Chloroplast 16S rRNA Research Articles

Closteriopsis acicularis (G. M. Smith) Belcher et Swale is a fusiform alga closely related to Chlorella kessleri Fott et Nováková(Chlorophyta, Trebouxiophyceae)

Complete nuclear 18S rRNA and chloroplast 16S rRNA coding sequences of the fusiform green alga Closteriopsis acicularis (G. M. Smith) Belcher et Swale (Chlorophyta) were used to determine its phylogenetic position within the Chlorophyta. Phylogenetic trees inferred from both genes show that C. acicularis is most closely related to Chlorella kessleri Fott et Nováková (Trebouxiophyceae) and does not belong to the family Selenastraceae (Chlorophyceae) as proposed previously. Despite its morphological distinctness, C. acicularis has to be placed close to the genus Chlorella Beijerinck, and especially to C. kessleri. The chloroplast 16S rRNAs of C. acicularis and C. kessleri possess a unique insertion resulting in an additional AT-rich helix in a length-conserved region of the gene. A close relationship to the genus Chlorella is further confirmed by the pyrenoid ultrastructure. The 16S rRNA gene of C. acicularis contains a group I subgroup IA3 intron which is most similar to the first intron in the corresponding gene of Chlamydomonas pallidostigmatica King (Chlorophyta). In helix P6, the intron carries an additional extension related to intron-encoded endonucleases of the LAGLIDADG family. It is the first group I intron reported in chloroplast 16S rDNA of a species other than Chlamydomonas.

Closteriopsis acicularis (G. M. Smith) Belcher et Swale is a fusiform alga closely related to Chlorella kessleri Fott et Nováková(Chlorophyta, Trebouxiophyceae)

Complete nuclear 18S rRNA and chloroplast 16S rRNA coding sequences of the fusiform green alga Closteriopsis acicularis (G. M. Smith) Belcher et Swale (Chlorophyta) were used to determine its phylogenetic position within the Chlorophyta. Phylogenetic trees inferred from both genes show that C. acicularis is most closely related to Chlorella kessleri Fott et Novakova (Trebouxiophyceae) and does not belong to the family Selenastraceae (Chlorophyceae) as proposed previously. Despite its morphological distinctness, C. acicularis has to be placed close to the genus Chlorella Beijerinck, and especially to C. kessleri. The chloroplast 16S rRNAs of C. acicularis and C. kessleri possess a unique insertion resulting in an additional AT-rich helix in a length-conserved region of the gene. A close relationship to the genus Chlorella is further confirmed by the pyrenoid ultrastructure. The 16S rRNA gene of C. acicularis contains a group I subgroup IA3 intron which is most similar to the first intron in the correspondi...

Structural basis for selectivity and toxicity of ribosomal antibiotics.

Ribosomal antibiotics must discriminate between bacterial and eukaryotic ribosomes to various extents. Despite major differences in bacterial and eukaryotic ribosome structure, a single nucleotide or amino acid determines the selectivity of drugs affecting protein synthesis. Analysis of resistance mutations in bacteria allows the prediction of whether cytoplasmic or mitochondrial ribosomes in eukaryotic cells will be sensitive to the drug. This has important implications for drug specificity and toxicity. Together with recent data on the structure of ribosomal subunits these data provide the basis for development of new ribosomal antibiotics by rationale drug design.

Identification of Differentially Expressed Genes in Susceptible and Resistant Responses of Chinese Cabbage to Plasmodiophora brassicae

Differential gene expression in susceptible and resistant responses of Chinese cabbage to Plasmodiophora brassicae was examined by differential screening of randomly amplified cDNAs. Three cDNA fragments (H6–2, H8, and Y4) hybridizing to differentially expressed mRNAs in RNA gel blot analysis were sequenced and subjected to database homology searches. H6–2 cDNA, detecting inhibited expression of the corresponding gene in the susceptible response, revealed significant homology to the chloroplast 16S rRNA gene. H8 cDNA, hybridizing to an extra mRNA band in the susceptible response along with a band observed in common among susceptible, resistant and control responses had significant homology with an Arabidopsis homeobox gene Athb‐8. Southern blot analysis showed that sequences hybridizing to H8 cDNA were contained in the genomic DNA of both Chinese cabbage and P. brassicae. Y4 cDNA, detecting enhanced expression of the corresponding gene in the resistant response, shared homology with an A. thaliana transcribed sequence with an unknown function.

