Citrus Exocortis Research Articles

High-Throughput Sequencing Identified Multiple Fig Viruses and Viroids Associated with Fig Mosaic Disease in Iraq.

Mosaic is the most common viral disease affecting fig plants. Although the Fig mosaic virus is the leading cause of mosaic disease, other viruses are also involved. High-throughput sequencing was used to assess viral infections in fig plants with mosaic. The genomic DNA and total RNAseq of mosaic-symptomatic fig leaves were sequenced using the Illumina platform. The analysis revealed the presence of fig badnavirus 1 (FBV-1), grapevine badnavirus 1 (GBV-1), citrus exocortis viroid (CEVd), and apple dimple fruit viroid (ADFVd). The FBV-1 and GBV-1 sequences were 7,140 bp and 7,239 bp long, respectively. The two genomes encode one open reading frame containing five major protein domains. The viroids, CEVd and ADFVd, were 397 bp and 305 bp long. Phylogenetic analyses revealed a close relationship between FBV-1 and Iranian isolates of the same species, while GBV-1 was closely related to Russian grapevine badnavirus isolates (Tem64, Blu17, KDH48, and Pal9). CEVd was closely related to other Iraqi isolates, while ADFVd was strongly related to a Spanish isolate. A registered endogenous pararetrovirus, caulimovirus-Fca1, with a size of 7,556 bp, was found in the RNA transcripts with a low expression level. This integrant was also detected in the genomes of the two lines 'Horaishi' (a female line) and 'Caprifig 6085' (a male line). Phylogenetic analyses revealed that caulimovirus-Fca1 was distinct from two other clades of different endogenous virus genera.

Resistance Induction in Two Alfalfa Varieties to Bean Leafroll Virus and Citrus Excortis Viroid Using Some Botanicals and Amino Acids Preparations

Many researches have been conducted so far in the topic of controlling the Bean leafroll virus and Citrus exocortis viroid. This study was conducted in a private farm at Balad district from September 1, 2023, to January 6, 2024, and aimed to evaluate the efficacy of azolla and clover plant extract, fosetyl aluminum pesticide, and Debal against Bean leafroll virus in the presence of Citrus exocortis viroid in diseased alfalfa. The diagnosis was confirmed for the whole genome of the virus and viroid under study using next generation sequencing technology. The resulting sequences were compared in the International Gene Bank database NCBI. The virus was the 1st record registered in Iraq, which was registered with a accession number PP889325, and the viroid genome was registered for the first time in the NCBI database with an accession number PP869624. Findings of the field experiment showed that the treatments were effective in reducing infection rates and disease severity beside increasing plant defense enzymes (catalase, polyphenol oxidase, and peroxidase) in virus infected alfalfa. Debal treatment, individual or in combination, recorded the highest rate leaf content of catalase (8.00), polyphenol oxidase (3.70), and peroxidase (4.13), with values significantly differed from infected untreated control treatment that recorded 3.33, 0.91, and 0.81, respectively.

First Report of Citrus Leaf Blotch Virus on Nagami Kumquat in Turkey.

