Chronic Rheumatologic Disease Research Articles

Evaluation of Quality of Life in Rheumatological Patients with Post-Tonsillectomy

Aim: The main aim of the study was to determine whether tonsillectomy improves the quality of life in adults suffering from chronic or recurrent tonsillitis and in rheumatologically treated patients.
 Materials and methods: This study was conducted on seropositive or seronegative patients (n=50) who were followed up with various rheumatological diagnoses (rheumatoid arthritis, ankylosing spondylitis, psoriatic arthritis, etc.) at the physical medicine and rehabilitation clinic of SBU Diyarbakir Gazi Yasargil Education Research Hospital and who were diagnosed with acute or chronic tonsillitis and who applied to the ENT clinic. It was done to follow the pre- and post-operative conditions. In these patients who were decided to undergo surgical treatment, HAQ (Health assessment questionnaire) quality of life scale and VAS (Visual Analog Scala) were applied to evaluate the perception of pain before and at the 6th month after the operation.
 Results: In this study of 50 adults, mean age was 28.0 years (SD 7.2 years), 38 adults were followed up in the 1st month of diagnosis, while 12 adults were followed up in the 7th month of diagnosis. All patients experienced significant improvements throughout the treatment process. According to the results of the patients' quality of life scale, it was determined that it increased significantly, primarily due to improvements in general and physical areas. 96% (96/100) of participating patients reported benefiting from tonsillectomy. Patients in the postoperative control group had significantly higher quality of life scores than patients in the preoperative case group (p < 0.001).
 Conclusion: Adult patients who underwent tonsillectomy due to acute tonsillitis reported improvement in their quality of life 6 months after surgery. Based on this, physical examination of rheumatological patients who have rheumatological diseases and have undergone tonsillectomy and it is likely to improve general health, create a sense of well-being in patients, and improve overall quality of life. The social benefits of tonsillectomy appear to be negligible. The effects are likely to be long-lasting and have a greater impact on younger patients. The presence of chronic rheumatological disease due to tonsillar inflammation and infective symptoms are the main factors affecting the severity of the disease.

A case report on sero-negative juvenile idiopathic arthritis progressing to polyarthritis

A group of inflammatory arthritic disorders known as juvenile idiopathic arthritis (JIA) are characterized by arthritis of uncertain origin that first manifests in a child under the age of 16. This is the most common chronic rheumatological disease of childhood. The JIA is present in every country and has an incidence of 1 in 100,000. Despite the absence of a documented etiology, there are a number of genetic and environmental risk factors as well as immunologic abnormalities that can be seen and used to infer information about the pathophysiology of the illness. Although there is no cure, modern therapy can frequently reduce the underlying inflammation and enhance function and symptoms. In this case patient showed complete resolution of symptoms with no signs of recurrence. As a result, it helps patient to live a healthy life.

#6184 PULSE WAVE VELOCITY AND AMBULATORY BLOOD PRESSURE IN PATIENTS WITH RENAL HYPERFILTRATION

Abstract Background and Aims Recent studies have been implicated that abnormally increased glomerular filtration rate, defined as renal hyperfiltration, may be a risk factor for the development of renal damage and cardiovascular disease. Herein, we aimed to investigate the possible relationship between renal hyperfiltration(RHf) and pulse wave velocity, ambulatory blood pressure measurements and clinical parameters. Method All individuals included the study were between 18 and 65 years old. The eGFR (CKD-EPI) values of above 140 ml/min/1.73 m² were defined as RHf. Nineteen individuals in the renal hyperfiltration group and 20 in the control group were included. Blood and urine samples of the cases were examined. The individuals with diabetes, obesity, pregnancy, hypertension, cardiovascular disease, peripheral artery disease, cerebrovascular disease, chronic rheumatological disease, and thyroid dysfunction were excluded from the study. The parameters related arterial stiffness and ambulatory blood pressure measurements were obtained in all cases. The results were analyzed statistically. Results The two groups were similar in terms of gender, age, BMI and smoking. In RHf group, total cholesterol, 24-hour urine proteinuria and albuminuria, SBP, DBP, MAP and PP values ​​were found higher than control group. Interestingly, the differences of “night time” measurements of all these hemodynamic parameters were more pronounced in RHf group. The trend of “non-dipper” pattern was to be higher in the hyperfiltration group. In arterial stiffness parameters the augmentation pressure (AP), central systolic pressure (CSP), reflection magnitude (RM), central diastolic pressure (CBP), and pulse pressure amplification (PPA) were found significantly different. Pearson's corelation analysis revealed that AP, CSP, CBP was the positively; RM was negatively correlated with eGFR in hyperfiltration group (Table 1 and 2). Multivariate linear regression analysis revealed that AP, 24-hour proteinuria and mean arterial pressure were the independent parameters related to hyperfiltration. Logistic regression showed that only AP was an independent predictor of hyperfiltration (p = 0.001, OR = 0.84; 0.757-0.935, CI 95%). Conclusion We found that augmentation pressure is the most important independent parameter correlated with RHf among arterial stiffness measurements. The vascular risk may be increased in this population.

