on D. citri is restricted, something that has potentially limited further study of efficient control options. To explore the functionalities of D. citri target genes, screening for specific reference genes using RT-qPCR under different experimental conditions is essential for the furtherance of biological studies concerning D. citri. The eight candidate reference genes were evaluated by dedicated algorithms (geNorm, Normfinder, BestKeeper and ΔCt method) under five specific experimental conditions (developmental stage, sex, tissue, population and temperature). In addition, the RefFinder software, a comprehensive evaluation platform integrating all of the above algorithms, ranked the expression stability of eight candidate reference genes. The results showed that the best reference genes under different experimental settings were V-ATP-A and RPS18 at different developmental stages; α-tubulin, 18S and V-ATP-A in both sexes; EF1A and α-tubulin in different tissues; Actin and Argk under different populations; and RPS18 and RPL13 in different temperatures. The validation of selected reference genes was further identified using heat shock protein (Hsp) 70 as a reporter gene. Our study, for the first time, provides a detailed compilation of internal reference genes for D. citri that are suitable for RT-qPCR analysis, which is robust groundwork for comprehensive investigation of the functional target genes of D. citri.

Development of Simplified Recombinase Polymerase Amplification Assay for Rapid and Robust Detection of Citrus Yellow Vein Clearing Virus.

Citrus is an economically important fruit crop, belongs to family Rutaceae, cultivated commercially in over 130 countries, which holds a leading profitable position in the international market. The most important citrus varieties are mandarins, oranges, lemons, sweet limes, grapefruits and pomelos. Citrus yellow vein clearing virus (CYVCV) is an important graft transmissible plant pathogen known to reduce productivity of citrus fruits due to its predominant association and widespread occurrence. Requirement of fast, reliable, efficient & economical CYVCV indexing assay is a prerequisite for production of healthy planting material. Currently, nucleic acid isolation and thermal cycler-based assay available for CYVCV indexing is a cumbersome lab intensive method. The present study was undertaken to develop and validate reverse transcription-recombinase polymerase amplification (RT-RPA) assay requiring no tedious RNA isolation, separate cDNA synthesis and costlier instrument like thermo-cycler. Optimized RT-RPA assay was able to amplify CYVCV up to 10-7 dilution (equivalent to 0.1pg/μl) with the prepared templates of both RNA and crude saps and showed higher sensitivity in detection of CYVCV infection in field samples as compared to the conventional RT-PCR. Developed RT-RPA assay showed high specificity without any cross-reaction with other citrus pathogens (Indian citrus ringspot virus, citrus yellow mosaic virus, citrus tristeza virus, citrus exocortis viroid and huanglongbing). RT-RPA using crude leaf sap as template is quite simple, robust, highly sensitive, time and cost effective; therefore, it can be used in resource constrained laboratories as screening tool, for field surveys and on-site testing programs in farms, nurseries and biosecurity. Present study, first time reports the development, optimization and validation of crude sap-based RT-RPA assay for the detection of CYVCV infection in citrus plants namely; Kinnow mandarin, Mosambi and Grape fruit.

Genotype Sequencing and Phylogenetic Analysis Revealed the Origins of Citrus Yellow Vein Clearing Virus California Isolates.