Kumquat, known as the smallest of citrus fruits, has seen an increase in the number of commercial orchards in recent years. In May of 2022, a PCR-based survey for citrus virus diseases was conducted in commercial Nagami kumquat (Fortunella margarita (Lour.) Swingle) orchards in the Cukurova region of Turkey. During the survey, five trees with bud union disorder symptoms were found in two different kumquat orchards in the Erdemli district of Mersin province. Young leaf samples from the five trees showing bud union disorder symptoms and two symptomless trees were collected from 6-year-old kumquat. Common citrus viruses and viroids, such as citrus psorosis virus, citrus exocortis viroid, and hop stunt viroid, were not detected in PCR tests performed on all collected samples. The samples were also tested for citrus leaf blotch virus (CLBV; genus Citrivirus, family Betaflexiviridae), a virus associated with a bud union crease in kumquat (Vives et al.2001). Total RNA was isolated from collected leaf samples using the RNeasy Plant Mini Kit (Qiagen, USA). In the RT-PCR assay, two separate specific primer pairs were used to determine the presence of CLBV. The coat protein gene (CP), was amplified with primers KU-18 (5'-TTAAGATTACAGACACGAAGG- 3') and KU-19 (5' CTGTTTTTGAATTTTGCTCG-3'), and the RNA-dependent RNA polymerase gene (RdRp) was amplified with KU-27(5'-GATGCAAGCCAGGATGAATAC-3') and KU-15 (5'-CAGACACTCCAAGACCTTTCC-3') primers (Vives et al. 2002). All of symptomatic samples yielded amplicons of the expected size (456-bp RdRp and 438-bp CP). No amplicons were obtained from symptomless samples. Two PCR products were sequenced to confirm their identity by direct sequencing (GenBank accession no: OQ718432, OQ718433, PP726107, PP726108). Consensus sequences of these two genes showed 96% and 97% nt identity with CP and RdRP genes of the CLBV sequence in GenBank (MT038390, EU857539), respectively. For biological indexing, four RT-PCR-positive samples were used as inoculum sources. Four of Etrog citron (C. medica) and four of Dweet tangor (C. tangerina) seedlings were graft-inoculated for each source, and two seedlings for each cultivar were used as a negative control. Two months later, chlorotic blotching symptoms were observed on Dweet tangor leaves. Six months later, Etrog citron exhibited stem pitting symptoms. None of the negative control seedlings developed any symptoms. RT-PCR was performed to confirm the presence of CLBV in the virus-inoculated seedlings, and amplicons of the expected sizes (456-bp RdRp and 438-bp CP) were obtained. To the best of our knowledge, this is the first report of the CLBV infection in citrus in Turkey. CLBV is thought to have originated from infected grafting material in the country, although it is not known where it may have originated. Further research is needed to determine the distribution of CLBV and its potential to impact commercial citrus production in Turkey.

The Elimination of Viroids through In Vitro Thermotherapy and a Meristem Tip Culture from a New Limonime Hybrid (Citrus x limon var. limon (L.) Burm. f. x Citrus latifolia var. latifolia)

Viruses and viroids pose a significant challenge in citriculture, and their control is crucial for plant health. This study evaluated the effectiveness of in vitro thermotherapy combined with a meristem tip culture for eliminating citrus exocortis viroid (CEVd) and hop stunt viroid (HSVd) from a new limonime hybrid (Citrus x limon var. limon x Citrus latifolia var. latifolia). The elimination success was confirmed by RT-PCR assays. The in vitro elimination rate for CEVd during the shoot proliferation stage (43%) was higher than for HSVd (21%). Accordingly, in the subsequent rooting stage, the in vitro elimination rate for CEVd (50%) was higher than for HSVd (33%). Successful CEVd and HSVd eradication at a 100% rate was confirmed in the ex vitro acclimatized plants in the greenhouse. The study also established an efficient micropropagation protocol. The optimal treatment for in vitro shoot induction was 0.5–2 mg L−1 benzyladenine (BA) + 0.5 mg L−1 gibberellic acid (GA3) + 0.25 mg L−1 naphthalene acetic acid (NAA), while for shoot elongation, it was 0.5 mg L−1 BA + 0.5 mg L−1 kinetin (KIN) + 0.5 mg L−1 GA3 + 0.25 mg L−1 NAA. Rooting was best promoted by 1 mg L−1 NAA. This study provides valuable insights for the mass production of viroid-free propagation material in this new lemon x lime hybrid, contributing to the conservation of genetic resources in citrus breeding programs through the combined application of in vitro thermotherapy and an in vitro meristem tip culture, a novel and highlighted achievement reported for the first time in this study.

Loquat (Eriobotrya japonica) Is a New Natural Host of Tomato Mosaic Virus and Citrus Exocortis Viroid.

