Chronic Seizures Research Articles

MicroRNA-132 Interact with p250GAP/Cdc42 Pathway in the Hippocampal Neuronal Culture Model of Acquired Epilepsy and Associated with Epileptogenesis Process.

Increasing evidence suggests that epilepsy is the result of synaptic reorganization and pathological excitatory loop formation in the central nervous system; however, the mechanisms that regulate this process are not well understood. We proposed that microRNA-132 (miR-132) and p250GAP might play important roles in this process by activating the downstream Rho GTPase family. We tested this hypothesis using a magnesium-free medium-induced epileptic model of cultured hippocampal neurons. We investigated whether miR-132 regulates GTPase activity through p250GAP and found that Cdc42 was significantly activated in our experimental model. Silencing miR-132 inhibited the electrical excitability level of cultured epileptic neurons, whereas silencing p250GAP had an opposite effect. In addition, we verified the effect of miR-132 in vivo and found that silencing miR-132 inhibited the aberrant formation of dendritic spines and chronic spontaneous seizure in a lithium-pilocarpine-induced epileptic mouse model. Finally, we confirmed that silencing miR-132 has a neuroprotective effect on cultured epileptic neurons; however, this effect did not occur through the p250GAP pathway. Generally, silencing miR-132 may suppress spontaneous seizure activity through the miR-132/p250GAP/Cdc42 pathway by regulating the morphology and electrophysiology of dendritic spines; therefore, miR-132 may serve as a potential target for the development of antiepileptic drugs.

Two heterozygous Cav3.2 channel mutations in a pediatric chronic pain patient: recording condition-dependent biophysical effects.

We report expression system-dependent effects of heterozygous mutations (P769L and A1059S) in the Cav3.2 CACNA1H gene identified in a pediatric patient with chronic pain and absence seizures. The mutations were introduced individually into recombinant channels and then analyzed by means of electrophysiology. When both mutants were co-expressed in tsA-201 cells, we observed a loss of channel function, with significantly smaller current densities across a wide range of voltages (-40 to +20 mV). In addition, when both mutant channels were co-expressed, the channels opened at a more depolarizing potential with a ~5-mV right shift in the half-activation potential, with no changes in half-inactivation potential and the rate of recovery from inactivation. Interestingly, when both mutants were co-expressed in the neuronal-derived CAD cells in a different extracellular milieu, the effect was remarkably different. Although not statistically significant (p < 0.07), current densities appeared augmented compared to wild-type channels and the difference in the half-activation potential was lost. This could be attributed to the replacement of extracellular sodium and potassium with tetraethylammonium chloride. Our results show that experimental conditions can be a confounding factor in the biophysical effects of T-type calcium channel mutations found in certain neurological disorders.

Low-frequency stimulation in anterior nucleus of thalamus alleviates kainate-induced chronic epilepsy and modulates the hippocampal EEG rhythm

High-frequency stimulation (HFS) of the anterior nucleus of thalamus (ANT) is a new and alternative option for the treatment of intractable epilepsy. However, the responder rate is relatively low. The present study was designed to determine the effect of low-frequency stimulation (LFS) in ANT on chronic spontaneous recurrent seizures and related pathological pattern in intra-hippocampal kainate mouse model. We found that LFS (1Hz, 100μs, 300μA), but not HFS (100Hz, 100μs, 30μA), in bilateral ANT significantly decreased the frequency of spontaneous recurrent seizures, either non-convulsive focal seizures or tonic–clonic generalized seizures. The anti-epileptic effect persisted for one week after LFS cessation, which manifested as a long-term inhibition of the frequency of seizures with short (20–60s) and intermediate duration (60–120s). Meanwhile, LFS decreased the frequency of high-frequency oscillations (HFOs) and interictal spikes, two indicators of seizure severity, whereas HFS increased the HFO frequency. Furthermore, LFS decreased the power of the delta band and increased the power of the gamma band of hippocampal background EEG. In addition, LFS, but not HFS, improved the performance of chronic epileptic mice in objection-location task, novel objection recognition and freezing test. These results provide the first evidence that LFS in ANT alleviates kainate-induced chronic epilepsy and cognitive impairment, which may be related to the modulation of the hippocampal EEG rhythm. This may be of great therapeutic significance for clinical treatment of epilepsy with deep brain stimulation.