Phylogeny of ultra-rapidly evolving dinoflagellate chloroplast genes: a possible common origin for sporozoan and dinoflagellate plastids.

Complete chloroplast 23S rRNA and psbA genes from five peridinin-containing dinoflagellates (Heterocapsa pygmaea, Heterocapsa niei, Heterocapsa rotun-data, Amphidinium carterae, and Protoceratium reticulatum) were amplified by PCR and sequenced; partial sequences were obtained from Thoracosphaera heimii and Scrippsiella trochoidea. Comparison with chloroplast 23S rRNA and psbA genes of other organisms shows that dinoflagellate chloroplast genes are the most divergent and rapidly evolving of all. Quartet puzzling, maximum likelihood, maximum parsimony, neighbor joining, and LogDet trees were constructed. Intersite rate variation and invariant sites were allowed for with quartet puzzling and neighbor joining. All psbA and 23S rRNA trees showed peridinin-containing dinoflagellate chloroplasts as monophyletic. In psbA trees they are related to those of chromists and red algae. In 23S rRNA trees, dinoflagellates are always the sisters of Sporozoa (apicomplexans); maximum likelihood analysis of Heterocapsa triquetra 16S rRNA also groups the dinoflagellate and sporozoan sequences, but the other methods were inconsistent. Thus, dinoflagellate chloroplasts may actually be related to sporozoan plastids, but the possibility of reproducible long-branch artifacts cannot be strongly ruled out. The results for all three genes fit the idea that dinoflagellate chloroplasts originated from red algae by a secondary endosymbiosis, possibly the same one as for chromists and Sporozoa. The marked disagreement between 16S rRNA trees using different phylogenetic algorithms indicates that this is a rather poor molecule for elucidating overall chloroplast phylogeny. We discuss possible reasons why both plastid and mitochondrial genomes of alveolates (Dinozoa, Sporozoa and Ciliophora) have ultra-rapid substitution rates and a proneness to unique genomic rearrangements.

Crystallization and preliminary X-ray studies of I-CreI: a group I intron-encoded endonuclease from C. reinhardtii.

Group I intron endonuclease I-CreI is encoded by an open reading frame contained within a self-splicing intron in the Chlamydomonas reinhardtii chloroplast 23S rRNA gene. I-CreI initiates the lateral transfer or homing of this intron by specifically recognizing and cleaving a pseudopalindromic 19-24 bp homing site in chloroplast 23S rRNA genes that lack the intron. The gene encoding this enzyme has been subcloned, and the protein product has been purified and crystallized. The crystals belong to space group P321, with unit cell dimensions a = b = 78.2 A, c = 67.4 A. The crystal unit cell is consistent with an asymmetric unit consisting of the enzyme monomer. The specific volume of this unit cell is 3.3 A3/Da. The crystals diffract to at least 3.0 A resolution after flash-cooling, when using a rotating anode x-ray source and an RAXIS image plate detector.

Cis-acting elements and trans-acting factors for accurate translation of chloroplast psbA mRNAs: development of an in vitro translation system from tobacco chloroplasts.

Translational regulation is an important step of gene expression in chloroplasts. To analyze biochemical mechanisms of translational regulation unique to higher plant chloroplasts, an in vitro translation system has been developed from tobacco chloroplasts. Conditions for chloroplast extraction and the in vitro translation reaction have been optimized with a tobacco psbA-lacZ fusion mRNA. The in vitro system supports accurate translation of a variety of chloroplasts mRNAs. Using a series of mutant psbA mRNAs, we showed that three elements within the 5'-untranslated region of the mRNA are required for translation. Two of them are complementary to the 3'-terminus of chloroplast 16S rRNA (termed RBS1 and RBS2) and the other is an AU-rich sequence (UAAAUAAA) located between RBS1 and RBS2 and is termed the AU box. mRNA competition experiments using the in vitro translation reaction and gel mobility shift assays revealed the existence of a trans-acting factor(s) for translation and its possible interaction with the AU box. We propose a model for the initiation of psbA translation whereby RBS1 and RBS2 bind cooperatively to the 3'-end of 16S rRNA resulting in looping out of the AU box, which facilitates the interaction of a trans-acting factor(s).