Loquat leaves exhibiting obvious yellowing, blistering, mosaic, leaf upward cupping, crinkle, and leaf narrowing were identified in Panzhihua City, Sichuan Province, China. High-throughput sequencing (HTS) with the ribo-depleted cDNA library was employed to identify the virome in the loquat samples; only tomato mosaic virus (ToMV) and citrus exocortis viroid (CEVd) were identified in the transcriptome data. The complete genome sequence of ToMV and CEVd were obtained from the loquat leaves. The full-length genome of the ToMV-loquat is 6376 nt and comprises four open reading frames (ORFs) encoding 183 kDa protein, RNA-dependent RNA polymerase (RdRp), movement protein (MP), and coat protein (CP), respectively. A pairwise identity analysis showed that the complete sequence of the ToMV-loquat had a nucleotide identity between 98.5 and 99.3% with other ToMV isolates. A phylogenetic analysis indicated that ToMV-loquat was more closely related to ToMV-IFA9 (GenBank No. ON156781). A CEVd sequence with 361 nt in length was amplified based on the HTS contigs, sequence alignment indicated CEVd-loquat had the highest identity with the strain of CEVd-Balad (GenBank No. PP869624), phylogenetic analysis showed that CEVd-loquat was more closely related to CEVd-lettuce (GenBank No. ON993891). This significant discovery marks the first documentation and characterization of ToMV and CEVd infecting loquat plants, shedding light on potential threats to loquat cultivation and providing insights for disease management strategies.

Development of Simplified Recombinase Polymerase Amplification Assay for Rapid and Robust Detection of Citrus Yellow Vein Clearing Virus.

Citrus is an economically important fruit crop, belongs to family Rutaceae, cultivated commercially in over 130 countries, which holds a leading profitable position in the international market. The most important citrus varieties are mandarins, oranges, lemons, sweet limes, grapefruits and pomelos. Citrus yellow vein clearing virus (CYVCV) is an important graft transmissible plant pathogen known to reduce productivity of citrus fruits due to its predominant association and widespread occurrence. Requirement of fast, reliable, efficient & economical CYVCV indexing assay is a prerequisite for production of healthy planting material. Currently, nucleic acid isolation and thermal cycler-based assay available for CYVCV indexing is a cumbersome lab intensive method. The present study was undertaken to develop and validate reverse transcription-recombinase polymerase amplification (RT-RPA) assay requiring no tedious RNA isolation, separate cDNA synthesis and costlier instrument like thermo-cycler. Optimized RT-RPA assay was able to amplify CYVCV up to 10-7 dilution (equivalent to 0.1pg/μl) with the prepared templates of both RNA and crude saps and showed higher sensitivity in detection of CYVCV infection in field samples as compared to the conventional RT-PCR. Developed RT-RPA assay showed high specificity without any cross-reaction with other citrus pathogens (Indian citrus ringspot virus, citrus yellow mosaic virus, citrus tristeza virus, citrus exocortis viroid and huanglongbing). RT-RPA using crude leaf sap as template is quite simple, robust, highly sensitive, time and cost effective; therefore, it can be used in resource constrained laboratories as screening tool, for field surveys and on-site testing programs in farms, nurseries and biosecurity. Present study, first time reports the development, optimization and validation of crude sap-based RT-RPA assay for the detection of CYVCV infection in citrus plants namely; Kinnow mandarin, Mosambi and Grape fruit.

