Circular Viral Genomes Research Articles

Evasion of short interfering RNA-directed antiviral silencing in Musa acuminata persistently infected with six distinct banana streak pararetroviruses.

Vegetatively propagated crop plants often suffer from infections with persistent RNA and DNA viruses. Such viruses appear to evade the plant defenses that normally restrict viral replication and spread. The major antiviral defense mechanism is based on RNA silencing generating viral short interfering RNAs (siRNAs) that can potentially repress viral genes posttranscriptionally through RNA cleavage and transcriptionally through DNA cytosine methylation. Here we examined the RNA silencing machinery of banana plants persistently infected with six pararetroviruses after many years of vegetative propagation. Using deep sequencing, we reconstructed consensus master genomes of the viruses and characterized virus-derived and endogenous small RNAs. Consistent with the presence of endogenous siRNAs that can potentially establish and maintain DNA methylation, the banana genomic DNA was extensively methylated in both healthy and virus-infected plants. A novel class of abundant 20-nucleotide (nt) endogenous small RNAs with 5'-terminal guanosine was identified. In all virus-infected plants, 21- to 24-nt viral siRNAs accumulated at relatively high levels (up to 22% of the total small RNA population) and covered the entire circular viral DNA genomes in both orientations. The hotspots of 21-nt and 22-nt siRNAs occurred within open reading frame (ORF) I and II and the 5' portion of ORF III, while 24-nt siRNAs were more evenly distributed along the viral genome. Despite the presence of abundant viral siRNAs of different size classes, the viral DNA was largely free of cytosine methylation. Thus, the virus is able to evade siRNA-directed DNA methylation and thereby avoid transcriptional silencing. This evasion of silencing likely contributes to the persistence of pararetroviruses in banana plants. We report that DNA pararetroviruses in Musa acuminata banana plants are able to evade DNA cytosine methylation and transcriptional gene silencing, despite being targeted by the host silencing machinery generating abundant 21- to 24-nucleotide short interfering RNAs. At the same time, the banana genomic DNA is extensively methylated in both healthy and virus-infected plants. Our findings shed light on the siRNA-generating gene silencing machinery of banana and provide a possible explanation why episomal pararetroviruses can persist in plants whereas true retroviruses with an obligatory genome-integration step in their replication cycle do not exist in plants.

Reactivation of Chromosomally Integrated Human Herpesvirus-6 by Telomeric Circle Formation

More than 95% of the human population is infected with human herpesvirus-6 (HHV-6) during early childhood and maintains latent HHV-6 genomes either in an extra-chromosomal form or as a chromosomally integrated HHV-6 (ciHHV-6). In addition, approximately 1% of humans are born with an inheritable form of ciHHV-6 integrated into the telomeres of chromosomes. Immunosuppression and stress conditions can reactivate latent HHV-6 replication, which is associated with clinical complications and even death. We have previously shown that Chlamydia trachomatis infection reactivates ciHHV-6 and induces the formation of extra-chromosomal viral DNA in ciHHV-6 cells. Here, we propose a model and provide experimental evidence for the mechanism of ciHHV-6 reactivation. Infection with Chlamydia induced a transient shortening of telomeric ends, which subsequently led to increased telomeric circle (t-circle) formation and incomplete reconstitution of circular viral genomes containing single viral direct repeat (DR). Correspondingly, short t-circles containing parts of the HHV-6 DR were detected in cells from individuals with genetically inherited ciHHV-6. Furthermore, telomere shortening induced in the absence of Chlamydia infection also caused circularization of ciHHV-6, supporting a t-circle based mechanism for ciHHV-6 reactivation.