The Citrus yellow vein clearing virus (CYVCV) causes a viral disease that has been reported in some citrus-growing regions in countries in Eurasia including Pakistan, India, Türkiye, Iran, China, and South Korea. Recently, CYVCV was detected in a localized urban area in a town in the middle of California's citrus-growing region and marks the first occurrence of the virus in North America. CYVCV has been reported to be spread by aphid and whitefly vectors and is graft and mechanically transmitted. Hence, it is an invasive pathogen that presents a significant threat to the California citrus industry, especially lemons, which are highly symptomatic to CYVCV. To elucidate the origin of the CYVCV California strain, we used long-read sequencing technology and obtained the complete genomes of three California CYVCV isolates, CA1, CA2, and CA3. The sequences of these isolates exhibited intergenomic similarities ranging from 95.4% to 97.4% to 54 publicly available CYVCV genome sequences, which indicated a relatively low level of heterogeneity. However, CYVCV CA isolates formed a distinct clade from the other isolates when aligned against other CYVCV genomes and coat protein gene sequences as shown by the neighbor network analysis. Based on the rooted Maximum Likelihood phylogenetic trees, CYVCV CA isolates shared the most recent common ancestor with isolates from India/South Asia. Bayesian evolutionary inferences resulted in a spatiotemporal reconstruction, suggesting that the CYVCV CA lineage diverged from the Indian lineage possibly around 1995. This analysis placed the origin of all CYVCV to around 1990, with South Asia and/or Middle East as the most plausible geographic source, which matches to the first discovery of CYVCV in Pakistan in 1988. Moreover, the spatiotemporal phylogenetic analysis indicated an additional virus diffusion pathway: one from South Asia to China and South Korea. Collectively, our phylogenetic inferences offer insights into the probable dynamics of global CYVCV dissemination, emphasizing the need for citrus industries and regulatory agencies to closely monitor citrus commodities crossing state and international borders.

The coat protein of citrus yellow vein clearing virus directly targets the ascorbate peroxidase 1 in lemon (ClAPX1) to facilitate virus accumulation

Reactive oxygen species (ROS) are closely related to the antiviral immune response of plants, while virus can regulate ROS through various pathways to facilitate their own infection or replication. Citrus yellow vein clearing virus (CYVCV) is one of the most devastating viruses affecting lemon (Citrus limon) industry worldwide. However, the pathogenesis of CYVCV remains poorly understood. In this study, direct interaction between the coat protein (CP) of CYVCV and the ascorbate peroxidase 1 of lemon (ClAPX1) was confirmed for the first time by yeast two-hybrid, Bimolecular Fluorescence Complementation, and Co-immunoprecipitation assays. Transient expression of CP in lemon and Nicotiana benthamiana significantly enhanced the enzyme activity of the ClAPX1, and then inhibited the accumulation of H2O2. In addition, overexpression of ClAPX1 in lemon by transgene significantly promoted CYVCV accumulation and depressed the expression of most genes involved in jasmonic acid (JA) signaling pathway. Correspondingly, ClAPX1 silencing by RNA interference inhibited CYVCV accumulation and increased the expression of most genes involved in JA signaling pathway. To our knowledge, this is the first report that viruses regulate ROS by targeting APX directly, thereby suppressing host immune response and promoting viral accumulation, which may be mediated by JA signaling pathway.

First Report of citrus virus A infecting citrus (Citrus reticulata Blanco) in China.