Molecular detection of Citrus exocortis viroid (CEVd), Citrus viroid-III (CVd-III), and Citrus viroid-IV (CVd-IV) in Palestine

Citrus hosts various phytopathogens that have impacted productivity, including viroids. Missing data on the status of viroids in citrus in Palestine were not reported. This study was aimed to detect any of Citrus exocortis viroid (CEVd), Citrus viroid-III (CVd-III), and Citrus viroid-IV (CVd-IV) in the Palestinian National Agricultural Research Center (NARC) germplasm collection Field inspections found symptoms such as leaf epinasty; vein discoloration, and bark cracking on various citrus varieties. RT-PCR revealed a significant prevalence of CVd-IV; CEVd and CVd-III (47%, 31%, and 22%; respectively). CVd-III variants with 91.3% nucleic acid sequence homology have been reported. The sequence of each viroid were deposited in GenBank as (OP925746 for CEVd, OP902248 and OP902249 for CVd-III-PS-1 and -PS-2 isolates, and OP902247 for CVd-IV). This was the first to report three of citrus viroids in Palestine, appealing to apply of phytosanitary measures to disseminate healthy propagating materials free from viroids.

Effects of RNA silencing during antagonism between citrus exocortis viroid and citrus bark cracking viroid in Etrog citron (Citrus medica).

Citrus exocortis viroid (CEVd) and citrus bark cracking viroid (CBCVd) are two important viroids that infect citrus plants and frequently occur as mixed infections in orchards. However, the mechanism of antagonism between the two viroids in mixed infections remains unclear. The CEVd/CBCVd-citron system and small RNA sequencing (sRNA-seq) were used to study the antagonism. When CBCVd was inoculated before CEVd, the CEVd titre was significantly reduced and the symptoms were attenuated. Viroid-derived sRNAs (vd-sRNAs) from CEVd and CBCVd were predominantly 21-nucleotide (nt) and 22-nt in length and had similar 5' base biases. Homologous sequences of the two viroids in the terminal right (TR) region are rich in vd-sRNAs, and the high frequency vd-sRNAs selected from the CBCVd TR region can be used to degrade the transcripts of CEVd invivo directly. These results suggest that RNA silencing may play an important role in the antagonism of the two viroids, thus deepening our understanding of the molecular interaction of long noncoding RNAs in woody plants.

Risk potential of international fruit trade for viroid spreading - case study on hop viroids in Europe

Most hops are produced in Europe; therefore, it is alarming that the citrus bark cracking viroid (CBCVd), the causal agent of the severe hop stunt disease, was detected in different nonadjacent hop growing countries. It is still unclear how the initial infection occurred since CBCVd is typically found in citrus and not in hops. To extent data for a viroid risk assessment, potential hosts were tested for the presence of viroids in grocery stores in the hop producing areas of Slovenia and Germany. Samples positive for hop-pathogenic viroids were further used for infection studies. The surveys covered CBCVd, hop stunt viroid (HSVd), citrus exocortis viroid (CEVd), citrus dwarfing viroid (CDVd), citrus viroid V (CVdV), and citrus bent leaf viroid (CBLVd). The results show that all tested viroids can be found in fruits sold in grocery stores, thus there is a risk of introducing CBCVd, HSVd, and other viroids into the hop growing regions via imported fruits and their remains. Furthermore, the transmission study reveals that CBCVd and HSVd infected citrus fruits can lead to infected plants, irrespective of the type of inoculum whether in the form of RNA extract, injected sap, or fruit peel in the soil. Finally, the phylogenetic analysis showed that the sequence diversity within viroid samples is high and that CBCVd and HSVd sequence variants can be found, which are almost identical to variants confirmed in hop. We assumed that fruit imports contribute to international viroid spreading and inappropriate handling like fruit waste deposition to agricultural lands is a serious risk factor.

First Report of citrus virus A infecting citrus (Citrus reticulata Blanco) in China.