Involvement of the visual pathway is not a risk factor of visual field deficits in patients with occipital arteriovenous malformations: an fMRI study

Occipital arteriovenous malformations (AVMs) are still one of neurosurgery’s most intriguing and challenging pathologies. In this study, we reviewed our series of patients with occipital AVMs admitted in Beijing Tiantan Hospital from June 2013 through January 2015 and attempted to evaluate the risk factors of visual field deficits (VFDs) in these patients at presentation. Forty-two consecutive patients with occipital AVMs were included in our study. Patient parameters (age, sex, and history of hemorrhage) and AVM characteristics (size, side, venous drainage, Spetzler-Martin grade, and diffuseness) were collected. VFDs were quantified using an Octopus perimetry. Conventional MRI, blood oxygen level dependent fMRI (BOLD-fMRI) of the visual cortex, and diffusion tensor imaging (DTI) of the optic radiation were performed. The least distances from the AVM to the optic radiation (AVM-OR) and from the AVM to the visual cortex (AVM-VC) were measured. Univariate analyses were used to correlate initial VFDs with patient parameters, AVM characteristics, AVM-OR, and AVM-VC distances. VFDs were identified in 14 patients, among which 12 patients presented with a history of hemorrhage and 2 patients presented with nonhemorrhagic chronic headache. VFDs were more common (P = 0.000003) in patients with ruptured AVMs. VFD frequency was not associated with patient age, sex, and AVM characteristics (size, side, venous drainage, S-M grade, and diffuseness). Unlike other lesions involving the optic radiation and visual cortex, the frequency of VFDs in occipital AVMs did not correlate with the AVM-OR and AVM-VC distances (P = 0.640 and 0.638, respectively). A history of hemorrhage is an independent risk factor of VFDs in occipital AVMs. Most unruptured occipital AVMs may present with chronic headache and seizures other than VFDs. The distances from the AVMs to the optic radiation and the visual cortex are not associated with preexisting VFDs. Our results prompt us to probe into the plasticity of the visual pathway in patients with this congenital vascular anomaly.

The frequency of spontaneous seizures in rats correlates with alterations in sensorimotor gating, spatial working memory, and parvalbumin expression throughout limbic regions

Cognitive deficits and psychotic symptoms are highly prevalent in patients with temporal lobe epilepsy (TLE). Imaging studies in humans have suggested that these comorbidities are associated with atrophy in temporal lobe structures and other limbic regions. It remains to be clarified whether TLE comorbidities are due to the frequency of spontaneous seizures or to limbic structural damage per se. Here, we used the pilocarpine model of chronic spontaneous seizures to evaluate the possible association of seizure frequency with sensorimotor gating, spatial working memory, and neuropathology throughout limbic regions. For TLE modeling, we induced a 2-h status epilepticus by the systemic administration of lithium–pilocarpine. Once spontaneous seizures were established, we tested the locomotor activity (open field), spatial working memory (eight-arm radial maze), and sensorimotor gating (prepulse inhibition of acoustic startle). After behavioral testing, the brains were sectioned for hematoxylin–eosin staining (cell density) and parvalbumin immunohistochemistry (GABAergic neuropil) in the prefrontal cortex, nucleus accumbens, thalamus, amygdala, hippocampus, and entorhinal cortex. The animal groups analyzed included chronic epileptic rats, their controls, and rats that received lithium–pilocarpine but eventually failed to express status epilepticus or spontaneous seizures. Epileptic rats showed deficits in sensorimotor gating that negatively correlated with the radial maze performance, and impairments in both behavioral tests correlated with seizure frequency. In addition to neuronal loss at several sites, we found increased parvalbumin immunostaining in the prefrontal cortex (infralimbic area), thalamus (midline and reticular nuclei), amygdala, Ammon’s horn, dentate gyrus, and entorhinal cortex. These tissue changes correlated with seizure frequency and impairments in sensorimotor gating. Our work indicates that chronic seizures might impact the inhibitory–excitatory balance in the temporal lobe and its interconnected limbic regions, which could increase the likelihood of cognitive deficits and interictal psychiatric disorders.