Citrus is one of the most popular fruit crops in the world. Citrus virus A (CiVA, species Coguvirus eburi, genus Coguvirus) is a newly identified virus (Navarro et al. 2018) with two negative-sense single-stranded RNAs (RNA1 and RNA2). To date, CiVA has been detected on different citrus species in South Africa, U.S.A. and Greece (Bester et al. 2021; Park et al. 2021; Beris et al. 2021). CiVA has not been reported in China. In Sept. 2018, virus-like symptoms of leaf mottling, leaf flecking, and oak leaf patterns were observed on 'Orah' mandarin (Or) and 'Harumi' tangor (Ht) trees grown in Neijiang (NJ, Sichuan Province) and on Citrus reticulata cv.'Jinqiushatangju' (Jq) trees in Guizhou Province (GZ). Two mixed leaf samples (HY-NJ: 1 Or and 1 Ht and GZ-1: 2 Jq) were collected from symptomatic trees and then subjected to high-throughput sequencing (HTS). Total RNA was extracted by TRIzol. The cDNA library was constructed after depleting ribosomal RNA using a TruSeq RNA Sample Prep Kit and sequenced by Illumina HiSeq X-ten platform with paired-end reads length of 150 bp. After removing adaptors, low-quality reads, and reads homologous to citrus hosts by CLC Genomics Workbench 11 (Qiagen, U.S.A.), 917,547 and 1,508,134 clean reads were obtained from 56,239,772 and 81,535,900 total reads for HY-NJ and GZ-1, respectively. De novo assembly of the clean reads by CLC Genomics Workbench 11 resulted in 2,181 contigs for HY-NJ and 3,718 contigs for GZ-1. BLASTX searches of the contigs against local virus (taxid:10239) and viroid datasets (taxid:2559587) downloaded from NCBI allowed identification of several viruses and viroids. CiVA, citrus leaf blotch virus, citrus yellow vein clearing virus (CYVCV), and citrus psorosis virus (CPsV) were detected in HY-NJ. CiVA, hop stunt viroid, citrus viroid VI, citrus viroid V, citrus exocortis viroid, citrus dwarfing viroid, citrus bent leaf viroid, citrus bark cracking viroid, CYVCV, citrus tristeza virus, apple stem grooving virus, and CPsV were also detected in GZ-1. The lengths of the CiVA contigs were 6,682-nt and 6,670-nt matching RNA1 and 2,728-nt and 2,715-nt matching RNA2, respectively. The average coverage depth of clean reads mapped to CiVA-related contigs in HY-NJ was 64.90 and 156.54 for RNA1 and RNA2, respectively, and 26.50 and 558.08 in GZ-1. The full-length genomes of CiVA in HY-NJ and GZ-1 were determined by Sanger sequencing of six overlapping cDNA fragments obtained by RT-PCR and 5' and 3' RACE. At least 5 molecular clones were randomly selected for each fragment. The NJ isolate had a 6,690 nt RNA1 (GenBank accession no. MZ436805) and a 2,740 nt RNA2 (MZ436807). The GZ isolate had a 6,688 nt RNA1 (MZ436804) and a 2,734 nt RNA2 (MZ436806). BLASTN showed that the NJ and GZ isolates have 99.31 to 99.60% sequence identity to the isolate CG301 (MT922052; MT9220523). A phylogenetic tree constructed from nucleotide sequences indicated that the NJ and GZ isolates are closely related to the CG301 isolate. Among 105 citrus samples (35 Or and 30 Ht from NJ and 50 Jq from GZ) randomly collected, 11 samples (4 Or, 2 Ht and 5 Jq) with similar symptoms tested positive by RT-PCR using generic primers designed from conservative regions of RNA2 (F: TTGCAGTAGTGAGAAGGGAGT; R: TCAAAAGAGGCAGTGGTAGGA). To our knowledge, this is the first report of CiVA infecting citrus trees in China. The results will help facilitate further research to assess the threat of CiVA to citrus growing areas in China.

The interaction between the lemon ribosomal protein ClRPS9-2 and citrus yellow vein clearing virus coat protein affects viral infection and gene silencing suppressor activity.

Citrus yellow vein clearing virus (CYVCV) is an emerging virus that causes serious economic damage to the lemon industry worldwide. The coat protein (CP) of CYVCV is a strong RNA silencing suppressor and is associated with the severity of symptoms in citrus, yet the interaction between CP and host factors remains unknown. In this study, the 40S ribosomal subunit protein S9-2 (ClRPS9-2) was identified as a CP-binding partner using the yeast two-hybrid system from a lemon (cv. Eureka) cDNA library, and the interaction between CP and ClRPS9-2 was demonstrated by in vivo methods. The results suggest that the N-terminal 8-108 amino acid sequence of ClRPS9-2 is crucial for its interaction with CP and may be associated with the nuclear localization of ClRPS9-2. The accumulation and silencing suppressor activity of CP were reduced by transient expression of ClRPS9-2 in Nicotiana benthamiana. Reverse transcription-quantitative PCR analysis showed that the content of CYVCV in ClRPS9-2 transgenic Eureka lemon plants was approximately 50% of that in CYVCV-infected wild-type plants 1 month after inoculation, and mild yellowing and vein clearing symptoms were observed in the transgenic plants. These findings demonstrate that ClRPS9-2 plays a role in host defensive reactions, and the enhanced resistance of transgenic plants to CYVCV may be associated with the up-regulation of salicylic acid-related and R genes.

