Chlorotic Spot Research Articles

<p class="Body"><strong>Injurious status of <em>Schizotetranychus schizopus </em>(Zacher, 1913) (Acari: Tetranychidae) on Indian Thorny Bamboo</strong></p>

Spider mites, especially members of Schizotetranychus represent a common and dominant group of bamboo pests, enjoying worldwide distribution. The present paper highlights the feeding attributes of a notorious species of bamboo spider mite, viz. Schizotetranychus schizopus (Zacher, 1913) infesting the Indian Thorny Bamboo, Bambusa bambos (L.) Voss. Observations on feeding behavior of the mite were completed in the laboratory by collecting mite specimens from infested leaves of bamboo plants grown in Calicut University Botanical Garden. The species showed initial colonization on the abaxial surface of bamboo leaves, adjacent to the midrib and feeding activity of the members of the colony resulted in the development of damage symptoms like chlorotic spots, white patches, yellowing etc. Comparative analysis of the biochemical constituents of mite infested and uninfested leaves of B. bambos revealed significant alterations. Mite infested bamboo leaves presented significantly reduced values of chlorophyll fluorescence (30.10% loss in Fv/Fm ratio) thereby indicating a decline of photosynthetic efficiency. Significant reduction in total carbohydrate (58.87%) and total protein (21.02%) contents also could be accounted in mite infested leaves. Meanwhile, mite infestation was found to enhance the production of stress compounds such as Total Phenol (22.86%) and Proline (69.05%). An increase in the uptake of micro and macronutrients like Potassium (18.87%), Calcium (36.66%), Copper (48.76%) and Zinc (19.62%) was also observed in mite infested leaves. Despite this, the uptake of nutrients such as Phosphorus (8.22%), Magnesium (3.55%), Sulphur (1.54%), Iron (11.46%), Manganese (13.64%) and Boron (30.09%) significantly decreased owing to mite infestation. Significant decrease in moisture content also was evident in the mite infested bamboo leaves. The results of the study helped to evidence the biotic stress induced by the mite on its bamboo host, by promoting enhanced production of Total Phenol, Proline, Potassium, Calcium, Copper and Zinc which would play a substantial role in the defense mechanism of the plant.

Pealius gallae sp. nov. (Hemiptera: Aleyrodidae) causing leaf pit galls in Celtis philippensis Blanco (Rosales: Cannabaceae) in Andaman Islands, India

A new whitefly species, Pealius gallae sp. nov. forming pit galls on Celtis philippensis Blanco discovered in the Andaman Islands, is described and illustrated. Leaf pit galls were formed in the microhabitat of the puparia, each pit was observed with a single puparium, the opposite side of the galls was convex, easily recognizable by chlorotic spots; older galls turn brown and brittle. This is the first authentic record with illustrations of any leaf pit gall forming whitefly. The specialised gall inducing insects may pose extinction risks with limited host range. The new whitefly differs from Pealius cinnamomi David and Sundararaj in the habitus, gall forming nature, number of submarginal setae, vasiform orifice shape, broad tracheal folds and pattern of tubercles in it.

A novel emaravirus comprising five RNA segments is associated with ringspot disease in oak

We report the complete nucleotide sequence of the genome of a novel virus in ringspot-diseased common oak (Quercus robur L.). The newly identified pathogen is associated with leaf symptoms such as mottle, chlorotic spots and ringspots on diseased trees. High-throughput sequencing (HTS, Illumina RNASeq) was used to explore the virome of a ringspot-diseased oak that had chlorotic ringspots of suspected viral origin on leaves for several years. Bioinformatic analysis of the HTS dataset followed by RT-PCR enabled us to determine complete sequences of four RNA genome segments of a novel virus. These sequences showed high similarity to members of the genus Emaravirus, which includes segmented negative-stranded RNA viruses of economic importance. To verify the ends of each RNA, we conducted rapid amplification of cDNA ends (RACE). We identified an additional genome segment (RNA 5) by RT-PCR using a genus-specific primer (PDAP213) to the conserved 3´ and 5´termini in order to amplify full-length genome segments. RNA 5 encodes a 21-kDa protein that is homologous to the silencing suppressor P8 of High Plains wheat mosaic virus. The five viral RNAs were consistently detected by RT-PCR in ringspot-diseased oaks in Germany, Sweden, and Norway. We conclude that the virus represents a new member of the genus Emaravirus affecting oaks in Germany and in Scandinavia, and we propose the name “common oak ringspot-associated emaravirus” (CORaV).

Molecular identification and characterization of groundnut bud necrosis virus and its associated thrips vector from Gerbera jamesonii in India

Gerbera is an important cut flower crop popular throughout the world. In summer months of 2016, gerberas grown in polyhouses of RHREC, GKVK, Bengaluru, Karnataka, India showed heavy infestation of thrips and displayed symptoms of viral infections. Infected plants displayed irregular chlorotic or necrotic spots or blotches, necrosis of veins, bronzing, crinkling and deformations of leaves; necrotic streaks on flower stalks; chlorosis or necrosis of flower petals; tip necrosis or death of young plants. The virus was identified as groundnut bud necrosis virus based on DAC-ELISA, RT-PCR and transmission studies, and it was characterized by cloning and sequencing of N gene and 3′ UTRs. Thrips associated was identified as Scirtothrips dorsalis and the virus was detected in individual thrips using DAC-ELISA. The virus could be efficiently transmitted to cowpea variety C-152 both by mechanical sap inoculation and vector transmission and to tulsi plants by vector transmission. Sequence of S-RNA segment of the virus from two independent gerbera samples was submitted under the accession numbers KX832986.1 and KX832987.1. The two isolates showed per cent identities of 97.1 and 98.5 at N gene and at 3′ UTRs, respectively, with each other and 92.9–99.1% at N gene with other GBNV isolates. Phylogenetically they clustered along with other GBNV isolates reported from different hosts and locations within the major clade of watermelon silver mottle virus serogroup. Differential response was observed in gerbera varieties with respect to incidence of GBNV disease (19.6–80.6%) and thrips (24.6–54.0 thrips/leaf) with the least incidence in the varieties Esmara and Orinaco.