Two novel circo-like viruses detected in human feces: complete genome sequencing and electron microscopy analysis

The application of viral metagenomic techniques and a series of PCRs in a human fecal sample enabled the detection of two novel circular unisense DNA viral genomes with 92% nucleotide similarity. The viruses were tentatively named circo-like virus-Brazil (CLV-BR) strains hs1 and hs2 and have genome lengths of 2526 and 2533 nucleotides, respectively. Four major open reading frames (ORFs) were identified in each of the genomes, and differences between the two genomes were primarily observed in ORF 2. Only ORF 3 showed significant amino acid similarities to a putative rolling circle replication initiator protein (Rep), although with low identity (36%). Our phylogenetic analysis, based on the Rep protein, demonstrated that the CLV-BRs do not cluster with members of the Circoviridae, Nanoviridae or Geminiviridae families and are more closely related to circo-like genomes previously identified in reclaimed water and feces of a wild rodent and of a bat. The CLV-BRs are members of a putative new family of circular Rep-encoding ssDNA viruses. Electron microscopy revealed icosahedral (∼23nm) structures, likely reflecting the novel viruses, and rod-shaped viral particles (∼65–460×21×10nm in length, diameter, and axial canal, respectively). Circo-like viruses have been detected in stool samples from humans and other mammals (bats, rodents, chimpanzees and bovines), cerebrospinal fluid and sera from humans, as well as samples from many other sources, e.g., insects, meat and the environment. Further studies are needed to classify all novel circular DNA viruses and elucidate their hosts, pathogenicity and evolutionary history.

Comparative metagenomics: natural populations of induced prophages demonstrate highly unique, lower diversity viral sequences

To understand the similarities and differences between a free living viral population and its co-occurring temperate population, metagenomes of each type were prepared from the same seawater sample from Tampa Bay, FL. Libraries were prepared from extracted DNA of the ambient viruses and induced prophages from the co-occurring, viral-reduced microbial assemblage. Duplicate libraries were also prepared using the same DNA amplified by multiple displacement amplification. A non-viral-reduced, induced, amplified viral dataset from the same site in 2005 was reanalysed for temporal comparison. The induced viral metagenome was higher in identifiable virus sequences and differed from the other three datasets based on principal component, rarefaction, trinucleotide composition and contig spectrum analyses. This study indicated that induced prophages are unique and have lower overall community diversity than ambient viral populations from the same site. Both of the amplified contemporary metagenomes were enriched in single-stranded DNA (ssDNA) viral sequences. Six and 16 complete, circular ssDNA viral genomes were assembled from the amplified induced and ambient libraries, respectively, mostly similar to circoviruses. The amplified ambient metagenome contained genomes similar to an RNA-DNA hybrid virus recently identified in a hot spring and to an ssDNA virus infecting the diatom Chaetoceros.

Investigation of viruses in Diporeia spp. from the Laurentian Great Lakes and Owasco Lake as potential stressors of declining populations

The benthic amphipod Diporeia is an ecologically and biogeochemically important constituent of deep freshwater lakes in North America. The proliferation of dreissenid mussels in the mid-1990s coincided with a sharp decrease in Diporeia populations in several Laurentian Great Lakes; however the ultimate cause and mechanisms of their decline are still unknown. Here we examined the composition of DNA viruses associated with Diporeia collected from populations of Lake Michigan that had declined and stable populations in Lake Superior and Owasco Lake (Finger Lake in central New York State). Viral metagenomic libraries from Owasco Lake and Lake Superior were comprised primarily of bacteriophages, which may infect bacteria within the amphipod microbiome. In contrast, the metagenomic library from Lake Michigan contained well-represented ssDNA circular viral genomes. The prevalence and viral load of one putative Type V ssDNA circular virus (LM29173) that recruited almost 30% of total viral sequence reads in the Lake Michigan library was analyzed by quantitative PCR. The prevalence of LM29173 was over two orders of magnitude greater in Lake Michigan compared to the other two lakes. Although further research is necessary to establish the pathology and epidemiological extent of viral-Diporeia interactions, our data suggest that viruses may be numerically significant constituents of the Diporeia microbiome, and if pathogenic some of these viruses may be a stressor of Great Lakes Diporeia populations. Our data further indicate that special attention should be given to the circovirus that was prevalent in the declining Michigan population but uncommon in the other two lakes.