Detection of Mandarivirus and greening bacterium using electron microscopy, PCR and RT-PCR in Kinnow mandarin nurseries in Punjab

Kinnow mandarin is one of the most important fruit crops in northern India particularly in Punjab. Indian citrus ringspot virus (ICRSV), Citrus yellow vein clearing virus (CYVCV) and citrus greening bacterium (CGB) are very important graft transmissible pathogens causing reduced productivity in Kinnow mandarin. A survey was undertaken in 11 kinnow mandarin nurseries, 2 to 4 star rated by National Horticultural Board in Punjab. Samples collected from these nurseries were indexed by electron microscopy, immunosorbent electron microscopy (ISEM), PCR and RT-PCR. In RT-PCR test, out of 33 samples of kinnow mandarin mother plants, 3 samples were found positive for CYVCV and 6 samples for ICRSV. In two nurseries, both the viruses were detected in the same plant indicating mixed infection in the mother plants. In ISEM test, 4 samples out of 12 samples were positive for ICRSV and 2 samples were positive for CYVCV. CGB was detected in two plants out of nine plant leaf samples collected from four nurseries. In view of these studies it is evident that molecular diagnostics as indexing tool need to be applied for the production of clean planting material of kinnow mandarin.

Identification of citrus APX gene family and their response to CYVCV infection.

Ascorbate peroxidase (APX) is one of the most important antioxidant enzymes in the reactive oxygen metabolic pathway of plants. The role of APX under biotic and abiotic stress conditions has been explored, but the response pattern of APX under biotic stresses is relatively less known. In this study, seven CsAPXs gene family members were identified based on the sweet orange (Citrus sinensis) genome and subjected to evolutionary and structural analysis using bioinformatics software. The APX genes of lemon (ClAPXs) were cloned and showed a high conservation to CsAPXs by sequences alignment. In citrus yellow vein clearing virus (CYVCV)-infected Eureka lemons (C. limon) at 30th day post inoculation, APX activity and accumulation of hydrogen peroxide (H2O2) and malondialdehyde were measured to be 3.63, 2.29, and 1.73 times to that of the healthy control. The expression levels of 7 ClAPX genes in different periods of CYVCV-infected Eureka lemon were analyzed. Notably, ClAPX1, ClAPX5, and ClAPX7 showed higher expression levels compared to healthy plants, while ClAPX2, ClAPX3, and ClAPX4 showed lower expression levels. Functional identification of ClAPX1 in Nicotiana benthamiana showed that increasing the expression of ClAPX1 could significantly reduce the accumulation of H2O2, and it was verified that ClAPX1 is located in the plasma membrane of the cell. The present study provided information on the evolution and function of citrus APXs and revealed for the first time their response pattern to CYVCV infection.

Estimating the distribution of chlorophyll content in CYVCV infected lemon leaf using hyperspectral imaging