Evaluation of apple cultivars to four pome fruit viruses in Iranian National Collection of Kamalshahr Horticulture Research Station, Karaj

The National Iranian Apple Collection comprises a wide range of native and imported commercial cultivars used for breeding researches. Successful phenotyping requires healthy plants capable of expressing the existing genetic potential. The time-consuming and expensive process of producing healthy primary nucleus may be avoided by a primitive screening of the plant material. Indeed, the new young shoots grown next to heavy pruning under high regional solar radiation may act as in vivo thermotherapy. A total of 98 samples collected from 48 apple cultivars were assessed to detect the occurrence and prevalence of lethal viruses such as Apple stem pitting virus, Apple chlorotic leaf spot virus, Apple stem grooving virus and Tomato ring spot virus. The presence of ASPV, ACLSV, ASGV and ToRSV was tested by DAS ELISA using specific antibodies. To confirm ELISA results, all virus-free samples, or ones suspected of being infected by a sole virus, were consequently subjected to reverse transcription polymerase chain reaction (RT-PCR). This was achieved by the use of specific primers for a region of the ACLSV and ASPV genomes which encode part of the coat protein (CP), specific primers for full length CP of ASGV, and specific primers for a region of the ToRSV genome which encodes part of the replicase. The ELISA results demonstrated that 71.4%, 47.5% and 18.5% of the samples in total were infected by ACLSV, ASPV, and ASGV respectively. No infection by ToRSV was observed within the tested cultivars. The integration of ELISA results with RT-PCR proved that McIntosh1, Starking1, Red spur cooper2, Yellow transparent1, and Glockenapfel were recognized virus-free material, and therefore could be used and maintained as primary nucleus and healthy mother orchards.

Rapid and specific detection of apple chlorotic leaf spot virus in pear by reverse-transcription recombinase polymerase amplification.

Apple chlorotic leaf spot virus (ACLSV) is an important virus infecting fruit trees. It causes serious economic losses in the global production of fruit trees belonging to the genera Prunus and Malus and can be vegetatively transmitted during propagation. In this study, an isothermal reverse transcription-recombinase polymerase amplification (RT-RPA) assay method was developed for detecting ACLSV in pear leaves. A set of RT-RPA primers showed high rapidity, sensitivity, and specificity in ACLSV detection. The RT-RPA assay was performed at a single, constant temperature of 42°C, could be completed in approximately 10min, and did not exhibit cross-reactivity with other common pear viruses. This RT-RPA assay was 100-fold more sensitive than regular RT-PCR. The optimized RT-RPA assay was further used to detect ACLSV in field-collected pear samples. These advantages make RT-RPA a promising diagnostic tool for determining ACLSV infection in pear certification programs. Keywords: apple chlorotic leaf spot virus; detection; pear; reverse transcription-recombinase polymerase amplification.

HISTOPATHOLOGICAL PATTERNS OF LESIONS CAUSED BY TWO DICHORHAVIRUS

Different from most plant viruses, Brevipalpus mite-transmitted viruses (BTV) cause localized infection, not being able to systemically invade the infected plant. To broaden the specter of the histopathological changes in leaf tissues induced by BTV infection, we examined the tissue organization of leaf lesions caused by the infection of two additional representatives of dichorhaviruses, Clerodendrum chlorotic spot virus (ClCSV) and Coffee ringspot virus (CoRSV). In general, tissue alterations within the lesions followed the pattern noticed in CiLV-C and CiLV-N infection. In all analyzed lesions, necrotic cells form the central region that is surrounded by a chlorotic halo where hypertrophied cells commonly occur. Presence of reactive oxygen components were also a characteristic of the chlorotic halo. Though more cases of localized lesions on leaves infected by more BTV, remains to be analyzed, it seems that these lesions respond similarly upon infection by BTV, either Cile- or Dichorhavirus.

First report of pear chlorotic leaf spot-associated virus on Japanese and European pears in Japan and its detection from an eriophyid mite.