Integrated circoviral rep-like sequences in the genome of cyprinid fish

Recently a new group of circoviruses have been detected in tissues of Barbel fish and European catfish in Hungary. In our study circovirus genomes were screened in eight additional fish species for the detection and characterization of circoviruses. Two species of these bore circoviral sequences based on conventional PCR assay targeting the replication-associated protein coding gene fragments. Interestingly, the methods successfully used before failed to amplify other parts of the circular viral genome, suggesting the presence of partial, integrated genetic elements in the genome of the host. The successfully sequenced fragments of the Indian rohu (Labeo rohita) encoded mutations which may cause frameshifts or termination in the coding region described previously in other vertebrates. Phylogenetic analyses presumed that integration of the viral genetic elements might have progressed concurrently or following the diversification of cyprinid fish. Further studies on the nature of whole circovirus genomes and integrated elements may help to understand their potential role and evolution in different fish species.

L2, the minor capsid protein of papillomavirus

The capsid protein L2 plays major roles in both papillomavirus assembly and the infectious process. While L1 forms the majority of the capsid and can self-assemble into empty virus-like particles (VLPs), L2 is a minor capsid component and lacks the capacity to form VLPs. However, L2 co-assembles with L1 into VLPs, enhancing their assembly. L2 also facilitates encapsidation of the ∼8kbp circular and nucleosome-bound viral genome during assembly of the non-enveloped T=7d virions in the nucleus of terminally differentiated epithelial cells, although, like L1, L2 is not detectably expressed in infected basal cells. With respect to infection, L2 is not required for particles to bind to and enter cells. However L2 must be cleaved by furin for endosome escape. L2 then travels with the viral genome to the nucleus, wherein it accumulates at ND-10 domains. Here, we provide an overview of the biology of L2.

A divergent clade of circular single-stranded DNA viruses from pig feces

Using metagenomics and molecular cloning methods, we characterized five novel small, circular viral genomes from pig feces that are distantly related to chimpanzee and porcine stool-associated circular viruses, (ChiSCV and PoSCV1). Phylogenetic analysis placed these viruses into a highly divergent clade of this rapidly growing new viral family. This new clade of viruses, provisionally named porcine stool-associated circular virus 2 and 3 (PoSCV2 and PoSCV3), encodes a stem–loop structure (presumably the origin of DNA replication) in the small intergenic region and a replication initiator protein commonly found in other biological systems that replicate their genomes via the rolling–circle mechanism. Furthermore, these viruses also exhibit three additional overlapping open reading frames in the large intergenic region between the capsid and replication initiator protein genes.

Efficient expression and purification of tag-free Epstein–Barr virus EBNA1 protein in Escherichia coli by auto-induction

Epstein–Barr nuclear antigen 1 (EBNA1) is the essential Epstein–Barr virus (EBV) protein at the interface between the EBV genome and the host chromatin. It is EBNA1’s task to guarantee replication and segregation of the multicopy closed circular viral genome in infected cells. While EBNA1’s functions are relatively well understood, little is known about the molecular mechanisms of EBNA1 mediating chromatin tethering and DNA replication. To characterize those, purified EBNA1 would be a very useful tool in many different biochemical assays. For long, it was not possible to overexpress sufficient quantities of EBNA1 in Escherichia coli (E. coli) due to its rare codon usage, especially in the N-terminal part of the protein. Recently, some groups succeeded in purifying EBNA1 from bacteria using advanced inducible E. coli cells [1–3]. However, all purification procedures ended in a His-tagged version of EBNA1, which might influence EBNA1’s function in biological assays. Therefore, we inserted a tobacco etch virus (TEV)-cleavage site between the N-terminal His-tag and the following open reading frame of EBNA1. Using sequential Ni–NTA and gel filtration columns and TEV protease-mediated cleavage upon autoinduction, we were able to purify functional EBNA1 protein featuring just a single additional, artificial N-terminal glycine residue. Following our simple and fast purification scheme we were able to synthesize 2mg of highly pure EBNA1 protein per liter culture.

First Report of Tomato yellow leaf curl virus Infecting Common Bean in China.