Seizure Suppression Efficacy of Closed-Loop Versus Open-Loop Deep Brain Stimulation in a Rodent Model of Epilepsy

We assess and compare the effects of both closed-loop and open-loop neurostimulation of the rat hippocampus by means of a custom low-power programmable therapeutic neurostimulation device on the suppression of spontaneous seizures in a rodent model of epilepsy. Chronic seizures were induced by intraperitoneal kainic acid injection. Two bipolar electrodes were implanted into the CA1 regions of both hippocampi. The electrodes were connected to the custom-built programmable therapeutic neurostimulation device that can trigger an electrical stimulation either in a periodic manner or upon detection of the intracerebral electroencephalographic (icEEE) seizure onset. This device includes a microchip consisting of a 256-channel icEEG recording system and a 64-channel stimulator, and a programmable seizure detector implemented in a field-programmable gate array (FPGA). The neurostimulator was used to evaluate seizure suppression efficacy in ten epileptic rats for a total of 240 subject-days (5760 subject-hours). For this purpose, all rats were randomly divided into two groups: the no-stimulation group and the stimulation group. The no-stimulation group did not receive stimulation. The stimulation group received, first, closed-loop stimulation and, next, open-loop stimulation. The no-stimulation and stimulation groups had a similar seizure frequency baseline, averaging five seizures per day. Closed-loop stimulation reduced seizure frequency by 90% and open-loop stimulation reduced seizure frequency by 17%, both in the stimulation group as compared to the no-stimulation group.

Epilepsy and Adult Neurogenesis

Seizure activity in the hippocampal region strongly affects stem cell-associated plasticity in the adult dentate gyrus. Here, we describe how seizures in rodent models of mesial temporal lobe epilepsy (mTLE) affect multiple steps in the developmental course from the dividing neural stem cell to the migrating and integrating newborn neuron. Furthermore, we discuss recent evidence indicating either that seizure-induced aberrant neurogenesis may contribute to the epileptic disease process or that altered neurogenesis after seizures may represent an attempt of the injured brain to repair itself. Last, we describe how dysfunction of adult neurogenesis caused by chronic seizures may play an important role in the cognitive comorbidities associated with mTLE.

A Case Report of Solitary Fibrous Tumor in the Axilla of a 4-year-old Girl with Additional Marker Chromosome

Solitary fibrous tumor (SFT) is uncommon and known to affect in middle-aged adults, with rare reports of occurrences in children. Although frequently involving the pleura, recent reports show that SFT may also involve extrapleural sites. SFT is known as a benign tumor, but in some cases SFT recurs, invades locally, or shows malignant transformation. We experienced a case of SFT that developed in the axilla of a 4-year-old girl with multiple congenital anomalies with constitutional chromosomal abnormality of 46,XX[44]/47,XX,+mar[11]. Her tumor could not be surgically resected due to the patient’s multiple anomalies including congenital heart disease, chronic lung problem and seizure disorder. She died of congestive heart failure with respiratory failure due to tumor growth. This report is meaningful not only because SFT affected a pediatric patient with a constitutional chromosomal abnormality, but also because the tumor originated from the axillary area, a site of origin rarely reported for SFTs. pISSN 2233-5250 / eISSN 2233-4580 http://dx.doi.org/10.15264/cpho.2015.22.2.171 Clin Pediatr Hematol Oncol 2015;22:171∼175

Dysembryoplastic Neuroepithelial Tumors.

Dysembryoplastic neuroepithelial tumor (DNT) is a benign glioneuronal neoplasm that most commonly occurs in children and young adults and may present with medically intractable, chronic seizures. Radiologically, this tumor is characterized by a cortical topography and lack of mass effect or perilesional edema. Partial complex seizures are the most common presentation. Three histologic subtypes of DNTs have been described. Histologically, the recognition of a unique, specific glioneuronal element in brain tumor samples from patients with medically intractable, chronic epilepsy serves as a diagnostic feature for complex or simple DNT types. However, nonspecific DNT has diagnostic difficulty because its histology is indistinguishable from conventional gliomas and because a specific glioneuronal element and/or multinodularity are absent. This review will focus on the clinical, radiographic, histopathological, and immunohistochemical features as well as the molecular genetics of all three variants of DNTs. The histological and cytological differential diagnoses for this lesion, especially the nonspecific variant, will be discussed.

The Severity of Gliosis in Hippocampal Sclerosis Correlates with Pre-Operative Seizure Burden and Outcome After Temporal Lobectomy.