In May 2018, three leaf samples were collected from Japanese pear trees cv. "Hosui" that exhibited typical chlorotic spot symptoms (Supplementary Figure S1) in a germplasm nursery in Tsukuba, Ibaraki. Total RNA was prepared using the rapid CTAB method (Gambino et al. 2008) for high-throughput sequencing, as described by Kubota et al. (2020). In brief, after removing ribosomal RNAs, a library was constructed by fragmenting RNA, synthesizing cDNA, and polymerase chain reaction (PCR) amplification. Sequencing was performed using NovaSeq 6000 sequencer (Illumina, San Diego, CA, U.S.A.) with paired-end 150 nt reads. De novo assembly was performed using CLC Genomics Workbench 11.0 Software (Qiagen, Hilden, Germany), with a minimum length of 500 bp. A total of 36,017 contigs derived from 33,565,182 reads were obtained and subjected to BLASTX search against the GenBank sequence database as of January 2019. Viruses commonly found in stone fruits, i.e., apple stem pitting virus, apple green crinkle-associated virus, apricot latent virus (foveaviruses), and apple stem grooving virus (a capillovirus), were detected. In addition, five contigs with amino acid sequence homologies to P1-P4 of known emaraviruses and the P7 of High Plains wheat mosaic virus (Tatineni et al. 2014) were detected and designated as PEV-Jp. The complete nucleotide (nt) sequences of the five segments of PEV-Jp were determined by Sanger sequencing of cloned reverse transcription (RT)-PCR amplification products using the primers shown in Supplementary Table S1; the 5'- and 3'-terminal sequences were RACE verified (Takara Bio, Shiga, Japan). In pairwise comparisons, the complete RNA1 to RNA5 of PEV-Jp (LC554756-760) shared 90.7% to 98.7% nt identities with those of PCLSaV-CG1 (MK602177-181), indicating that PEV-Jp is an isolate of PCLSaV. Using newly designed segment-specific primers (Supplementary Table S1), 12 symptomatic Japanese pear trees cv. "Kosui" sampled in 2020 from the same nursery tested positive for PCLSaV by RT-PCR while 12 symptomless trees were negative for the virus. Similar chlorotic spots, sometimes accompany necrotic spots, were observed on European pear (Pyrus communis) cv. "Le Lectier." (Fig. S1F) in Niigata in 2019; PCLSaV was detected by RT-PCR in leaf tissue samples from symptomatic trees (n = 3/3) but not in symptomless trees (n = 0/2). No vector for PCLSaV has been identified (Liu et al. 2020) but acaricide sprays in the early spring are effective for preventing occurrence of chlorotic spots in pear orchards (Nakai et al. 2018). Since the infestations of Eriophyes chibaensis Kadono, an eriophyid mite often observed on the Japanese pear (Fig. S1G to S1I) (Kadono, 1981), has been associated with occurrences of the chlorotic spots (Shimizu et al. 2019), samples of E. chibaensis individuals were collected from PCLSaV-positive Japanese pear cvs. "Akizuki" and "Kosui"and P. communis cv. "Le Lectier." for total nucleic acid isolations via phenol-chloroform extraction, followed by quantitative RT-PCR (Supplementary Table S1). The expected RNA1 and RNA5 specific 150 bp products were detected from mite samples collected from Akizuki (n = 6/12), Kosui (n = 13/18), and Le Lectier (n = 6/8). The results indicate that E. chibaensis can ingest PCLSaV and may be a potential vector for the virus, although additional experiments are needed to demonstrate its vector competency. To our knowledge, this is the first report of PCLSaV in Japan and the first report of its detection in E. chibaensis.

Diversity of Expression Types of Ht Genes Conferring Resistance in Maize to Exserohilum turcicum.

Northern corn leaf blight (NCLB) is an important leaf disease in maize (Zea mays) worldwide and is spreading into new areas with expanding maize cultivation, like Germany. Exserohilum turcicum, causal agent of NCLB, infects and colonizes leaf tissue and induces elongated necrotic lesions. Disease control is based on fungicide application and resistant cultivars displaying monogenic resistance. Symptom expression and resistance mechanisms differ in plants carrying different resistance genes. Therefore, histological studies and DNA quantification were performed to compare the pathogenesis of E. turcicum races in maize lines exhibiting compatible or incompatible interactions. Maize plants from the differential line B37 with and without resistance genes Ht1, Ht2, Ht3, and Htn1 were inoculated with either incompatible or compatible races (race 0, race 1 and race 23N) of E. turcicum. Leaf segments from healthy and inoculated plants were collected at five different stages of infection and disease development from penetration (0–1 days post inoculation - dpi), until full symptom expression (14–18 dpi). Symptoms of resistance responses conveyed by the different Ht genes considerably differed between Ht1 (necrotic lesions with chlorosis), Ht2 (chlorosis and small lesions), Ht3 (chlorotic spots) and Htn1 (no lesions or wilt-type lesions). In incompatible interactions, fungal DNA was only detected in very low amounts. At 10 dpi, DNA content was elevated in all compatible interactions. Histological studies with Chlorazol Black E staining indicated that E. turcicum formed appressoria and penetrated the leaf surface directly in both types of interaction. In contrast to incompatible interactions, however, the pathogen was able to penetrate into xylem vessels at 6 dpi in compatible interactions and strongly colonized the mesophyll at 12 dpi, which is considered the crucial process differentiating susceptible from resistant interactions. Following the distinct symptom expressions, resistance mechanisms conferred by Ht1, Ht2, Ht3, and Htn1 genes apparently are different. Lower disease levels and a delayed progress of infection in compatible interactions with resistant lines imply that maize R genes to E. turcicum are associated with or confer additional quantitative resistance.

First report of Tomato spotted wilt virus in Petasites japonicus in Korea.

Butterbur (Petasites japonicus [Siebold & Zucc.] Maxim.) is a perennial herb of the Asteraceae family that is cultivated for medicinal and nutritional purposes. Due to long-term vegetative propagation of virus-infected native species, the yield and quality of butterbur plants have deteriorated. Five viruses have been reported to infect this species: alfalfa mosaic virus (AMV), arabis mosaic virus (ArMV), butterbur mosaic virus (ButMV), broad bean wilt virus 2 (BBWV-2), and cucumber mosaic virus (CMV) (Ham et al. 2016; Tochihara and Tamura 1976). From 2018 to 2019, butterbur plants in four greenhouses in Nonsan, South Korea (Supplementary Figure S1a, b) were found to show virus-like symptoms such as chlorotic and necrotic ring spots, necrosis, and mild mosaic on the leaves. Disease incidence was greater than 80% in one greenhouse (~1,000 m2). To identify the causal virus, we collected 17 symptomatic butterbur leaf samples from these greenhouses and performed reverse-transcription polymerase chain reaction (RT-PCR) analysis using species-specific detection primers for the five reported viruses and tomato spotted wilt virus (TSWV) (Supplementary Table S2). RT-PCR results showed that 12 samples from three greenhouses showing necrotic ring spots and mosaic symptoms were infected with a mixture of TSWV and ButMV, whereas 5 samples from one greenhouse showing mild mosaic symptoms were infected only with ButMV. TSWV (genus Orthotospovirus, family Tospoviridae) is transmitted by thrips and causes serious damage to a wide range of economically important plants (Pappu et al. 2009). ButMV (genus Carlavirus, family Betaflexiviridae) is transmitted by aphids, as well as infected vegetative propagation material (Hashimoto et al. 2009) and is the most predominant virus in butterbur in Korea (Ham et al. 2016). To isolate TSWV from butterbur, leaf extracts from symptomatic samples were mechanically inoculated on an assay host, Chenopodium quinoa, via three single-lesion passages followed by propagation in Nicotiana tabacum cv. Samsun. Thirty different indicator plant species were used for the bioassay of the TSWV isolate (TSWV-NS-BB20) by mechanical inoculation method (Supplementary Table S3). RT-PCR analysis confirmed that TSWV-NS-BB20 induced necrotic local lesions and mosaic on Nicotiana species and ring spots and mosaic on tomatoes and peppers. Notably, TSWV-NS-BB20 reproduced necrotic local lesions and mild mosaic symptoms on butterbur plants which were infected with ButMV with no obvious symptoms. To characterize TSWV-NS-BB20 genetically, the complete genome sequences of L (8914 nt), M (4751 nt), and S (2917 nt) RNA segments were obtained by RT-PCR using specific primers for TSWV as described previously (Kwak et al., 2020). The obtained sequences were deposited in GenBank under accession nos. MT643236, MT842841, and MN854654, respectively. BLASTn analysis showed that sequences of each segment had maximum nucleotide identities of 99.0, 98.9, and 98.6% to TSWV-L, M, and S (KP008128, FM163373, and KP008129) of TSWV-LL-N.05 isolate from tomato in Spain. Since 2018, TSWV outbreaks on butterbur are observed every year and thus may act as a potential source of TSWV infection for other crops of importance to Korea, such as pepper. Owing to the butterbur vegetative propagation, the identification of TSWV infection in butterbur will be helpful for future virus management to generate virus-free materials. To our knowledge, this is the first report of TSWV infection of butterbur.