Some relationships between the gas exchange, biochemistry and molecular biology of photosynthesis during leaf development of tomato plants after transfer to different carbon dioxide concentrations

ABSTRACTTomato plants were exposed to four concentrations of CO2 (350, 700, 1050 or 1400 μmol CO2 mol−1) for 31 d. The light‐saturated rate of photosynthesis (A) of the unshaded fifth leaf was measured at either an ambient CO2 concentration of 350 μmol CO2 mol−1 [A (350)] or at the level of CO2 at which the plants were grown. The chloroplast protein composition and the level of transcripts of nuclear or plastid photosynthesis‐associated genes (PAGs), as well as the main carbohydrate content of the fifth leaf maintained horizontal and unshaded, were also measured during leaf development. At 60 and 95% leaf expansion, the A of high‐CO2‐grown plants measured at growth CO2 was higher than the A (350) of the plants grown at ambient CO2. However, in the fully mature leaves, A (growth CO2) declined linearly as growth CO2 concentration increased. The A (350) of plants exposed to elevated CO2 up to 60% leaf expanion had not acclimated to high CO2. At 95% leaf expansion, A (350) was lower in plants grown at high CO2. A versus CO2 (Ci) for mature leaves showed that A of the plants grown at high CO2 was lower over the entire range than that for plants grown at present ambient CO2 concentration. Lines fitted to the linear part of the A/Ci curves were concurrent at a Ci of 49μmol CO2 mol−1 and A=−1.21μmol CO2 m−2s−1. This Ct value is close to Λ* (46 μmol CO2 mol−1), the compensation point at 27°C calculated from the equation described in Brooks & Farquhar (1985, Planta 165, 397–406). This A is an estimate of respiration in the light (R1) and was not affected by acclimation to elevated CO2. Thylakoid proteins (photo‐system I core protein, D1 and D2 of the photosystem II core complex, cytochrome f) were all reduced by elevated CO2 only in the fully mature leaves (31d exposure), whereas the large and small subunits of Rubisco and Rubisco activase proteins had already declined after 22 d exposure. Transcript levels of the plastid‐encoded PAG (rbcL, psbA, psaA‐B) were reduced in the mature leaves by elevated CO2 when expressed on a total RNA basis, but they were not sensitive to elevated CO2 when expressed on a chloroplast 16S rRNA basis. However, rbcS, rca and cab mRNA transcripts were lower in the plants grown at high CO2 than in control plants after 22 d exposure when expressed on a nuclear rRNA basis. The loss of these nuclear PAGs was correlated with an accumulation of soluble sugars and starch.

Analyses of the Extent of Immunological Relatedness between a Highly Purified Pea Chloroplast Functional RNA Polymerase and Escherichia coli RNA Polymerase

Summary The reported nucleotide sequence homology between the RNA polymerase (EC 2.7.7.6) coding (rpo) genes in Escherichia coli and their putative homologues in chloroplast DNA is not only limited to about 26-50 %, but also scattered. Utilising the homologous in vitro transcription system and immunological approach, we address as to which extent the chloroplast functional RNA polymerase and E. coli RNA polymerase are related. Highly purified RNA polymerase from pea chloroplasts has been demonstrated to transcribe both ribosomal and messenger RNA genes and the purified homologous antibodies inhibit the chloroplast gene promoter recognizing ability as well as in vitro transcriptional activity of the enzyme [Rajasekhar et al., 1991]. While recognizing all of the polypeptides of the chloroplast enzyme on Western blots, the chloroplast RNA polymerase antibodies did not cross-react with the sub-units of E. coli RNA polymerase or wheat germ RNA polymerase and vice versa. Antibodies against the 130 kDa,110 kDa, 75-95 kDa and 48 kDa polypeptides of the purified chloroplast RNA polymerase immobilized only homologous RNA polymerase on the affinity columns. The active enzyme eluted from the immunoaffinity columns showed sub-unit patterns similar to that of purified RNA polymerase. The specificity of these antibodies was confirmed with the lack of immobilization of E. coli RNA polymerase and vice versa with the E. coli RNA polymerase antibodies. The E. coli RNA polymerase also manifested transcription in vitro utilising the supercoiled 7A/30T recombinant containing the chloroplast 16S rRNA minigene as well as the supercoiled pCB 1-3 recombinant containing the upstream sequences of ribulose-1,5-bisphosphate carboxylase large sub-unit (rbc-L) gene. The transcriptional activities, however, were specifically affected only by homologous RNA polymerase antibodies, but not by heterologous RNA polymerase antibodies. While both the chloroplast and the E. coli RNA polymerases caused mobility shifts of the chloroplast 16S rRNA gene and rbc-L gene promoter fragments, only the homologous antibodies were effective in abolishing this response. The data obtained form the first functional evidence that the highly purified pea chloroplast RNA polymerase and the E. coli RNA polymerase are immunologically only distantly related.