Citrus is one of the most popular fruit crops in the world. Citrus virus A (CiVA, species Coguvirus eburi, genus Coguvirus) is a newly identified virus (Navarro et al. 2018) with two negative-sense single-stranded RNAs (RNA1 and RNA2). To date, CiVA has been detected on different citrus species in South Africa, U.S.A. and Greece (Bester et al. 2021; Park et al. 2021; Beris et al. 2021). CiVA has not been reported in China. In Sept. 2018, virus-like symptoms of leaf mottling, leaf flecking, and oak leaf patterns were observed on 'Orah' mandarin (Or) and 'Harumi' tangor (Ht) trees grown in Neijiang (NJ, Sichuan Province) and on Citrus reticulata cv.'Jinqiushatangju' (Jq) trees in Guizhou Province (GZ). Two mixed leaf samples (HY-NJ: 1 Or and 1 Ht and GZ-1: 2 Jq) were collected from symptomatic trees and then subjected to high-throughput sequencing (HTS). Total RNA was extracted by TRIzol. The cDNA library was constructed after depleting ribosomal RNA using a TruSeq RNA Sample Prep Kit and sequenced by Illumina HiSeq X-ten platform with paired-end reads length of 150 bp. After removing adaptors, low-quality reads, and reads homologous to citrus hosts by CLC Genomics Workbench 11 (Qiagen, U.S.A.), 917,547 and 1,508,134 clean reads were obtained from 56,239,772 and 81,535,900 total reads for HY-NJ and GZ-1, respectively. De novo assembly of the clean reads by CLC Genomics Workbench 11 resulted in 2,181 contigs for HY-NJ and 3,718 contigs for GZ-1. BLASTX searches of the contigs against local virus (taxid:10239) and viroid datasets (taxid:2559587) downloaded from NCBI allowed identification of several viruses and viroids. CiVA, citrus leaf blotch virus, citrus yellow vein clearing virus (CYVCV), and citrus psorosis virus (CPsV) were detected in HY-NJ. CiVA, hop stunt viroid, citrus viroid VI, citrus viroid V, citrus exocortis viroid, citrus dwarfing viroid, citrus bent leaf viroid, citrus bark cracking viroid, CYVCV, citrus tristeza virus, apple stem grooving virus, and CPsV were also detected in GZ-1. The lengths of the CiVA contigs were 6,682-nt and 6,670-nt matching RNA1 and 2,728-nt and 2,715-nt matching RNA2, respectively. The average coverage depth of clean reads mapped to CiVA-related contigs in HY-NJ was 64.90 and 156.54 for RNA1 and RNA2, respectively, and 26.50 and 558.08 in GZ-1. The full-length genomes of CiVA in HY-NJ and GZ-1 were determined by Sanger sequencing of six overlapping cDNA fragments obtained by RT-PCR and 5' and 3' RACE. At least 5 molecular clones were randomly selected for each fragment. The NJ isolate had a 6,690 nt RNA1 (GenBank accession no. MZ436805) and a 2,740 nt RNA2 (MZ436807). The GZ isolate had a 6,688 nt RNA1 (MZ436804) and a 2,734 nt RNA2 (MZ436806). BLASTN showed that the NJ and GZ isolates have 99.31 to 99.60% sequence identity to the isolate CG301 (MT922052; MT9220523). A phylogenetic tree constructed from nucleotide sequences indicated that the NJ and GZ isolates are closely related to the CG301 isolate. Among 105 citrus samples (35 Or and 30 Ht from NJ and 50 Jq from GZ) randomly collected, 11 samples (4 Or, 2 Ht and 5 Jq) with similar symptoms tested positive by RT-PCR using generic primers designed from conservative regions of RNA2 (F: TTGCAGTAGTGAGAAGGGAGT; R: TCAAAAGAGGCAGTGGTAGGA). To our knowledge, this is the first report of CiVA infecting citrus trees in China. The results will help facilitate further research to assess the threat of CiVA to citrus growing areas in China.