Occurrence of Plasmopara destructor causing Downy Mildew on Impatiens walleriana in Brazil.

Impatiens walleriana (Balsaminaceae), popularly known as Impatiens, is an African succulent and a popular ornamental plant worldwide (GBIF, 2019). In Brazil it is broadly grown indoors and outdoors, including in public parks of Curitiba, State of Paraná (Viezzer et al. 2018). In September 2018, I. walleriana plants showing typical downy mildew symptoms were observed in wastelands and gardens in Curitiba. The symptoms included adaxial chlorotic leaf spots with abundant white sporulation on abaxial side (Supplementary figure 1). The disease led to severe defoliation of the plants and the incidence of the plant disease varied from 20 to 80% of plants in an area ranging from 400 to 40,000 m2. A representative sample was deposited in herbarium of the Museu Botânico Municipal de Curitiba (MBM 331601). The following morphology was observed: Sporangiophores (n = 30), hyaline, thin walled, emerging through stomata, 407.3 to 551.1 μm long, slightly swollen base, first branch at 165.8 to 324.7 μm from base, end branches 5.1 to 13.1 μm long, sporangia (n = 50) hyaline, thin-walled subglobose to ovoid, from 12.8 to 21.9 μm x 12.5 to 17.9 μm, slightly papillate. Due to morphological and genetic variations within the species Plasmopara obducens, Görg et al. (2017) proposed the new species P. velutina and P. destructor. The morphology of the Curitiba specimen was equivalent to that described for P. destructor (Görg et al. 2017). DNA was extracted from LEMIDPRTf-19-02 isolate and the ITS1 and cox2 regions were PCR amplified as described in Görg et al. (2017). The resulting sequences were deposited in GenBank (ITS1, MT680628; cox2, MT952335). A BLASTn analysis of the sequences revealed 100% homology with ITS (MF372742) and cox2 (MF372728) sequences of type strain of P. destructor (GLM-F107554). A Bayesian phylogenetic analysis was performed to compare the sequences from this study with reference sequences for P. obducens, P. destructor and P. velutina (Görg et al. 2017; Salgado-Salazar et al. 2018). The oomycete from Curitiba grouped in a reliable clade with P. destructor (Supplementary figure 2). Pathogenicity was carried out by ex vivo and in vivo tests. For ex vivo, stems with approximately four healthy leaves of I. walleriana (n = 10) were embedded in aluminum grid inside of gerbox with the stem bases immersed in distilled water. The inoculation of five stems was carried out by spraying a suspension with 6 x 104 sporangia mL-1 on the abaxial side of the leaves. Five stems with leaves inoculated with sterile water were used as controls. They were incubated in a growth chamber in the dark for 48 h at 20 °C and another 12 days in a 12 h light photoperiod. The confirmation of pathogenicity in plants (in vivo) was obtained with the inoculation of I. walleriana seedlings (one-month old) grown in 2 dm3 aluminum pots. The inoculation methodology and number of plants were the same as the stems test. After the inoculation, plants were incubated in a growth chamber for 48 h in the dark at 20 °C with 100% RH with nebulization, and another 10 days at a photoperiod of 12 hours of light. For both tests, abundant sporulation was observedwith morphology equivalent to Plasmopara destructor described by Görg et al. (2017). No disease developed on control plants. To our knowledge, this is the first report of P. destructor on I. walleriana in Brazil (Farr and Rossman 2019, Silva et al. 2019) representing a potential loss to flower production and a reduction in flowering period in public gardens and parks.