Astrogliosis and microgliosis in hippocampal sclerosis (HS) are widespread and are postulated to contribute to the pro-excitatory neuropathological environment. This study aimed to establish if seizure burden at the time of surgery or post-surgical outcome were correlated with the extent of gliosis in HS. As a secondary aim, we wanted to determine if the degree of gliosis could be predicted by pre-operative neuroimaging.Children and adults who underwent epilepsy surgery for HS between 2002 and 2011 were recruited (n = 43), and age-matched autopsy controls obtained (n = 15). Temporal lobe specimens were examined by DAB immunohistochemistry for astrocytes (glial fibrillary acidic protein (GFAP)) and microglia (CD68). Cell counting for GFAP and CD68 was performed and quantitative densitometry undertaken for GFAP. Seizure variables and outcome (Engel) were determined through medical record and patient review. Seizure frequency in the 6months prior to surgery was measured to reflect the acute seizure burden. Duration of seizures, age at onset and age at operation were regarded to reflect chronic seizure burden. Focal, lobar and generalized atrophy on pre-operative MRI were independently correlated with the degree of cortical gliosis in the surgical specimen.In HS, both acute and chronic seizure burden were positively correlated with the degree of gliosis. An increase in reactive astrocyte number in CA3 was the strongest predictor of poor post-operative seizure outcome at 1 and 3years post-operatively in this cohort. Changes in lower cortical astrocyte and upper cortical microglial number also correlated with post-operative outcome at 1year. Post-surgical seizure outcome (1, 3 and 5years) did not otherwise correlate with GFAP immunoreactivity (GFAP-IR) or CD68 immunoreactivity (CD68-IR). Increased microglial activation was detected in patients with pre-operative bilateral convulsive seizures, compared to those without convulsive seizures. Furthermore, focal, lobar and generalized atrophy on pre-operative neuroimaging were independently correlated with the degree of cortical gliosis in the surgical specimen.

Effect of Antiepileptic Drugs for Acute and Chronic Seizures in Children with Encephalitis.

BackgroundEncephalitis presents with seizures in the acute phase and increases the risk of late unprovoked seizures and epilepsy. This study aimed to evaluate the effect of antiepileptic drugs in pediatric patients with acute seizures due to encephalitis and epilepsy.Patients and MethodsCases of acute pediatric encephalitis between January 2000 and December 2010 were reviewed. Clinical data, including onset at age, seizure type, seizure frequency, effects of antiepileptic drugs, and prognosis were analyzed.ResultsDuring the study period, 1038 patients (450 girls, 588 boys) were enrolled. Among them, 44.6% (463) had seizures in the acute phase, 33% had status epilepticus, and 26% (251) developed postencephalitic epilepsy. At one year of follow-up, 205 of the 251 patients with postencephalitic epilepsy were receiving antiepileptic drugs while 18% were seizure free even after discontinuing the antiepileptic drugs. Among those with postencephalitic epilepsy, 67% had favorable outcomes and were using <2 anti-epileptic drugs while 15% had intractable seizures and were using ≥ 2 antiepileptic drugs. After benzodiazepines, intravenous phenobarbital was preferred over phenytoin as treatment of postencephalitic seizures in the acute phase. For refractory status epilepticus, high-dose topiramate combined with intravenous high-dose phenobarbital or high-dose lidocaine had less side effects.ConclusionsChildren with encephalitis have a high rate of postencephalitic epilepsy. Phenobarbital and clonazepam are the most common drugs used, alone or in combination, for postencephalitic epilepsy.

Modification of Astrocyte Metabolism as an Approach to the Treatment of Epilepsy: Triheptanoin and Acetyl-L-Carnitine.

Epilepsy is a severe neurological disorder characterized by altered electrical activity in the brain. Important pathophysiological mechanisms include disturbed metabolism and homeostasis of major excitatory and inhibitory neurotransmitters, glutamate and GABA. Current drug treatments are largely aimed at decreasing neuronal excitability and thereby preventing the occurrence of seizures. However, many patients are refractory to treatment and side effects are frequent. Temporal lobe epilepsy (TLE) is the most common type of drug-resistant epilepsy in adults. In rodents, the pilocarpine-status epilepticus model reflects the pathology and chronic spontaneous seizures of TLE and the pentylenetetrazole kindling model exhibits chronic induced limbic seizures. Accumulating evidence from studies on TLE points to alterations in astrocytes and neurons as key metabolic changes. The present review describes interventions which alleviate these disturbances in astrocyte-neuronal interactions by supporting mitochondrial metabolism. The compounds discussed are the endogenous transport molecule acetyl-L-carnitine and the triglyceride of heptanoate, triheptanoin. Both provide acetyl moieties for oxidation in the tricarboxylic acid cycle whereas heptanoate is also provides propionyl-CoA, which after carboxylation can produce succinyl-CoA, resulting in anaplerosis-the refilling of the tricarboxylic acid cycle.