Common bean (Phaseolus vulgaris) is one of the most economically important vegetable crops in China. In November 2011, symptoms with thickening and crumpling of leaves and stunting were observed on common bean with incidence rate of 50 to 70% in the fields of Huaibei, northern Anhui Province, China. Diseased common bean plants were found to be infested with large population of whiteflies (Bemisia tabaci), which induced leaf crumple symptoms in healthy common beans, suggesting begomovirus etiology. To identify possible begomoviruses, 43 symptomatic leaf samples from nine fields were collected and total DNA of each sample was extracted. PCR was performed using degenerate primers PA and PB to amplify a specific region covering AV2 gene of DNA-A and part of the adjacent intergenic region (2). DNA fragments were successfully amplified from 37 out of 43 samples and PCR amplicons of 31 samples were used for sequencing. Sequence alignments among them showed that the nucleotide sequence identity ranged from 99 to 100%, which implied that only one type of begomovirus might be present. Based on the consensus sequences, a primer pair MB1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and MB1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) was designed and used to amplify the circular viral DNA genome. The complete genome (Accession No. JQ326957) was 2,781 nucleotides long and had the highest sequence identity (over 99%) with Tomato yellow leaf curl virus (TYLCV; Accession Nos. GQ352537 and GU199587). These samples were also examined by dot immunobinding assay using monoclonal antibody against TYLCV and results confirmed that TYLCV was present in the samples. These results demonstrated that the virus from common bean is an isolate of TYLCV, a different virus from Tomato yellow leaf curl China virus (TYLCCNV). TYLCV is a devastating pathogen causing significant yield losses on tomato in China since 2006 (4). The virus has also been reported from cowpea in China (1) and in common bean in Spain (3). To our knowledge, this is the first report of TYLCV infecting common bean in China.

Gene Delivery Using Helper Virus‐Free HSV‐1 Amplicon Vectors

Herpes simplex virus type 1 (HSV-1)-based amplicon vectors contain only a very small percentage of the 152-kbp viral genome. Consequently, replication and packaging of amplicons depend on helper functions that are provided either by replication-defective mutants of HSV-1 or by replication-competent, but packaging-defective, HSV-1 genomes. Sets of cosmids that overlap and represent the entire HSV-1 genome can form, via homologous recombination, circular replication-competent viral genomes, which give rise to infectious virus progeny. However, if the DNA cleavage/packaging signals are deleted, reconstituted virus genomes are not packageable, but still provide all the helper functions required for the packaging of cotransfected amplicon DNA. The resulting stocks of packaged amplicon vectors are essentially free of contaminating helper virus. This unit describes the cotransfection of amplicon and cosmid or bacterial artificial chromosome (BAC) DNA into 2-2 cells by cationic liposome-mediated transfection and the harvesting of packaged vector particles. Support protocols provide methods for preparing cosmid and BAC DNA and determining the titers of amplicon stocks.

Novel circovirus in European catfish (Silurus glanis)

Circular single-stranded DNA viral genomes had been identified worldwide in different species and in environmental samples. Among them, viruses belonging to the genus Circovirus of the family Circoviridae are present in birds and pigs, and recently, they were detected in barbels. The present study reports the identification of a new circovirus in fish. PCR amplification and sequencing were used to identify the novel circular DNA virus in European catfish (Silurus glanis). Full genome characterization and phylogenetic analysis showed that the virus belonged to the family Circoviridae and that it was distantly related to the previously described barbel circovirus.

First detection and analysis of a fish circovirus

Circoviruses are present worldwide in birds and pigs but their occurrence in fish has not yet been reported. Recently, increased mortality was observed in barbel fry (Barbus barbus) in Hungary. This paper reports the detection of previously unknown circular viral DNA genomes in barbels by the use of a circovirus-specific wide-range nested PCR. The analysis of two complete genomes (Barbel circovirus, BaCV1 and BaCV2) indicated that they belonged into a new genetic group within the family Circoviridae, distinct from known circoviruses and circovirus-like genomes. Their genome size was 1957 bases and contained two major ORFs similar to the capsid and replication-associated protein genes of circoviruses. A connection between the presence of the virus and clinical manifestations of the infection could not be proved.