Identification of Pomegranate as a New Host of Passiflora Edulis Symptomless Virus (PeSV) and Analysis of PeSV Diversity

Pomegranate is an important crop in the Mediterranean Basin that can be affected by a range of pathogens. With the aim to better understand the impact of viral diseases on pomegranate, two leaf samples from Turkey showing virus-like symptoms such as chlorotic spots and oak-leaf patterns were subjected to high throughput sequencing (HTS). Data analysis indicated the presence of passiflora edulis symptomless virus (PeSV: genus Roymovirus, Potyviridae family) in these two pomegranate samples, consistent with the observation by electron microscopy of flexuous filamentous viral particles 760 to 780 nm long. Further analysis of HTS reads revealed the presence of five PeSV variants in one of the samples and another single variant in the other. PeSV occurrence was also identified from publicly available SRA pomegranate RNA-Seq transcriptomic data from India and China. The genome of these PeSV-pomegranate variants share 78.0–86.8% nucleotide identity with that of the reference isolate from passionfruit (MH379332). The presence of PeSV in pomegranate was confirmed by specific RT-PCR assays targeting either the coat protein (CP) or Nla-Pro genes in 37 cultivated and one ornamental pomegranate out of 133 samples collected from the Eastern Mediterranean region of Turkey. To our knowledge, this is the first application of HTS to assess virus occurrence in pomegranate and the first recognition of pomegranate as a new host for PeSV.

Effect of heavy metals in the cement dust pollution on morphological and anatomical characteristics of Cenchrus ciliaris L.

This present study illustrated the effect of heavy metals in cement dust pollution on Cenchrus ciliaris L. This wild plant species spread surrounding and within the contaminated area. The induced soil by cement dust was changed physically and chemically. There were alterations in morphological characters like chlorotic spot, stem shortening and leaf curling. Similarly, anatomical alterations appeared obviously like rupturing and thickening of cells. The data of control and induced plant species were analyzed statistically separately and combined respectively. The regression equations represented the interaction between control and induced plant species graphically. Cenchrus ciliaris L. can be regarded as a standard heavy metal tolerant plant species.

First Report of Colletotrichum siamense Causing Anthracnose of Monstera deliciosa in Zhanjiang, China.

Monstera deliciosa Liebm is an ornamental foliage plant (Zhen et al. 2020De Lojo and De Benedetto 2014). In July of 2019, anthracnose lesions were observed on leaves of M. deliciosa cv. Duokong with 20% disease incidence of 100 plants at Guangdong Ocean University campus (21.17N,110.18E), Guangdong Province, China. Initially affected leaves showed chlorotic spots, which coalesced into larger irregular or circular lesions. The centers of spots were gray with a brown border surrounded by a yellow halo (Supplementary figure 1). Twenty diseased leaves were collected for pathogen isolation. Margins of diseased tissue was cut into 2 × 2 mm pieces, surface-disinfected with 75% ethanol for 30 s and 2% sodium hypochlorite (NaOCl) for 60 s, rinsed three times with sterile water before isolation. Potato dextrose agar (PDA) was used to culture pathogens at 28℃ in dark. Successively, pure cultures were obtained by transferring hyphal tips to new PDA plates. Fourteen isolates were obtained from 20 leaves. Three single-spore isolates (PSC-1, PSC-2, and PSC-3) were obtained ,obtained, which were identical in morphology and molecular analysis (ITS). Therefore, the representative isolate PSC-1 was used for further study. The culture of isolate PSC-1 on PDA was initially white and later became cottony, light gray in 4 days, at 28 °C. Conidia were single celled, hyaline, cylindrical, clavate, and measured 13.2 to 18.3 µm × 3.3 to 6.5 µm (n = 30). Appressoria were elliptical or subglobose, dark brown, and ranged from 6.3 to 9.5 µm × 5.7 to 6.5 µm (n = 30). Morphological characteristics of isolate PSC-1 were consistent with the description of Colletotrichum siamense (Prihastuti et al. 2009; Sharma et al. 2013). DNA of the isolate PSC-1 was extracted for PCR sequencing using primers for the rDNA ITS (ITS1/ITS4), GAPDH (GDF1/GDR1), ACT (ACT-512F/ACT-783R), CAL (CL1C/CL2C), and TUB2 (βT2a/βT2b) (Weir et al. 2012). Analysis of the ITS (accession no. MN243535), GAPDH (MN243538), ACT (MN512640), CAL (MT163731), and TUB2 (MN512643) sequences revealed a 97-100% identity with the corresponding ITS (JX010161), GAPDH (JX010002), ACT (FJ907423), CAL (JX009714) and TUB2 (KP703502) sequences of C. siamense in GenBank. A phylogenetic tree was generated based on the concatenated sequences of ITS, GAPDH, ACT, CAL, and TUB2 which clustered the isolate PSC-1 with C. siamense the type strain ICMP 18578 (Supplementary figure 2). Based on morphological characteristics and phylogenetic analysis, the isolate PSC-1 associated with anthracnose of M. deliciosa was identified as C. siamense. Pathogenicity test was performed in a greenhouse at 24 to 30oC with 80% relative humidity. Ten healthy plants of cv. Duokong (3-month-old) were grown in pots with one plant in each pot. Five plants were inoculated by spraying a spore suspension (105 spores ml-1) of the isolate PSC-1 onto leaves until runoff, and five plants were sprayed with sterile water as controls. The test was conducted three times. Anthracnose lesions as earlier were observed on the leaves after two weeks, whereas control plants remained symptomless. The pathogen re-isolated from all inoculated leaves was identical to the isolate PSC-1 by morphology and ITS analysis, but not from control plants. C. gloeosporioides has been reported to cause anthracnose of M. deliciosa (Katakam, et al. 2017). To the best of our knowledge, this is the first report of C. siamense causing anthracnose on M. deliciosa in ChinaC. siamense causes anthracnose on a variety of plant hosts, but not including M. deliciosa (Yanan, et al. 2019). To the best of our knowledge, this is the first report of C. siamense causing anthracnose on M. deliciosa, which provides a basis for focusing on the management of the disease in future.