Yellow vein clearing disease of lemon caused by the citrus yellow vein clearing virus (CYVCV) is a new devastating disease in lemon. Chlorophyll contents and distributions are critical biochemical parameters to assess this new disease. The objective of this study was to develop an efficient method for detecting chlorophyll contents and distributions in lemon leaves infected with CYVCV. Spectral reflectance and chlorophyll content data of healthy, nitrogen deficient, pesticide-damaged and the corresponding CYVCV-infected leaves were obtained. Successive projections algorithm, random frog, competitive adaptive reweighted sampling (CARS), synergy interval partial least squares and synergy interval partial least squares combined with successive projections algorithm were applied for reducing data dimension, respectively. Prediction models were built by applying least squares-support vector machine algorithm (LS-SVM). The results showed that the characteristic wavelengths were basically located in “green peak” (near 550 nm), “red valley” (near 680 nm), and “red edge” (680–750 nm). Prediction model based on the wavelengths extracted by CARS achieved the optimal prediction results with determination coefficient of 0.94, relative prediction deviation of 3.91 and root mean square error of 0.10 in testing set. Thus, the CARS algorithm combined with LS-SVM was applied for distributions of chlorophyll contents. The chlorophyll content of each pixel of the six types of leaves were displayed, and significantly reduced in the mesophyll tissue near the veins of CYVCV-infected leaves. These results suggest that the hyperspectral imaging coupled with CARS and LS-SVM can be used to efficiently measure the distribution of chlorophyll content in CYVCV infected lemon leaf, which provides a reference for a better understanding of the symptoms of disease.

Comparative transcriptome analysis of the Eureka lemon in response to Citrus yellow vein virus infection at different temperatures

The production of Eureka lemons (Citrus limon) is severely affected by Citrus yellow vein clearing virus (CYVCV). The symptoms induced by CYVCV in Eureka lemons can be reduced at high temperatures. To better understand the molecular mechanisms involved in Eureka lemon responses to CYVCV at high temperatures, chlorophyll content, protective enzyme activities, and chloroplast ultramicrostructure were analyzed in Eureka lemons infected with CYVCV and grown at 25 °C and 37 °C. Chlorophyll content, activity of ascorbate peroxidase (APX), and catalase (CAT) activity were significantly higher in CYVCV-infected lemons grown at 37 °C than at 25 °C. Leaf transcriptomics were also investigated in CYVCV-infected and mock-inoculated Eureka lemons grown at 25 °C and 37 °C. Functional analysis indicated that the differentially expressed genes (DEGs) including resistance-related genes (AGO4, PAL), chlorophyll degradation-related genes (CHL-1, CHL-2), antioxidant enzymes (APX2), and Transcription Factors (TFs) (MYB1R1/s3/12/14/48/111) might have been associated with the reduction in symptoms of CYVCV-infected Eureka lemons grown at higher temperature. This evidence contributes to a theoretical foundation for further study into the molecular basis underlying the interaction between Eureka lemons and CYVCV at high temperatures.

The Titer of Citrus Yellow Vein Clearing Virus Is Positively Associated with the Severity of Symptoms in Infected Citrus Seedlings.

Citrus yellow vein clearing virus (CYVCV), a new member of the genus Mandarivirus in the family Alphaflexiviridae, is the causal agent of citrus yellow vein clearing disease. CYVCV is transmitted to citrus by Dialeurodes citri, grafting, and contaminated knife blades, threatening citrus production. In this study, four infectious full-length complementary DNA clones of CYVCV (namely AY112, AY132, AY212, and AY221) derived from CYVCV isolate AY were obtained through yeast homologous recombination and inoculated to 'Eureka' lemon (Citrus limon Burm. f.) by Agrobacterium-mediated vacuum infiltration. Pathogenicity analysis indicated that the clones AY212 and AY221 caused more severe symptoms than AY112 and AY132. Northern blot and quantitative reverse transcription PCR analyses showed that the titers of virulent clones (AY212 and AY221) were significantly higher than those of attenuated clones (AY112 and AY132) in the infected 'Eureka' lemon seedlings. Subsequent comparative studies of viral infectivity, accumulation, and symptoms induced by AY221 in nine citrus cultivars indicated that the infectivity of AY221 varied from 25 to 100% between cultivars; 'Oota' ponkan (C. reticulata L.) showed the lowest infection rate, with mild symptoms, which might be a useful resource for CYVCY-resistance genes; and CYVCV titer was positively associated with the symptom development in infected citrus seedlings. In general, this report revealed the biological properties of CYVCV, thus laying a foundation for further investigation of pathogenic mechanisms in this virus.