Point mutations in the chloroplast 16s rRNA gene confer streptomycin resistance in Nicotiana plumbaginifolia

In a previous paper we reported the isolation of streptomycin-resistant mutants from Nicotiana plumbaginifolia and presented evidence for chloroplast control of the resistance trait. To understand the molecular basis of the resistance in these mutants, we sequenced three regions in the chloroplast 16s rRNA gene, which correspond to the 5' terminus, the 530 loop, and the 900 stem/loop of Escherichia coli 16s rRNA, and compared them with the sequences of the wild-type. Our results show that: (1) nine mutants have a C to T change at position 912, (2) one mutant (SR1021) has a G to A change at position 885, (3) one mutant has a C to T change at position 526, based on E. coli numbering; and (4) three mutants do not have any change in the regions analyzed. The point mutation detected in SR1021 has not been reported previously. In E. coli 16s rRNA, position 885 is protected from chemical probing by ribosomal protein S12 and is closely juxtaposed with the streptomycin-binding region (positions 912-915) in the predicted secondary structure. It is likely that the G to A transition at this position is a novel mutation for streptomycin resistance.

16S Ribosomal RNA Gene Sequence and Phylogeny of ToxicMicrocystissp. (Cyanobacteria)

The toxigenic and bloom-forming cyanobacterial genus Microcystis contains several ill-defined species. The 16S rDNA for two strains of toxic M. aeruginosa were sequenced and compared to available cyanobacterial, bacterial, and chloroplast 16S rRNA gene information. Phylogeny and the validity of a molecular taxonomy for the genus Microcystis is presented.

Erythromycin and 5S rRNA binding properties of the spinach chloroplast ribosomal protein CL22.

The spinach chloroplast ribosomal protein (r-protein) CL22 contains a central region homologous to the Escherichia coli r-protein L22 plus long N- and C-terminal extensions. We show in this study that the CL22 combines two properties which in E. coli ribosome are split between two separate proteins. The CL22 which binds to the 5S rRNA can also be linked to an erythromycin derivative added to the 50S ribosomal subunit. This latter property is similar to that of the E. coli L22 and suggests a similar localization in the 50S subunit. We have overproduced the r-protein CL22 and deleted forms of this protein in E. coli. We show that the overproduced CL22 binds to the chloroplast 5S rRNA and that the deleted protein containing the N- and C-terminal extensions only has lost the 5S rRNA binding property. We suggest that the central homologous regions of the CL22 contains the RNA binding domain.

Detection of point mutations in the chloroplast genome by single-stranded conformation polymorphism analysis.

Single-stranded conformation polymorphism (SSCP) analysis was used to examine the mutations of the chloroplast 16S rRNA locus of streptomycin-resistant mutants in Nicotiana plumbaginifolia. DNA fragments of 121, 517, 968 and 1578 bp, each possessing a known point mutation, were generated by polymerase chain reaction (PCR). The resulting fragments were denatured and separated by nondenaturing polyacrylamide gel electrophoresis. Compared to the patterns of the wild-type DNA fragments, the bands of the single-stranded DNA fragments of 121 and 517 bp with base changes were shifted. However, no pattern variations were detected from the DNA fragments of 968 and 1578 bp generated from both wild-type and mutants.

Cleavage and recognition pattern of a double-strand-specific endonuclease ( I-CreI) encoded by the chloroplast 23S rRNA intron of Chlamydomonas reinhardtii

Several group-I introns have been shown to specifically invade intron-minus alleles of the genes that contain them. This type of intron mobility is referred to as ‘intron homing’, and depends on restriction endonucleases (ENases) encoded by the mobile introns. The ENase cleaves the intron-minus allele near the site of intron insertion, thereby initiating gene conversion. The 23S (LSU) rRNA-encoding gene ( LSU) of the chloroplast genome of Chlamydomonas reinhardtii contains a self-splicing group-I intron (CrLSU) that has a free-standing open reading frame (ORF) of 163 codons. Translation of CrLSU intron RNA in cell-free systems produces a polypeptide of approx. 18 kDa, the size expected for correct translation of the ORF. The in vitro-synthesized 18-kDa protein cleaves plasmid DNA that contains a portion of LSU where the intron normally resides, but lacking the intron itself. Cleavage by the intron-encoded enzyme (I- CreI) occurs 5 bp and 1 bp 3' to the intron insertion site (in the 3'-exon) in the top (/) and bottom (,) strands, respectively, resulting in 4-nt single-stranded overhangs with 3'-OH termini. We also show that the recognition sequence of I- CreI spans the cleavage site and is 24 bp in length (5'-CAAAACGTC,GTGA/GACAGTTTGGT).