Orthotospovirus disease epidemic: molecular characterization and incidence in peanut crops

Argentina is one of the main peanut (Arachis hypogaea L.) exporting countries with the major peanut-growing area located in the province of Cordoba. During the 2015–2016 growing season, severe outbreaks of an orthotospovirus-like disease occurred in a number of commercial peanut fields. The aim of this work was to determine the prevalence of orthotospoviruses and their incidence in peanut. In DAS-ELISA, all samples collected from symptomatic plants reacted with antisera to groundnut ringspot virus/tomato chlorotic spot virus (GRSV/TCSV) and tomato spotted wilt virus (TSWV). RT-PCR was performed with a single pair of primers for conserved regions of the GRSV, TCSV and TSWV nucleoprotein (N) genes, and digestion with restriction enzymes, allowed the identification of the pathogen as GRSV. The results were confirmed by sequencing of the N gene. Diseased peanut plants were observed in 30 out of 81 surveyed fields located in the north-central region of the peanut-growing area. In that region, the disease incidence was evaluated in four commercial fields, recorded values from 3% to 47.25% with a mean disease incidence of 18.69%. Our study reported for the first time a significant outbreak of GRSV in peanut in Argentina and provide information on the occurrence and distribution of some Orthotospovirus species.

First Report of Cichorium endivia (Asteraceae) as a Natural Host of Groundnut ringspot orthotospovirus in Brazil.

Endive (Cichorium endivia L.) is a very important cash crop for small farmers in Brazil. During inspections conducted in the summer season of 2019-2020, leaf samples of C. endivia 'La Spezia' seedlings exhibiting typical symptoms of orthotospoviruses infection (viz. concentric chlorotic spots and apical leaf deformation; ≈ 10%) were collected in commercial greenhouses in Brasília-DF, Central Brazil. Leaves of one healthy and three symptomatic plants were initially evaluated via double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) with polyclonal antibodies (produced at CNPH) raised against the nucleoprotein of the three major orthotospoviruses: tomato spotted wilt orthotospovirus (TSWV), groundnut ringspot orthotospovirus (GRSV) and tomato chlorotic spot orthotospovirus (TCSV). Strong serological reactions were observed only against GRSV antibodies exclusively in extracts from symptomatic samples. In order to confirm the causal agent of those symptoms, total RNA was extracted (Trizol®; Sigma) from infected leaf samples and used in a two-step reverse transcriptase polymerase chain reaction (RT-PCR) approach. Synthesis of the cDNA was carried out with the J13 primer (5'-CCC GGA TCC AGA GCA AT-3') (Cortez et al., 2001) followed by PCR assays with the primer pair BR60 (5'-AGA GCA ATC GTG TCA-3`) and BR65 (5'-ATC AAG CCT TCT GAA AGT CAT-3') (Eiras et al., 2001). This primer set amplifies a fragment of 453 bp including the untranslated region at the 3' terminus of the small RNA and the protein N-coding gene of at least five orthotospoviruses: TSWV, GRSV, TCSV, chrysanthemum stem necrosis orthotospovirus (CSNV) and zucchini lethal chlorosis orthotospovirus (ZLCV) (Eiras et al., 2001). The obtained amplicons (≈ 432 bp) were subsequently subjected to Sanger dideoxy nucleotide sequencing at CNPH. BLASTn analysis showed >99% identity with a wide array of GRSV isolates available in the GenBank. The nucleotide sequence of Tospo #1 (MT215222) and Tospo #3 (MT215224) isolates displayed 100% identity between them, whereas the Tospo #2 (MT215223) isolate displayed one non-synonymous point mutation in the 3' untranslated region in comparison with the former two isolates. Three plants of C. endivia, Capsicum annuum L. cv. Ikeda, tomato (Solanum lycopersicum L.) cv. Santa Clara and its isoline 'LAM-147' (with the Sw-5 resistance gene), Nicotiana rustica L., Lactuca sativa L. ('Vanda' and 'PI-342444') and Gomphrena globosa L. were mechanically inoculated individually with each GRSV isolate in order to confirm their pathogenicity. Chlorotic lesions and mosaic were observed seven days after inoculation of all plant materials, except the tomato inbred line 'LAM-147', which has the Sw-5 gene that confers broad-spectrum resistance to all Brazilian orthotospoviruses (Boiteux and Giordano, 1993). The GRSV infection was confirmed via DAS-ELISA and RT-PCR 15 days after inoculation, using the same set of antibodies and the primer pair BR60 / BR65. Transmission electron microscopy of ultrathin sections from symptomatic leaf tissues, both from field-infected and experimentally inoculated endive revealed the presence of typical orthotospovirus particles, within endoplasmic reticulum cisternae. Natural infection of endive by TSWV has been reported in Greece (Chatzivassiliou et al., 2000) and by TCSV in São Paulo State, Brazil and in Florida, USA (Subramanya Sastry et al., 2019). To our knowledge, it is the first report of GRSV naturally infecting this Asteraceae species in Brazil. Confirmation of GRSV infection of C. endivia plants is a relevant piece of information aiming to design effective disease management strategies.