Excision and Episomal Replication of Cauliflower mosaic virus Integrated into a Plant Genome

Transgenic Arabidopsis (Arabidopsis thaliana) plants containing a monomeric copy of the cauliflower mosaic virus (CaMV) genome exhibited the generation of infectious, episomally replicating virus. The circular viral genome had been split within the nonessential gene II for integration into the Arabidopsis genome by Agrobacterium tumefaciens-mediated transformation. Transgenic plants were assessed for episomal infections at flowering, seed set, and/or senescence. The infections were confirmed by western blot for the CaMV P6 and P4 proteins, electron microscopy for the presence of icosahedral virions, and through polymerase chain reaction across the recombination junction. By the end of the test period, a majority of the transgenic Arabidopsis plants had developed episomal infections. The episomal form of the virus was infectious to nontransgenic plants, indicating that no essential functions were lost after release from the Arabidopsis chromosome. An analysis of the viral genomes recovered from either transgenic Arabidopsis or nontransgenic turnip (Brassica rapa var rapa) revealed that the viruses contained deletions within gene II, and in some cases, the deletions extended to the beginning of gene III. In addition, many of the progeny viruses contained small regions of nonviral sequence derived from the flanking transformation vector. The nature of the nucleotide sequences at the recombination junctions in the circular progeny virus indicated that most were generated by nonhomologous recombination during the excision event. The release of the CaMV viral genomes from an integrated copy was not dependent upon the application of environmental stresses but occurred with greater frequency with either age or the late stages of plant maturation.

Amp-PCR: Combining a Random Unbiased Phi29-Amplification with a Specific Real-Time PCR, Performed in One Tube to Increase PCR Sensitivity

In clinical situations where a diagnostic real-time PCR assay is not sensitive enough, leading to low or falsely negative results, or where detection earlier in a disease progression would benefit the patient, an unbiased pre-amplification prior to the real-time PCR could be beneficial. In Amp-PCR, an unbiased random Phi29 pre-amplification is combined with a specific real-time PCR reaction. The two reactions are separated physically by a wax-layer (AmpliWax®) and are run in sequel in the same sealed tube. Amp-PCR can increase the specific PCR signal at least 100×106-fold and make it possible to detect positive samples normally under the detection limit of the specific real-time PCR. The risk of contamination is eliminated and Amp-PCR could replace nested-PCR in situations where increased sensitivity is needed e.g. in routine PCR diagnostic analysis. We show Amp-PCR to work on clinical samples containing circular and linear viral dsDNA genomes, but can work well on DNA of any origin, both from non-cellular (virus) and cellular sources (bacteria, archae, eukaryotes).

Equus caballus papillomavirus‐2 (EcPV‐2): An infectious cause for equine genital cancer?

The aetiology of genital squamous cell carcinoma (SCC) in horses remains unknown, but the similarity to the disease in man, for which papillomavirus infection has been shown to be a causal factor, requires to be investigated in horses. One or more novel papillomaviruses cause equine genital SCC and its associated premalignant lesions. DNA was extracted from samples of equine genital SCC and performed rolling circle amplification, in order to identify closed circular DNA viral genomes within the samples. The amplified DNA was subcloned and sequenced and the DNA sequence compared to that of other papillomavirus genomes. Using PCR primers developed from these genomic DNA sequences, studies were then carried out in order to identify the frequency at which the viral DNA could be identified in equine genital cancer samples from horses in both the UK, Australia and Austria. Finally, in situ hybridisation using specific probes developed from this DNA sequence were used to confirm the presence of the viral RNA sequences in the neoplastic cells in these lesions. The full length genome of a novel papillomavirus species was characterised from the equine genital SCC tissue and termed Equus caballus papillomavirus-2 (EcPV-2). Viral DNA and RNA was identified in the genital tumour samples, but not in the adjacent histologically normal tissue. EcPV-2 DNA could not be identified in equine ocular or nasal carcinomas or within the scrotal skin or in most smegma samples obtained from tumour-free horses. Sequencing of amplicons, generated from the archived equine genital tumours, identified variations within E1 and E6 on DNA and predicted protein level. A novel papillomavirus, EcPV-2, is likely to play a causal role in the pathogenesis of equine genital epithelial tumours. Identification of a papillomavirus causal for genital carcinomas in horses may lead to development of a vaccine that could be used to prevent this serious disease in horses. This would be analogous to man, where vaccination against oncogenic papillomavirus species is currently being used to help prevent cervical cancer.