Combination of Cold Therapy and Chemotherapy for Eradication of Citrus exocortis Viroid

Combination of Cold Therapy and Chemotherapy for Eradication of Citrus exocortis Viroid

Development of Multiplex RT-PCR Assay for the Simultaneous Detection of Four Systemic Diseases Infecting Citrus

The citrus systemic diseases, including citrus Huanglongbing (caused by Candidatus Liberibacter asiaticus (CLas)), citrus tristeza (caused by citrus tristeza virus (CTV)), citrus tatter leaf (caused by citrus tatter leaf virus (CTLV)), and citrus exocortis (caused by citrus exocortis viroid (CEVd)), are threats to citrus production in Taiwan. Reliable diagnostic methods are important for the management of these systemic diseases. In this study, we developed a multiplex reverse transcription–polymerase chain reaction (RT-PCR) assay to detect four pathogens simultaneously. Herein, the specific amplicons from each pathogen (295 bp for CLas, 468 bp for CTV, 120 bp for CTLV, and 196 bp for CEVd) were successfully produced using the optimized multiplex RT-PCR described here. The sensitivity evaluation showed that low titers of pathogens could be detected using this multiplex RT-PCR. Compared with the published simplex assays, the detection of field samples using the multiplex RT-PCR developed in this study showed a better performance. The detections using multiplex RT-PCR revealed that these four citrus systemic pathogens were commonly found in fields, and 30.0% of field samples were mix-infected. To our knowledge, this is the first study of a survey of the four important citrus systemic diseases in Taiwan, and it provides insights for improving disease management. Therefore, the multiplex RT-PCR assay provides a useful method for routine disease surveying and the production of pathogen-free citrus plants.

Development and Statistical Validation of E-Probe Diagnostic Nucleic Acid Analysis (EDNA) Assays for the Detection of Citrus Pathogens from Raw High-Throughput Sequencing Data

The cost for high-throughput sequencing (HTS) has decreased significantly and has made it possible for the application of this technology for routine plant diagnostics. There are constraints to the use of HTS as a diagnostic tool, including the need for dedicated personnel with a bioinformatic background for data analysis and the lack of a standardized analysis pipeline that makes evaluating and validating results generated at different HTS laboratories difficult. E-probe diagnostic nucleic acid analysis (EDNA) is an in-silico bioinformatic tool that utilizes short curated electronic probes (e-probes) designed from pathogen-specific sequences that allow users to detect and identify single or multiple pathogens of interest in raw HTS data sets. This platform streamlines the bioinformatic data analysis into a graphical user interface as a plant diagnostic tool used by diagnosticians. In this study, we describe the process for the development, validation, and use of e-probes for detection and identification of a wide range of taxonomically unique citrus pathogens that include citrus exocortis viroid, citrus tristeza virus, ‘ Candidatus Liberibacter asiaticus’, and Spiroplasma citri. We demonstrate the process for evaluating the analytical and diagnostic sensitivity and specificity metrics of the in-silico EDNA assays. In addition, we show the importance of including background noise (internal controls) to generate variance in noninfected samples for a valid statistical test using the quadratic discriminant analysis. The fully validated EDNA assays from this study can be readily integrated into existing citrus testing programs that utilize HTS. [Formula: see text] Copyright © 2023 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license .

A reverse transcription loop-mediated isothermal amplification assay for the detection of citrus exocortis viroid in Australian citrus

Citrus exocortis viroid (CEVd), the causal agent of exocortis, is a pathogen that is thought to infect all citrus varieties, although it is asymptomatic in most. Symptoms of exocortis develop on susceptible rootstocks, resulting in stunting and yield reduction. To aid the detection and management of CEVd, a rapid near-field assay was developed using reverse transcription loop-mediated isothermal amplification (RT-LAMP) for the detection of the viroids in nursery and field trees. Over 240 CEVd sequences, including sequence variants from representative Australian isolates that induce mild and severe symptoms, were used in the design of the primers. The RT-LAMP successfully detected CEVd in a 1:1000 dilution (236 pg) of plant total RNA indicating high sensitivity, and also detected the viroid in rapid, crude plant extractions. The assay was highly specific to CEVd, given there was no cross-reactivity with other citrus-infecting pathogens. This new assay provides a simple, robust, specific, and sensitive method to detect CEVd in Australian citrus and to our knowledge, is the first RT-LAMP assay to detect any citrus-infecting viroid.

Diversity of viroids infecting grapevines in the South African Vitis germplasm collection.