Artificial Intelligence in Rheumatoid Arthritis: Current Status and Future Perspectives: A State-of-the-Art Review.

Investigation of the potential applications of artificial intelligence (AI), including machine learning (ML) and deep learning (DL) techniques, is an exponentially growing field in medicine and healthcare. These methods can be critical in providing high-quality care to patients with chronic rheumatological diseases lacking an optimal treatment, like rheumatoid arthritis (RA), which is the second most prevalent autoimmune disease. Herein, following reviewing the basic concepts of AI, we summarize the advances in its applications in RA clinical practice and research. We provide directions for future investigations in this field after reviewing the current knowledge gaps and technical and ethical challenges in applying AI. Automated models have been largely used to improve RA diagnosis since the early 2000s, and they have used a wide variety of techniques, e.g., support vector machine, random forest, and artificial neural networks. AI algorithms can facilitate screening and identification of susceptible groups, diagnosis using omics, imaging, clinical, and sensor data, patient detection within electronic health record (EHR), i.e., phenotyping, treatment response assessment, monitoring disease course, determining prognosis, novel drug discovery, and enhancing basic science research. They can also aid in risk assessment for incidence of comorbidities, e.g., cardiovascular diseases, in patients with RA. However, the proposed models may vary significantly in their performance and reliability. Despite the promising results achieved by AI models in enhancing early diagnosis and management of patients with RA, they are not fully ready to be incorporated into clinical practice. Future investigations are required to ensure development of reliable and generalizable algorithms while they carefully look for any potential source of bias or misconduct. We showed that a growing body of evidence supports the potential role of AI in revolutionizing screening, diagnosis, and management of patients with RA. However, multiple obstacles hinder clinical applications of AI models. Incorporating the machine and/or deep learning algorithms into real-world settings would be a key step in the progress of AI in medicine.

Assessment of Cardiac Risk in Women with Autoimmune Disease.

The purpose of our review was to evaluate current standards in clinical practice in determining overall cardiac risk in female patients with chronic rheumatologic diseases. We hoped to not only summarize known cardiac manifestations of various chronic rheumatologic diseases but also determine the effectiveness of new risk scores in determining cardiac risk in this patient population. Chronic rheumatologic diseases have been associated with various cardiac manifestations for some time, with initial studies involving risk of coronary artery disease (CAD) in rheumatoid arthritis (RA) and systemic lupus erythematosus (SLE). However, recent studies have shown numerous other cardiac manifestations associated with these and other chronic rheumatologic diseases. Risk scores have been used for several decades to help determine overall cardiac risk in the general population, but these risk scores have notoriously underestimated the risk of cardiac disease in woman and in patients with chronic rheumatologic diseases. These diseases, often with a female predominance, can impact long-term mortality and have devastating consequences if not monitored and treated appropriately. Thus, new risk scores have been developed over the last several years to help improve detection and awareness of cardiac disease in these patients. Novel modified risk scores have found some success at improving the detection of cardiac disease in patients with chronic rheumatologic diseases. Further studies looking at these risk scores need to determine the accuracy of these scores and where they fall short. With the advent of advanced imaging technologies, future risk scores may involve certain imaging-based markers to help guide accurate risk determination.