Temporal Landscape of Human Gut Virome in SARS-CoV-2 Infection and Severity

Background: Coronavirus Disease 2019 (COVID-19) caused by the enveloped RNA virus SARS-CoV-2 primarily affects the respiratory and gastrointestinal tracts.SARS-CoV-2 was isolated from faecal samples and active viral replication was reported in human intestinal cells. The human gut also harbors an enormous amount of resident viruses (collectively known as virome) that play a role in regulating host immunity and pathophysiology.Understanding gut virome perturbation that underlies SARS-CoV-2 infection and severity is an unmet need.Methods: We enrolled 98 COVID-19 patients with varying disease severity (3 asymptomatic, 53 mild, 34 moderate, 5 severe, 3 critical) and 78 non-COVID-19 controls matched for gender and co-morbidities. All study subjects had faecal specimens sampled at inclusion. Blood specimens were sampled for COVID-19 patients at admission to test for inflammatory markers and white cell counts. Among COVID-19 cases, 37 (38%) patients had serially faecal samples collected 2 to 3 times per week from time of hospitalization until after discharge. Using shotgun metagenomics sequencing, we sequenced and profiled the faecal RNA and DNA virome respectively. We investigated alterations and longitudinal dynamics of the gut virome in association with disease severity and blood parameters.Findings: Patients with COVID-19 showed underrepresentation of P epper mild mottle virus (RNA virus) and multiple bacteriophage lineage s (DNA viruses) and enrichment of environment-derived eukaryotic DNA viruses in faecal samples, compared to non-COVID-19 subjects. Such gut virome dysbiosis persisted up to 30 days after disease resolution. Faecal virome in SARS-CoV-2 infection harboured more stress-, inflammation- and virulence-associated gene encoding capacities including those pertaining to bacteriophage integration, DNA repair, and metabolism and virulence associated with their bacterial host. Human faecal baseline abundance of 9 virus species (1 RNA virus, Pepper chlorotic spot virus, and 8 DNA virus species) inversely correlated with disease severity of COVID-19. These viruses were also inversely associated with blood levels of pro-inflammatory proteins, white cells and neutrophils. Among the 9 COVID-19 severity-associated virus species, 4 showed inverse correlation with age; 5 showed persistent lower abundance both during disease course and after disease resolution relative to non-COVID-19 subjects. Interpretation: Both enteric RNA and DNA viromes were perturbed in COVID-19, which prolonged even after disease resolution. Gut virome may calibrate host immunity and regulate severity to SARS-CoV-2 infection. Our observation that gut viruses inversely correlated with both severity of COVID-19 and host age partly explains that older subjects are prone to severe and unfavorable COVID-19 outcomes. Our data altogether highlight the significance of human gut virome in COVID-19 disease course and potentially therapeutics.Funding Statement: This work was supported by The D. H. Chen Foundation, Center for Gut Microbiota Research (Faculty of Medicine, The Chinese University of Hong Kong) and Health and Medical Research Fund (Hong Kong, China).Declaration of Interests: None.Ethics Approval Statement: This study was approved by the Joint Chinese University of Hong Kong–New Territories East Cluster Clinical Research Ethics Committees (Reference number: 2020.076). All subjects provided informed consent to participate in this study and agreed for publication of the research results.

First report of Raspberry leaf mottle virus infecting raspberry in Poland.

Raspberry leaf mottle virus (RLMV) in Europe has been associated with raspberry mosaic disease (Martin et al. 2013) and crumbly fruit disease (Quito-Avila et al. 2014) in red raspberry (Rubus idaeus L.) beside Rubus yellow net virus (RYNV) and Black raspberry necrosis virus (BRNV). RLMV has also been reported infecting blackberry (Jones and McGavin 1998; Thekke-Veetil et al. 2016). A survey of virus diseases was conducted from 2016 to 2018 in 34 raspberry commercial plantations in Central and southeastern Poland. Some of the plants showed chlorotic spots, vein yellows, mosaic patterns and deformation of leaves and fruits. Leaf samples from 146 plants were tested using RT-PCR for RLMV, RYNV, BRNV, Raspberry vein chlorosis virus (RVCV), Raspberry leaf blotch virus (RLBV), and Raspberry bushy dwarf virus (RBDV). The pairs of primers CPhF and CPhR (Tzanetakis et al. 2007) as well as 1436F and 1437R (McGavin and MacFarlane 2010) were used to amplify a 452-bp fragment of the coat protein homologue (CPh) gene and a 681-bp of the 1 a helicase gene, respectively. RT-PCR products were obtained for five samples from cultivars: Malling Promise (MPrOK1 and MPrOk2; plantation A), Canby (CanKop; plantation B), Polka (PolKop; plantation B) and Malling Seedling (MSeWa; plantation C) grown in southeastern Poland. MPrOK1 and MSeWa were co-infected with RYNV while the other three samples were mixed infected with RBDV. Each of these plants showed chlorotic spots and mosaic symptoms of different intensity, leaf deformation and reduced growth. The RLMV-specific amplicons obtained for all five positive samples were directly sequenced at Genomed company, Warsaw, Poland. The obtained sequences were aligned using ClustalW of the Lasergene 7.1 software (DNASTAR Inc., USA) and were compared with sequences available in GenBank using the BLASTn algorithm. The identity of nucleotide (nt) sequences of Cph gene of RLMV isolates found in Poland was revealed. They shared 97.7% and 99% nt sequence similarity with 'HCRL Glen Clova' from USA (DQ357218) and 'SCRI stock' isolate from United Kingdom (FN391551) strains respectively The nucleotide sequence of isolates from Poland indicates a closer relationship with the strain found in UK. However, the amino acid (aa) sequence of both reference strains was identical and shared 99.2% identity with the corresponding fragment of the isolates from Poland. The representative sequence of PolKop isolate was deposited in GenBank under accession No. MT241265. The similarity of nucleotide sequence of the 1 a helicase gene ranged from 98.5% (between MseWa and four other isolates) to 100% (between MPrOk1 and MPrOk2). The amino acids sequences of MPrOk1, MPrOk2 and MSeWa isolates were identical whereas they shared 99.5% similarity with CanKop and PolKop isolates. The nt and aa sequences within this region of all five isolates were in 98% homologous with the sequences of 'HCRL Glen Clova' strain. Nucleotide sequences of the 1 a helicase gene of the CanKop, PolKop, MseWa, MPrOk1, MPrOk2 isolates were deposited in GenBank (acc. Nos. MT847633-MT8347637). Considering the low incidence of RLMV (five out of 146 positively tested), it can be assumed that there is no emergency of the RLMV large-scale occurrence in Poland. However, as RLMV is transmitted by Amphorophora idaei aphids found in our country, infected plants near raspberry plantations may play an important role in virus spread. This is the first report of RLMV infecting red raspberry in Poland. Acknowledgments This work was performed in the frame of multiannual programme 2015-2020 "Actions to improve the competitiveness and innovation in the horticultural sector with regard to quality and food safety and environmental protection" (task 2.1), financed by the Polish Ministry of Agriculture and Rural Development. I would like to thank Mrs. Dorota Starzec for technical assistance. References Jones, A. T, and McGavin, W. J. 1998. Ann. Appl. Biol. 132:239. https://doi.org/10.1111/j.1744-7348.1998.tb05200.x. Martin, R. R. et al. 2013. Plant Dis. 98:176. http://dx.doi.org/10.1094/PDIS-04-12-0362-FE. McGavin, W. J. and MacFarlane, S. A. 2010. Ann. Appl. Biol. 156:439. doi:10.1111/j.1744-7348.2010.00401.x. Quito-Avila, D. F., et al. 2014. Plant Dis. 98:176. http://dx.doi.org/10.1094/PDIS-05-13-0562-RE. Thekke-Veetil, T., et al. 2016. Plant Dis. 101:265. https://doi.org/10.1094/PDIS-07-16-1014-PDN Tzanetakis, I. E., et al. 2007. Virus Res. 127:26. doi:10.1016/j.virusres.2007.03.010.