Seven viroid species and one putative viroid species have been reported to infect grapevine namely, hop stunt viroid (HSVd), grapevine yellow speckle viroid 1 (GYSVd-1), grapevine yellow speckle viroid 2 (GYSVd-2), Australian grapevine viroid (AGVd), Japanese grapevine viroid (JGVd), grapevine latent viroid (GLVd), and citrus exocortis viroid (CEVd), as well as a grapevine hammerhead viroid-like RNA (GHVd), so far. In this study, RNA sequence (RNA-Seq) data, from 229 Vitis accessions from the field-maintained vineyard of the South African Vitis germplasm collection, were analysed to determine the diversity of the viroids present. Five of the seven known grapevine-infecting viroids and one putative grapevine-infecting viroid species were very commonly found, with 214 of the 229 samples containing at least one viroid species. HSVd, GYSVd-1, GYSVd-2, AGVd, and JGVd, as well as GHVd, were identified in the RNA-Seq data of the samples and confirmed using RT-PCR and Sanger sequencing. The HSVd sequences indicated the presence of two variants, with one showing multiple nucleotide insertions. AGVd and GYSVd-2 did not display significant sequence diversity, confirming past international studies. GYSVd-1 occurs as four major variants worldwide and representatives of all four variants were identified in this vineyard. This is the first report on the diversity of viroids infecting grapevine in South Africa and the first report of JGVd outside of Japan and GHVd in South Africa. Further studies are needed to fully assess the population and to identify potentially new viroid species.

PM 7/31 (2) Citrus tristeza virus

<scp>PM</scp> 7/31 (2) Citrus tristeza virus

Application of Real Time PCR for the Prevalence Determination of Citrus Exocortis Viroid (CEVd) in Algeria

Abstract Citrus exocortis is a grafting disease caused by Citrus Exocortis Viroid (CEVd). The knowledge of the viroid’s incidence and distribution are necessary to further apply control measures. The objective of this work was to apply the real time PCR assay for the detection of CEVd in samples collected from symptomatic CEVd-infected plants in Mitidja (North Algeria). The assay showed an excellent diagnostic specificity where 38 out of 50 samples showed a positive reaction for CEVd, which revealed the presence of CEVd in citrus orchards with a prevalence of 76%. Consequently, this work offers a quick alternative to conventional methods for the early diagnosis and the prevalence assessment of CEVd.

SlS5H silencing reveals specific pathogen-triggered salicylic acid metabolism in tomato

BackgroundSalicylic acid (SA) is a major plant hormone that mediates the defence pathway against pathogens. SA accumulates in highly variable amounts depending on the plant-pathogen system, and several enzyme activities participate in the restoration of its levels. Gentisic acid (GA) is the product of the 5-hydroxylation of SA, which is catalysed by S5H, an enzyme activity regarded as a major player in SA homeostasis. GA accumulates at high levels in tomato plants infected by Citrus Exocortis Viroid (CEVd), and to a lesser extend upon Pseudomonas syringae DC3000 pv. tomato (Pst) infection.ResultsWe have studied the induction of tomato SlS5H gene by different pathogens, and its expression correlates with the accumulation of GA. Transient over-expression of SlS5H in Nicotiana benthamiana confirmed that SA is processed by SlS5H in vivo. SlS5H-silenced tomato plants were generated, displaying a smaller size and early senescence, together with hypersusceptibility to the necrotrophic fungus Botrytis cinerea. In contrast, these transgenic lines exhibited an increased defence response and resistance to both CEVd and Pst infections. Alternative SA processing appears to occur for each specific pathogenic interaction to cope with SA levels. In SlS5H-silenced plants infected with CEVd, glycosylated SA was the most discriminant metabolite found. Instead, in Pst-infected transgenic plants, SA appeared to be rerouted to other phenolics such as feruloyldopamine, feruloylquinic acid, feruloylgalactarate and 2-hydroxyglutarate.ConclusionUsing SlS5H-silenced plants as a tool to unbalance SA levels, we have studied the re-routing of SA upon CEVd and Pst infections and found that, despite the common origin and role for SA in plant pathogenesis, there appear to be different pathogen-specific, alternate homeostasis pathways.