Profile, recommendation criteria, and outcome of gastrostomy tube insertions in a pediatric teaching hospital

Objective: To describe the profile of patients undergoing a gastrostomy, the recommendations and outcome of this insertion in a Pediatric Teaching Hospital. Method: This was a retrospective, quantitative, and descriptive study that researched the records of patients who underwent a gastrostomy between January 2010 and December 2012. Results: The diseases and conditions most frequent were chronic infantile encephalopathy (77.5%), pneumonia (67.5%), seizures (57.5%), and malnutrition (42.5%). Although most patients presented a history of dysphagia (62.5%), oral feeding was observed most frequently as the most common form of nutrition, before the gastrostomy insertion (42.5%), followed by nasoenteric tube (40%). The introduction of nutrition by gastrostomy was successful and occurred an average of 2.82 (± 1.19) days after insertion. Six months after their gastrostomy, 80% of patients continued feeding only through this access tube and only 2.5% had removed the gastrostomy; 45% of the participants had gastrostomy complications, with extravasation of gastric material (15%) and local inflammation (15%) being the most frequent. Conclusion: The profile of patients undergoing gastrostomy is mostly of individuals with neurological and respiratory diseases, without respiratory support, of the male gender, and feeding by oral cavity or nasoenteric tube for a prolonged period. The main recommendation criteria were dysphagia and neurological diseases. Regarding the outcome, the introduction of nutrition by gastrostomy was successful; most individuals remained with this long-term nutritional support and the most common complications were gastric material extravasation and local inflammations

High serum levels of proinflammatory markers during epileptogenesis. Can omega-3 fatty acid administration reduce this process?

During the epileptogenic process, several events may occur, such as an important activation of the immune system in the central nervous system. The response to seizure activity results in an inflammation in the brain as well as in the periphery. Moreover, CRP and cytokines may be able to interact with numerous ligands in response to cardiac injury caused by sympathetic stimulation in ictal and postictal states. Based on this, we measured the serum levels of C-reactive protein (CRP) and cytokines during acute, silent, and chronic phases of rats submitted to the pilocarpine model of epilepsy. We have also analyzed the effect of a chronic treatment of these rats with omega-3 fatty acid in CRP and cytokine levels, during an epileptic focus generation. C-reactive protein and cytokines such as IL-1β, IL-6, and TNF-α presented high concentration in the blood of rats, even well after the occurrence of SE. We found reduced levels of CRP and all proinflammatory cytokines in the blood of animals with chronic seizures, treated with omega-3, when compared with those treated with vehicle solution. Taken together, our results strongly suggest that the omega-3 is an effective treatment to prevent SUDEP occurrence due to its capability to act as an anti-inflammatory compound, reducing the systemic inflammatory parameters altered by seizures.

Glycine transporter 1 is a target for the treatment of epilepsy

Glycine is the major inhibitory neurotransmitter in brainstem and spinal cord, whereas in hippocampus glycine exerts dual modulatory roles on strychnine-sensitive glycine receptors and on the strychnine-insensitive glycineB site of the N-methyl-d-aspartate receptor (NMDAR). In hippocampus, the synaptic availability of glycine is largely under control of glycine transporter 1 (GlyT1). Since epilepsy is a disorder of disrupted network homeostasis affecting the equilibrium of various neurotransmitters and neuromodulators, we hypothesized that changes in hippocampal GlyT1 expression and resulting disruption of glycine homeostasis might be implicated in the pathophysiology of epilepsy. Using two different rodent models of temporal lobe epilepsy (TLE) – the intrahippocampal kainic acid model of TLE in mice, and the rat model of tetanic stimulation-induced TLE – we first demonstrated robust overexpression of GlyT1 in the hippocampal formation, suggesting dysfunctional glycine signaling in epilepsy. Overexpression of GlyT1 in the hippocampal formation was corroborated in human TLE samples by quantitative real time PCR. In support of a role of dysfunctional glycine signaling in the pathophysiology of epilepsy, both the genetic deletion of GlyT1 in hippocampus and the GlyT1 inhibitor LY2365109 increased seizure thresholds in mice. Importantly, chronic seizures in the mouse model of TLE were robustly suppressed by systemic administration of the GlyT1 inhibitor LY2365109. We conclude that GlyT1 overexpression in the epileptic brain constitutes a new target for therapeutic intervention, and that GlyT1 inhibitors constitute a new class of antiictogenic drugs. These findings are of translational value since GlyT1 inhibitors are already in clinical development to treat cognitive symptoms in schizophrenia