Translational Challenges Of Human Herpesvirus 6 Chromosomal Integration

Translational Challenges Of Human Herpesvirus 6 Chromosomal Integration

Merkel Cell Polyomavirus and Two Previously Unknown Polyomaviruses Are Chronically Shed from Human Skin

Mounting evidence indicates that Merkel cell polyomavirus (MCV), a circular double-stranded DNA virus, is a causal factor underlying a highly lethal form of skin cancer known as Merkel cell carcinoma. To explore the possibility that MCV and other polyomaviruses commonly inhabit healthy human skin, we developed an improved rolling circle amplification (RCA) technique to isolate circular DNA viral genomes from human skin swabs. Complete MCV genomes were recovered from 40% of healthy adult volunteers tested, providing full-length, apparently wild-type cloned MCV genomes. RCA analysis also identified two previously unknown polyomavirus species that we name human polyomavirus-6 (HPyV6) and HPyV7. Biochemical experiments show that polyomavirus DNA is shed from the skin in the form of assembled virions. A pilot serological study indicates that infection or coinfection with these three skin-tropic polyomaviruses is very common. Thus, at least three polyomavirus species are constituents of the human skin microbiome.

Multiple Diverse Circoviruses Infect Farm Animals and Are Commonly Found in Human and Chimpanzee Feces

Circoviruses are known to infect birds and pigs and can cause a wide range of severe symptoms with significant economic impact. Using viral metagenomics, we identified circovirus-like DNA sequences and characterized 15 circular viral DNA genomes in stool samples from humans in Pakistan, Nigeria, Tunisia, and the United States and from wild chimpanzees. Distinct genomic features and phylogenetic analysis indicate that some viral genomes were part of a previously unrecognized genus in the Circoviridae family we tentatively named "Cyclovirus" whose genetic diversity is comparable to that of all the known species in the Circovirus genus. Circoviridae detection in the stools of U.S. adults was limited to porcine circoviruses which were also found in most U.S. pork products. To determine whether the divergent cycloviruses found in non-U.S. human stools were of dietary origin, we genetically compared them to the cycloviruses in muscle tissue samples of commonly eaten farm animals in Pakistan and Nigeria. Limited genetic overlap between cycloviruses in human stool samples and local cow, goat, sheep, camel, and chicken meat samples indicated that the majority of the 25 Cyclovirus species identified might be human viruses. We show that the genetic diversity of small circular DNA viral genomes in various mammals, including humans, is significantly larger than previously recognized, and frequent exposure through meat consumption and contact with animal or human feces provides ample opportunities for cyclovirus transmission. Determining the role of cycloviruses, found in 7 to 17% of non-U.S. human stools and 3 to 55% of non-U.S. meat samples tested, in both human and animal diseases is now facilitated by knowledge of their genomes.

Mechanism for CCC DNA Synthesis in Hepadnaviruses

Hepadnavirus replication requires the synthesis of a covalently closed circular (CCC) DNA from the relaxed circular (RC) viral genome by an unknown mechanism. CCC DNA formation could require enzymatic activities of the viral reverse transcriptase (RT), or cellular DNA repair enzymes, or both. Physical mapping of the 5′ and 3′ ends of RC DNA and sequence analysis of CCC DNA revealed that CCC DNA synthesis requires the removal of the RT and an RNA oligomer from the 5′ ends of minus and plus strand DNA, respectively, removal of sequences from the terminally redundant minus strand, completion of the less than full-length plus strand, and ligation of the ends. Two models have been proposed that could explain CCC DNA formation. The first (model 1) invokes a role for the RT to catalyze a cleavage-ligation reaction leading to the formation of a unit length minus strand in CCC DNA and a DNA repair reaction for the completion and ligation of plus strand DNA; the second (model 2) predicts that CCC DNA formation depends entirely on cellular DNA repair enzymes. To determine which mechanism is utilized, we developed cell lines expressing duck hepatitis B virus genomes carrying mutations permitting us to follow the fate of viral DNA sequences during their conversion from RC to CCC DNA. Our results demonstrated that the oligomer at the 5′ end of minus strand DNA is completely or at least partially removed prior to CCC DNA synthesis. The results indicated that both RC DNA strands undergo DNA repair reactions carried out by the cellular DNA repair machinery as predicted by model 2. Thus, our study provided the basis for the identification of the cellular components required for CCC DNA formation.