Diversity of Viruses and Viroids Infecting Taro in Kenya Based on Small RNA Sequencing and PCR Detection

Purpose: Viral diseases cause severe yield losses and quality decline in crops worldwide. Despite their economic significance, the occurrence and distribution of the major viruses and viroids infecting Taro in Kenya remain poor, limiting the development of robust disease management strategies to mitigate their spread. This study thus aimed to identify the viruses and viroids infecting Taro in Kenya as a basis for developing effective management strategies to support the prevention and control of Taro viruses.&#x0D; Methodology: Viral surveys and sampling were conducted across nine Taro-growing counties with diverse agroecological conditions in Kenya to determine the incidence and distribution of viruses affecting Taro. Leaf and whole plant samples of symptomatic edible and wild Taro were collected for PCR, RT-PCR, and small RNA sequencing assays to determine the diversity of viruses and viroids infecting Taro.&#x0D; Results: Disease-like symptoms, including stunting, leaf rolling, shrinkage, deformed leaves with mosaic and yellow veins, and dwarfism, were observed. An overall mean disease incidence of 32-60% was recorded in all sites surveyed. Small RNA sequencing revealed the presence of both DNA and RNA viruses. Detected DNA viruses included the Taro Bacilliform Virus (TaBV) and Taro Bacilliform CH Virus (TaBCHV), badnaviruses specific to Taro, the sweet potato Badnavirus B, sugarcane bacilliform virus, and sweet potato leaf curl virus. The RNA viruses included the sweet potato feathery mottle and Phaseolus vulgaris alphaendornavirus. A Citrus exocortis viroid was also detected. Interestingly, the wild relatives of Taro displayed very few viral sequence hits. This study reports the Taro viruses and viroids circulating in Kenya and is the first to describe the incidence, distribution, and sequence variability of TaBV in Kenya.&#x0D; Recommendations: Future studies should focus on developing effective management strategies to support the prevention and control of Taro viruses, including genetic resources for virus-Taro interactions, removing infected crops, controlling insect vectors, and developing virus-free planting materials.

First Report of Citrus Bent Leaf Viroid and Citrus Dwarfing Viroid in Argentina

Citrus Bent Leaf Viroid (CBLVd) and Citrus Dwarfing Viroid (CDVd), from genus Apscaviroid, are two of the widely distributed citrus viroids among the eight reported to date. They have been found to induce reduction in canopy volume and fruit production in citrus trees on trifoliate and trifoliate orange hybrids rootstocks. Moreover, citrus trees infected only with CBLVd or in combinations with Citrus Exocortis Viroid (CEVd), Hop Stunt Viroid (HSVd) and CDVd have been associated with a poor development of the root system. Samples of citrus trees showing viroid symptoms collected from citrus orchards in Tucumán, Salta, and Jujuy provinces (NW region in Argentina) were initially indexed on citron (Citrus medica) and then analyzed by s-PAGE. These samples were found to be infected with different viroid species, among them, CEVd and HSVd have been already identified. In order to determine the presence of other viroids, we performed a RT-PCR assay using specific primers for CBLVd, CDVd, CBCVd and CVd-V. Forty two samples including 15 lemons, 15 oranges, 8 grapefruits, 2 citrumelos and 2 Cleopatra mandarins were analyzed so far. On the basis of amplification of the appropriately sized DNA, CDVd was detected in thirty eight samples and CBLVd in all grapefruit samples. CBCVd and CVd-V were not found in any samples to date. Analysis of the sequence of amplicons revealed 96% and 97% identity with CBLVd GenBank reference sequences, and 96% to 98% with CDVd GenBank reference sequences. This is the first report of CBLVd and CDVd in citrus trees in Argentina.