Surgical Management of Juvenile Idiopathic Arthritis Related Dentofacial Deformities

Juvenile idiopathic arthritis (JIA) is the most common chronic rheumatologic disease of childhood and frequently affects the temporomandibular joints (TMJ). JIA TMJ management requires a team approach. Initially, TMJ JIA involvement is managed with systemic therapy or intra-articular medications to treat symptoms and limit the growth deformity, however may later require surgical intervention. This case series describes 4 patients with different presentations and treatments of juvenile idiopathic arthritis affecting the temporomandibular joints to illustrate a proposed treatment algorithm. This algorithm is not designed to be an absolute treatment regimen but a framework to help clarify the presenting problems and interventions that may be considered to treat JIA associated temporomandibular dysfunction and dentofacial deformity. This case series represents the variety of JIA temporomandibular joint disease and offers a graduated appropriate treatment algorithm.

Osteoporose e comprometimento laríngeo secundários à artrite idiopática juvenil: relato de caso

OBJECTIVE: Juvenile idiopathic arthritis (JIA) is a systemic inflammatory condition and the most common chronic rheumatological disease in childhood. Among complications, patients may have osteoporosis induced by treatment with glucocorticoids or the evolution of the disease. Another rare complication is the involvement of laryngeal cartilage, which may present with stridor or respiratory failure. The purpose of this report is to present a case of JIA with osteoporosis and laryngeal manifestations. CASE REPORT: Female, 15 years old, diagnosed with JIA 12 years ago with irregular treatment that evolved with severe and limiting disease. The patient had stridor and dyspnoea. Laryngoscopy showed involvement of arytenoid cartilage requiring tracheostomy. In addition, the patient was diagnosed with osteoporosis and bilateral coxarthrosis, requiring bilateral total hip arthroplasty.

Shoulder arthroplasty in patients with juvenile idiopathic arthritis: long-term outcomes.

Juvenile idiopathic arthritis (JIA) is the most common chronic rheumatologic disease that occurs in the pediatric population. Often, JIA continues throughout life, leading to progressive polyarticular arthritis and significant joint destruction and disability, oftentimes requiring replacement surgery. This study aimed to determine the outcomes of primary shoulder arthroplasty (SA) in patients with JIA. Over a 42-year time period (1977-2019), 67 primary SA (20 hemiarthroplasty [HA], 38 anatomic total shoulder arthroplasty [TSA], and 9 reverse shoulder arthroplasty [RSA]) with a prior diagnosis of JIA formally established in a multidisciplinary rheumatologic clinic met inclusion criteria. Further assessment was performed with inclusion of the visual analog scale pain score, active shoulder range of motion (ROM), imaging studies, complications, and implant survivorship free from reoperation and revision. SA led to substantial improvements in pain and ROM across the entire cohort at an average follow-up period of 12.2 years (range, 2-34 years). TSA was associated with the lowest pain scores (0.8; P = .02) and the highest American Shoulder and Elbow Surgeons Standardized Shoulder Assessment Form scores (77.4; P = .04) at the most recent follow-up when compared to HA and RSA. There were 14 (21%) complications across the cohort with rotator cuff failure (n = 4; 5.9%) as the most common complication followed by infection (n = 3; 4.5%). Revision surgery was performed in 5 shoulders (7.5%), with 5-year implant survival rates of 95.1% at 5 years, 93% at 10 years, 89.4% at 20 years, and 79.5% at 30 years. At 30 years, TSA was associated with better survival (90.1%) than HA (71.8%). Primary shoulder arthroplasty in the form of HA, TSA, and RSA offers a reliable surgical option for JIA patients with respect to pain reduction and ROM improvements. Unique challenges still exist in this cohort, in particular younger patients with an elevated propensity for glenoid bone erosion and a complication rate of 20.9%. As such, HA may not be ideal in this patient population. However, despite rotator cuff and glenoid concerns, TSA seems to be associated with better pain relief and patient-reported outcomes with the most durability in the long term when compared to HA.

Granulomatosis with polyangiitis - manifestations in the head andneck area

Granulomatosis with polyangiitis is a rare chronic rheumatologic systemic disease with a vasculitis of small- and medium-size vessels. Mostly the upper airways, lung and kidneys are affected. Symptoms are unspecific. Patients complain about stuffy nose, crustiness of nasal secretions, ulcera of the oral mucosa or epistaxis. The otorhinolaryngologist may be the first one to evaluate the patient's health condition. Long term complications may be cardial, renal or pulmonal failure. To this day the aetiology is still unknown. Severe disease is treated with a combination of immunosuppressive medications. Clinic examinations and laboratory tests should be carried out for life-time.