Autoregressive spectral analysis of cortical electroencephalographic signals in a rat model of post-traumatic epilepsy

Objectives:Post-traumatic epilepsy (PTE) is a common consequence of traumatic brain injury (TBI) and significant predictor of poor prognosis in TBI patients. To develop clinical interventions for PTE risk reduction, there is a need to elucidate the epileptogenic mechanisms induced by brain injury.Methods:The iron-induced rat model of epilepsy used here mimics many aspects of human PTE. Intracortical injection of iron results in local neuronal damage and the establishment of an epileptic focus, leading to chronic spontaneous electroencephalographic (EEG) signals and motor seizures, with progressively increasing frequency over many months. Identifying unique aspects of PTE seizure semiology for prognosis and treatment may be aided by novel methods of EEG analysis. Here, autoregressive (AR) methods were compared to the conventional fast Fourier transform (FFT) for processing EEG signals in iron-induced epilepsy.Results:Power spectra obtained using AR showed higher frequency resolution over a given epoch than the spectra obtained using FFT. Moreover, changes in total AR spectral power and frequency distribution over brief successive periods provided convenient indexes for long-term monitoring of seizures.Discussion:Autoregression analysis may prove complementary to FFT for EEG analysis in PTE patients.

Association of Alpha-Soluble NSF Attachment Protein with Epileptic Seizure.

Alpha-soluble N-ethylmaleimide-sensitive factor (NSF) attachment protein (αSNAP) is a ubiquitous and indispensable component of membrane fusion machinery. There is accumulating evidence that mild alterations of αSNAP expression may be associated with specific pathological conditions in several neurological disorders. This study aimed to assess αSNAP expression in temporal lobe epilepsy (TLE) patients and pilocarpine-induced rat model and to determine whether altered αSNAP expression leads to increased susceptibility to seizures. The expression of αSNAP was assessed in the temporal lobe from patients with TLE and pilocarpine-induced epileptic rats. In addition, αSNAP expression was silenced by lentivirus pLKD-CMV-GFP-U6-NAPA (primer: GGAAGCATGCGAGATCTATGC) in animals. At day 7, the animals were kindled by pilocarpine and then the time of latency to seizure and the incidence of chronic idiopathic epilepsy seizures were assessed. The immunoreactivity to alpha-SNAP was utilized to measure expression of this protein in the animal. By immunohistochemistry, immunofluorescence, and western blotting, we found significantly lower αSNAP levels in patients with TLE. αSNAP expression showed no obvious change in pilocarpine-induced epileptic rats, from 6h to 3days after seizure, compared with the control group, in the acute stage; however, αSNAP levels were significantly lower in the chronic phase (day 7, months 1 and 2) in epileptic rats. Importantly, behavioral data revealed that αSNAP-small interfering RNA (siRNA) could decrease the time of latency to seizure and increase the incidence of chronic idiopathic epilepsy seizures compared with the control group. αSNAP is mainly expressed in the neuron brain tissue of patients with TLE and epileptic animals. Our findings suggest that decreasing αSNAP levels may increase epilepsy susceptibility, providing a new strategy for the treatment of this disease.

Status epilepticus results in persistent overproduction of reactive oxygen species, inhibition of which is neuroprotective

Epilepsy and seizure activity result in the generation of reactive oxygen species (ROS), which contribute to seizure-induced neuronal damage. Recent in vitro evidence indicates that NADPH oxidase contributes significantly to seizure-induced ROS. We further tested this in rat glio-neuronal cultures and in ex vivo chronic epileptic rat brain tissue using live cell-imaging techniques. Here, we show that ROS are upregulated in chronic epilepsy and that ROS production contributes to cell death, which is seen after status epilepticus (SE) and chronic seizures. Inhibition of ROS production by AEBSF, a NADPH oxidase inhibitor, markedly reduced seizure-induced cell death in the perforant path model of epilepsy. These findings demonstrate a critical role for ROS, generated by NADPH oxidase, contributing to seizure-induced cell death. These findings point to NADPH oxidase inhibition as a novel treatment strategy to prevent brain injury in SE and chronic epilepsy.