Development of a Full-Length Infectious cDNA Clone of the Grapevine Berry Inner Necrosis Virus

Grapevine berry inner necrosis virus (GINV) belongs to the genus Trichovirus in the family Betaflexiviridae. The GINV isolate LN_BETA_RS was obtained from a “Beta” grapevine (Vitis riparia × Vitis labrusca) exhibiting chlorotic mottling and ring spot in Xingcheng, Liaoning Province, China. To verify the correlation between GINV and grapevine chlorotic mottling and ring spot disease, we constructed an infectious cDNA clone of GINV isolate LN_BETA_RS using the seamless assembly approach. Applied treatments of agroinfiltration infectious cDNA confirmed systemic GINV infection of the Nicotiana occidentalis 37B by reverse transcription polymerase chain reaction (RT-PCR) and transmission electron microscopy, exhibiting chlorotic mottling symptoms on leaves. Infectious cDNA was also transmitted to new healthy N. occidentalis plants through rub-inoculation. Moreover, the cDNA clone was agroinfiltrated into “Beta” and “Thompson Seedless” grapevine plantlets, and the inoculated grapevines exhibited leaf chlorotic mottling and ringspot during the two years of observation. GINV-inoculated “Beta” grapevines had serious leaf chlorotic mottling and ringspot symptoms on the whole plant, while relatively few symptoms were observed on the leaves of agroinoculated “Thompson Seedless” grapevines in early spring and only weak ring spot gradually appeared later in the top young leaves. Our experiments fulfilled Koch’s postulates and revealed the causative role of GINV in grapevine chlorotic mottling and ring spot disease.

Mulberry (Morus alba) is a new natural host of Citrus leaf blotch virus in China.

Mulberries (Morus spp., family Moraceae) are economically important deciduous woody plants. Their leaves are food for silkworms, and both the fruits and leaves have nutritional and medicinal values (Qin et al. 2012). The plants are widely distributed globally and have been cultivated in China for more than 5,000 years (Xie et al. 2014). In April 2019, virus-like symptoms of chlorotic leaf spots and, occasionally witches' broom were observed in trees of white mulberry (M. alba) in Shapingba district of Chongqing province. To investigate if any potential viral agent is associated with the symptoms, total RNA was extracted from leaves of one symptomatic tree using an RNAprep Pure Plant Plus Kit (TianGen, China). Ribosomal RNAs were depleted using a TruSeq RNA Sample Prep Kit (Illumina, USA), and the depleted RNA was used for construction of a cDNA library for sequencing using an Illumina HiSeq X-ten platform with pair-ended reads length layout 150 bp. Adaptors, low-quality reads and mulberry genomes-derived reads (He et al. 2013) were removed from a total of 25,433,798 reads using the CLC Genomics Workbench 11 (Qiagen, USA) and the clean reads of 936,562 were subjected to de novo assembly that generated 4,278 contigs (200-3,862 bp). These sequences were annotated by Blastx searches to local Viruses_NR and viroid datasets downloaded from GenBank. Finally, except three contigs (3,862 nt, 1,950 nt, and 1,179 nt) with 81.4-90% nucleotide sequence identities to citrus leaf blotch virus (CLBV, genus Citrivirus, family Betaflexiviridae), no other contigs were identified as viral-related. Total clean reads of 113,185 were mapped to the viral contigs with average coverage depth of 1,915, suggesting the presence of CLBV in the symptomatic tree. To recover the complete genome of CLBV, overlapping fragments were amplified by RT-PCR using virus-specific primer pairs. The 5' and 3' termini were determined by rapid amplification of cDNA ends (RACE kit, Invitrogen, USA). Five clones per amplicon were sequenced in two directions (Cao et al. 2018). The complete genome of the mulberry strain of CLBV (CLBV-ML, GenBank accession no. MT767171) is 8,776 nucleotides (nt) in length, excluding the poly (A) tail. CLBV-ML is similar to extant CLBV isolates in genome structure. BLASTn analysis showed that CLBV-ML had highest nucleotide sequence identities of 79.65-81.56% with Actinidia isolates (Liu et al. 2019) of CLBV at the whole genome. Phylogenetic analysis also placed it with the Actinidia isolates, indicating they are closely related. Thus, CLBV-ML is a highly divergent strain of CLBV. To study the occurrence of CLBV-ML, a total of 62 mulberry samples (42 with similar symptoms and 20 without symptoms) were randomly collected from Shapingba and tested by conventional RT-PCR using an isolate-specific primer pair (CLBV-F7182: ACCAATGACAATGCCACA; CLBV-R7857: TTATGAAACTCTTCCCACTT) designed in the CP gene to amplify a 676 bp fragment. The virus was detected in 37 symptomatic trees (88%) and 2 (10%) asymptomatic trees, suggesting the association of CLBV-ML with the symptoms. To the best of our knowledge, this is the first report of CLBV infection in mulberry which expands the host range of CBLV.