Transitioning from paediatric to adult rheumatological healthcare: English summary of the Japanese Transition Support Guide.

Issues related to transitioning from paediatric to adult healthcare are currently receiving international attention. In Japan, 1000 patients with childhood-onset chronic rheumatological diseases reach adulthood every year and require transition from care by paediatric to care by adult rheumatologists. Here, we propose a guide for the latter, wherein the adult caregiver poses the clinical questions about transitional support that they need to have answered, and the paediatric caregiver mainly compiles the plans for the transition. To formulate the guide, we sought comments from both the Japan College of Rheumatology and the Pediatric Rheumatology Association of Japan and obtained their approval. Here, we present the outcome of this consultation in the form of a Guide for Supporting Transitional Care, aiming to provide essential knowledge to physicians in the fields of adult internal medicine and orthopaedics who may be involved in treating patients with rheumatic disease during the transition from paediatric to adult care. The features of transitional support that are common for patients with various different rheumatic diseases are presented in this guide, with the aim of informing policy and strategies to deliver optimal outcomes in transitional care by non-paediatric rheumatologists.

Clinical features in 305 patients with juvenile idiopathic arthritis: A single center Turkish Study.

Juvenile idiopathic arthritis (JIA) is the most common chronic rheumatologic disease of childhood. The various subtypes of JIA differ in clinical features and treatments. The aim of this study was to analyze the frequency of JIA subtypes, patient demographic and clinical features, as well as the rates of macrophage activation syndrome, uveitis, and remission in Turkish JIA patients treated at a single center, and to compare the findings to those in the literature. The files of all JIA patients treated at our pediatric rheumatology department between January 2017 and January 2019 were retrospectively reviewed. Patient demographic, clinical, and laboratory data were obtained from the patients' files and the hospital database. The study included 305 patients (180 females) with a mean age at onset of 7.83 ± 4.62years. Among all the JIA subtypes, the most frequent was oligoarthritis (41.6%), followed by enthesitis-related arthritis (29.2%), rheumatoid factor (RF)-negative polyarthritis (13.4%), systemic arthritis (9.5%), RF-positive polyarthritis (2.6%), psoriatic arthritis (2.0%), and undifferentiated arthritis (1.6%). At the time of data collection, 278 patients (91.0%) were in remission, whereas 27 patients (9.0%) had active disease. Macrophage activation syndrome developed in 12 of the 29 (41.0%) systemic arthritis. Uveitis was noted in 32 (10.0%) patients. Biological agents were administered in 142 of the patients. The available data indicate that JIA as a whole is a heterogeneous disease with significant variability in course and long-term outcome. As such, each patient should be evaluated according to his / her disease subtype.

P069 Results of an online survey exploring the effects of shielding during the COVID-19 pandemic on patients with spondyloarthritis (SpA)