Prognosis of status epilepticus (SE): Relationship between SE duration and subsequent development of epilepsy.

In animal models, SE duration is related to epileptogenesis. Data in humans are scarce, mainly in NCSE; therefore, we aimed to study the prognosis of SE de novo and which factors may influence subsequent development of epilepsy. We evaluated patients with SE without previous epilepsy at our hospital (February 2011-February 2014), including demographics, etiology, number of AEDs, duration of SE, mortality, and occurrence of seizures during follow-up. Eighty-nine patients were evaluated. Median age was 69 (19-95) years old. Among them, 33.7% were convulsive. Regarding etiology, 59 were considered acute symptomatic (41 lesions, 18 toxic-metabolic), 17 remote or progressive symptomatic, and 13 cryptogenic. The median recovery time was 24h (30 min-360 h). In-hospital mortality was 29% (n = 26). After a median follow-up of 10 months, 58.7% of survivors (n = 37) showed seizures. Subsequently, we analyzed which factors might be related to the development of epilepsy, and we found that epilepsy development was more frequent with longer SE duration (37 vs. 23 h, p = 0.004); furthermore, patients with a toxic-metabolic etiology developed epilepsy less frequently (33% vs. 67%; p = 0.022). Epilepsy was also correlated (tendency) with focal SE (p = 0.073), a lesion in neuroimaging (p = 0.091), and the use of 2 or more AEDs (p = 0.098). Regarding SE duration, a cutoff of above 24h was clearly related to chronic seizures (p = 0.014); however, combining etiology and duration, the association of longer SE and epilepsy was significant in acute lesional SE (p = 0.034), but not in epilepsy with cryptogenic or remote/progressive etiology. After a logistic regression, only a duration longer than 24h (OR = 3.800 (1.277-11.312), p = 0.016) was found to be an independent predictor of the development of epilepsy. In patients with SE, the longer duration is associated with an increased risk of subsequent epilepsy at follow-up, mainly in symptomatic SE due to an acute lesion. It is unclear if it might be the result of a more severe injury causing both prolonged seizures and subsequent epilepsy, and therefore whether more aggressive treatment in this group might avoid this possibility. Most of the patients with cryptogenic or remote/progressive SE developed epilepsy regardless of SE duration. This article is part of a Special Issue entitled "Status Epilepticus".

Is There a Relation between EEG-Slow Waves and Memory Dysfunction in Epilepsy? A Critical Appraisal.

Is there a relationship between peri-ictal slow waves, loss of consciousness, memory, and slow-wave sleep, in patients with different forms of epilepsy? We hypothesize that mechanisms, which result in peri-ictal slow-wave activity as detected by the electroencephalogram, could negatively affect memory processes. Slow waves (≤4 Hz) can be found in seizures with impairment of consciousness and also occur in focal seizures without impairment of consciousness but with inhibited access to memory functions. Peri-ictal slow waves are regarded as dysfunctional and are probably caused by mechanisms, which are essential to disturb the consolidation of memory entries in these patients. This is in strong contrast to physiological slow-wave activity during deep sleep, which is thought to group memory-consolidating fast oscillatory activity. In patients with epilepsy, slow waves may not only correlate with the peri-ictal clouding of consciousness, but could be the epiphenomenon of mechanisms, which interfere with normal brain function in a wider range. These mechanisms may have transient impacts on memory, such as temporary inhibition of memory systems, altered patterns of hippocampal–neocortical interactions during slow-wave sleep, or disturbed cross-frequency coupling of slow and fast oscillations. In addition, repeated tonic–clonic seizures over the years in uncontrolled chronic epilepsy may cause a progressive cognitive decline. This hypothesis can only be assessed in long-term prospective studies. These studies could disentangle the reversible short-term impacts of seizures, and the impacts of chronic uncontrolled seizures. Chronic uncontrolled seizures lead to irreversible memory impairment. By contrast, short-term impacts do not necessarily lead to a progressive cognitive decline but result in significantly impaired peri-ictal memory performance.