Background/Aims The COVID-19 pandemic has created many challenges for patients with chronic rheumatological diseases. SpA - which includes ankylosing spondylitis (AS), axial spondyloarthritis (axSpA), psoriatic arthritis (PsA), and enteropathic arthritis - often affects young people who are otherwise fit and able. Many SpA patients take immunosuppressive medications and therefore were advised to shield. In view of this, we conducted a survey to better understand how shielding has affected the physical activity and symptoms of SpA patients during the pandemic. Methods An online anonymised survey was created and advertised via social media from 4th June to 4th July 2020. Patients with SpA were invited to complete the survey which included 18 questions exploring the impact of the pandemic on their symptoms, physical activity levels and medication use. Results There were 136 survey respondents, of whom 74.3% were female, with an age range from under 25 to over 75 years. The underlying diagnoses were PsA (60.5%), AS (28.4%), axSpA (10.5%) and enteropathic arthritis (0.8%). The majority (66.7%) of respondents were shielding; 44.1% were on disease modifying anti-rheumatic drugs (csDMARDs) and 56.6% were on biologics (bDMARDs). Most (94.1%) had continued their DMARDs throughout the shielding period. Non-steroidal anti-inflammatory drug (NSAID) use was reported to be increased in 18.6% of respondents, and unchanged in 69.0%. Compared to before the pandemic, 54.8% reported worsening joint stiffness and 45.6% reported worsening joint pain.Most respondents (67.6%) reported reduced levels of physical activity, the commonest reasons being: shielding (54.6%); increased fatigue (45.8%); concerns around social distancing (45.4%); poor sleep quality (38.6%); working from home (28.6%) and low mood (28.6%). Only 14.7% had attended a virtual exercise class. Conclusion Approximately 2 in 3 patients with SpA reported they were shielding during the first wave of the pandemic. Similar numbers of patients reported reduced physical activity levels and increased joint stiffness over this time. It is important to acknowledge that given the nature of the anonymised survey, we cannot be certain if the same patients who were shielding were the same as those who had reduced levels of physical activity or worsening symptoms. We have, however, shown that over half of the surveyed patients attributed their reduced physical activity levels to shielding. Taking into account that social restrictions (either self-imposed or government advised) are likely to be ongoing, we believe that a focus should be placed on supporting patients to maintain their activity levels, through initiatives such as specialist virtual exercise classes. Disclosure M. Naja: None. R. Amarnani: None. M. Castelino: None.

Numérique et activités physiques en rhumatologie

All areas of our lives are currently influenced by digitisation. A wide variety of connected tools and health-related websites are currently available. Activity trackers are an effective option for increasing physical activity in patients with chronic rheumatological diseases at risk of inactivity with excellent short-term adherence. Mobile health through smartphone applications is used to support medical practice and assist patients in their care. The applications are used both to evaluate patient practice and to encourage it. These digital devices have certain limitations, such as device adherence or the reliability of their content, which invites reasoned use.

АССОЦИАЦИЯ ПОЛИМОРФИЗМА rs2569190 ГЕНА CD14 С АНКИЛОЗИРУЮЩИМ СПОНДИЛИТОМ

Ankylosing spondylitis is a chronic rheumatological disease of unknown etiology. The search for new genetic associations will improve understanding of pathogenesis. Objective: to study the association of the rs2569190 polymorphism of the CD14 gene with ankylosing spondylitis in the European population of the Krasnoyarsk region. The study recruited 3 groups of patients: the first - with ankylosing spondylitis (AS) (n = 150), the second group - patients with the rest of seronegative spondyloarthritis (SPA) (n = 66), the third group included conditionally healthy patients (control group) (n = 226). The clinical assessment of patients with SPA was based on Russian federal clinical guidelines, including the calculation of the BASDAI, BASFI and HAQ indices. DNA isolation was performed using the standard phenol-chloroform method. Genotyping for the CD14 gene was performed by PCR (polymerase chain reaction) – RFLP (restriction fragment length polymorphism) analysis. PCR was performed with a set of primers (forward GCTGAGGTTCGGAGAAGTTGC; reverse GGTGCCAACAGATGAGGTTCAC) followed by restriction with Bme18I. PCR products were analyzed by electrophoresis in 4% polyacrylamide gel followed by staining with ethidium bromide. Comparative analysis of the group of patients with AS and the control group revealed a statistically significant prevalence of the TT genotype rs2569190 in the main group (34.7% versus 23.9%) (p = 0.0236; OR 1.6901; 95% CI OR 1.0728-2.6625). Patients with seronegative SPA did not demonstrate the significant disparities in rs2569190. In Krasnoyarsk region europids, the TT genotype of the rs2569190 polymorphism was associated with ankylosing spondylitis but not with seronegative SPA. The identification of a new association confirms the influence of other genetic factors on the predisposition to AS. It is likely that some of the genetic factors play a role in the pathogenesis under the influence of the external environment. Identification of these associations will make it possible to adjust the lifestyle of patients and their relatives to reduce the risk of exacerbation or development of AS.

The impact of autoimmune systemic inflammation and associated medications on male reproductive health in patients with chronic rheumatological, dermatological, and gastroenterological diseases: A systematic review.

Autoimmune disorders currently affect 5%-8% of the global population, characterized by an aberrant chronic inflammatory response to self-antigens. The aim of this study was to systematically review the current available evidence investigating the impact of systemic autoimmune diseases and associated immunosuppressive treatment on fertility parameters of adult men. Clinical trials, observational studies, and case reports written in English and reporting semen analysis, evaluation of seminal oxidative stress, and/or sperm DNA fragmentation in patients affected by psoriasis and psoriatic arthritis, celiac disease, inflammatory bowel diseases, systemic lupus erythematosus, ankylosing spondylitis, hidradenitis suppurativa, uveitis, dermatomyositis, and rheumatoid arthritis were collected by searching on PubMed, EMBASE, OVID, Scopus, and Cochrane Library databases, with no limit of time. The study quality and the extent of bias in design, methods, and outcome assessment were evaluated by applying the Joanna Briggs Institute Critical Appraisal tools. Evidence suggested that various autoimmune diseases or relevant medications can adversely affect male fertility parameters and that patients may benefit of counseling and sperm cryopreservation. Clinical trials further investigating any adverse effect of autoimmunity and related thereby on male infertility are warranted, to develop appropriate guidelines for males diagnosed and treated for autoimmune disorders.

Sonographic evaluation of hindfoot pain

ABSTRAC. Background : Hindfoot is frequently injured either duo to trauma, overuse or inflammatory processes. Different diagnoses unfortunately tend to have overlapping clinical signs and symptoms. So, clinicians tend to rely on imaging. Ultrasonography (US) has many benefits for evaluating hindfoot pain. Aim of the study: To review the prevalence of etiologies in patients with hindfoot pain by musculoskeletal ultrasound. Patient and methods: This study included one hundred (100) patients complaining of unilateral or bilateral hindfoot pain ranging in age from 16 to 65 years with no sex specification, excluding patients with chronic rheumatological inflammatory diseases, diabetes mellitus, major ankle trauma, previous foot surgery and any foot or lower limp deformity. All patients were subjected to careful history taking, clinical examination, laboratory investigations and X ray imaging for ankle and foot, giving provisional diagnosis; followed by real-time high resolution ultrasonography for the affected hind foot. Results: By high-resolution ultrasonography for the affected hindfoot of our patients, 181 different lesions were detected, tendon lesions were the commonest lesions detected, with 63 lesions (35%) followed by 59 lesions (32%) for joint & synovial lesions, 31(17%) for planter fascia lesions, 12(7%) for ligament lesions, 9(5%) for Bursal lesions and 7(4%) for subcutaneous lesions. Of these all lesions, 29 lesions (16%) were not clinically suspected. Conclusion: Ultrasonography is an ideal method for testing patients with hindfoot pain and are highly capable of identifying a wide variety of pathologies, some of which may not be clinically identified.

Treatment adherence and disease status among children with rheumatological diseases during COVID-19 pandemic: A cross-sectional study from a tertiary care center

Introduction: There is a reallocation of health-care services across the world in view of the COVID-19 pandemic. This has resulted in the disruption of routine care to children with chronic rheumatological diseases. We studied the treatment adherence and disease status of these children during the COVID-19 pandemic.Methods: We did a cross-sectional observational study of children (<16 years) with rheumatological diseases. Parents of seventy consecutive children with rheumatological diseases were interviewed through the telephone to assess the treatment adherence and disease status from April 2020 to July 2020.Results: In our study cohort, 44.3' (n = 31) had juvenile idiopathic arthritis (JIA), 52.9' (n = 37) had childhood lupus childhood-onset systemic lupus erythematosus (cSLE), 1.4' (n = 1) had juvenile scleroderma, and 1.4' (n = 1) had childhood vasculitis. About 38.6' (n = 27) had poor compliance due to reasons like difficulty in transportation (88.6') (n = 24), financial constraints (88.6') (n = 24), fear of acquiring COVID-19 by attending the study center (55.5') (n = 15), and fear of taking immunosuppressive drugs (18.5') (n = 5). Thirty percent (n = 21) respondents reported flare of symptoms. Common flare symptoms reported were joint pain (25.7') (n = 18), skin rashes (1.4') (n = 1), and oral ulcers (1.4') (n = 1). One patient with cSLE required admission for acute pancreatitis. Nearly 4.3' (n = 3) experienced influenza like illness. One patient with cSLE developed swab-positive mild COVID-19 illness. cSLE patients experienced significantly less flare symptoms compared to patients with other rheumatological illness (P = 0.03, odds ratio = 0.32, confidence interval = 0.1–0.9). Almost 98.6' (n = 68) of parents were not aware of electronic consultation portals.Conclusion: Although COVID-19 causes less symptomatic disease in children, this study highlights the indirect effects of pandemic like financial constraints and parental misconceptions on children with rheumatological diseases. Furthermore, the awareness about electronic portals in consultation needs to be increased.

Cognitive impairment in elderly patients with rheumatic disease and the effect of disease-modifying anti-rheumatic drugs.

Recent development of biologic disease-modifying anti-rheumatic drugs (DMARDs) has led to better control of disease activity among patients with chronic rheumatological diseases. Many patients with rheumatic disease are living longer, adding to the growing elderly population. Rheumatic diseases, most notably rheumatoid arthritis (RA) and systemic lupus erythematosus (SLE), are known to increase the risk of cognitive impairment. Systemic inflammation associated with chronic rheumatological diseases has been postulated to be key driver of cognitive decline. Recent development of classic and biologic DMARDs have led to better control of disease activity among patients with rheumatic conditions. It is proposed that strict control of systemic inflammation will significantly lower the risk of cognitive impairment among patients with rheumatic disease. The impact of classic DMARDs on cognitive function appears to be variable. On the other hand, biologic DMARDs, specifically antitumor necrosis factor (TNF) drugs (i.e., etanercept), have been shown to significantly lower the risk of dementia. Experimental studies on IL-1, IL-6, and B and T cell blockade are promising. However, clinical data is limited. Preclinical studies on targeted therapies, specifically JAK/STAT inhibitors, also show promising results. Additional studies are necessary to better understand the impact of these newer biologic agents on cognitive function in elderly patients with rheumatic disease. Key points • Patients with chronic rheumatic conditions are beginning to live longer, adding to the elderly population. • Patients with chronic rheumatologic disease are at increased risk of cognitive impairment compared to the general population. • Recent development of biologic (i.e., TNF, IL-1, IL-6) and targeted drugs (i.e., Janus kinase inhibitors) have led to better control of disease activity. • Current evidence suggests that TNF inhibitors may have beneficial effects on cognitive function. However, evidence on newer biologic and targeted therapies is limited.

Tuberculin skin test conversion in patients under treatment with anti-tumor necrotizing factor alpha agents

BackgroundDespite successful clinical outcomes of biologic medications in patients with chronic rheumatic diseases, some considerable adverse effects such as infections remain a major concern. Possibility of tuberculosis (TB) reactivation over treatment with anti-tumor necrotizing factor (TNF) alpha agents has necessitated a screening test before initiation of treatment. However, screening over the course of treatment is not recommended in those patients with negative baseline screening tests. This study aimed to evaluate the efficacy of tuberculin skin test (TST) before treatment in patients with chronic rheumatologic diseases who were indicated to receive anti-TNF-alpha therapy and the necessity of repeating this test over the course of treatment.MethodsIn this prospective study, patients with chronic rheumatologic diseases receiving anti-TNF-alpha agents were studied in a two-year period. TST was performed before treatment and those with positive results were excluded from the study. Thereafter, treatment with anti-TNF-alpha agents was initiated with the indicated dose. TST was repeated before administration of biologic treatment until TST became positive or 16 weeks after the initiation of treatment with anti-TNF-alpha.ResultsA total of 51 cases were studied, of whom one patient (1.9%) was excluded due to positive TST before treatment. All participants received infliximab and the TST test became positive in one patient (2%) 2 weeks after receiving the first dose. Also, the results of further tests at weeks 6, 10, and 14 were all negative for the remaining patients.ConclusionDue to the possibility of TST conversion after administration of anti-TNF-alpha therapy, it is important to consider TB monitoring in patients under treatment with these agents using available methods such as TST.

Opioid prescribing in adults with and without psoriasis

To the Editor: Opioids are generally not indicated for chronic pain from musculoskeletal and skin diseases1; however, there is emerging literature that patients with chronic rheumatologic and dermatologic diseases are receiving opioids at a higher rate than the general population.2-4 The objective of this study was to examine the 1-year incidence of opioid prescriptions in opioid-naive adults with and without psoriasis.