Direct sequencing of tobacco chloroplast genome by the polymerase chain reaction.

We have developed a polymerase chain reaction (PCR) method for sequencing of tobacco chloroplast genome. In a mixture containing chloroplast DNA, 5'-end-labeled oligonucleotide primer, Taq DNA polymerase and reaction buffer, we were able to sequence a segment of chloroplast 16S rRNA gene. The results showed that the 750 bp of DNA sequenced were identical to the sequence reported, indicating that direct sequencing method that we have developed is useful for the sequencing of chloroplast genome. To analyze the chloroplast genome more rapidly in those in vitro grown plantlets, we also developed a simple method which is applicable for the amplifications and sequencing of chloroplast 16S rRNA fragment from either 0.15 g of tobacco leaf or stem tissue. The readable sequences obtained from the presented methods were consistent with the published sequence.

Sequence, proposed secondary structure, and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm.

The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3' end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTTGGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.

Nucleotide sequence of the chloroplast 16S rRNA gene from pea (Pisum sativum L.)

Nucleotide sequence of the chloroplast 16S rRNA gene from pea (Pisum sativum L.)

Analysis of streptomycin-resistance of Escherichia coli mutants

We previously reported about Escherichia coli transformation experiments yielding streptomycin-resistant cells carrying a C912 to T transition in a plasmid-born 16S rRNA gene. These experiments were based on results obtained with streptomycin-resistant Euglena chloroplasts bearing an equivalent mutation in the single chloroplast 16S rRNA gene. We extended this study and transformed E. coli with plasmid constructs having a mutated 16S rRNA gene at position 914 (A to C) or a double mutation at positions 912 and 888 (C to T:G to A) or a mutation in the S12 gene (Lys-42 to Thr). We tested the transformed cells before and after a screening procedure in the presence of streptomycin. We find that the plasmid-born mutations protect colonies against a short streptomycin exposure, but ribosomes carrying mutated 16S rRNA do not significantly reduce codon misreading in vitro. However, ribosomes isolated from transformed cells after the screening procedure resist misreading. These ribosomes have acquired a second mutation in the S12 protein as shown in one case by sequencing and by transformation experiments. Furthermore, we show that the A914 to C mutation prevents (strongly reduces) base methylation in the central domain of 16S rRNA.

Sequence and secondary structure of chloroplast 16S rRNA from the chromophyte algaOlisthodiscus luteus, as inferred from the gene sequence

Sequence and secondary structure of chloroplast 16S rRNA from the chromophyte alga<i>Olisthodiscus luteus</i>, as inferred from the gene sequence

Highly purified pea chloroplast RNA polymerase transcribes both rRNA and mRNA genes

Pea chloroplast RNA polymerase has been obtained with about 2000-fold purification using DEAE-cellulose and phosphocellulose chromatography. The purified enzyme contained ten prominent polypeptides of 150, 130, 115, 110, 95, 85, 75, 48, 44 and 39 kDa and four other minor polypeptides of 90, 34, 32 and 27 kDa. Purification of this enzyme using chloroplast 16S rDNA promoter affinity column chromatography also yielded an enzyme with similar polypeptides. Purified polyclonal antibodies against the purified chloroplast RNA polymerase were found to recognize most of the polypeptides of the enzyme in Western blot experiments. Primary mobility shift of the 16S rRNA gene and ribulose-1,5-bisphosphate carboxylase large subunit (rbc-L) gene promoters observed with the chloroplast RNA polymerase was abolished by these antibodies. The specific in vitro transcription of these rRNA and mRNA genes was also inhibited by these antibodies. The transcription of the rRNA and mRNA genes was also abolished by tagetitoxin, a specific inhibitor of chloroplast RNA polymerase. The chloroplast RNA polymerase was found to bind specifically to the chloroplast 16S rRNA gene promoter region as visualized in electron microscopy. The presence of the polypeptides of 130, 110, 75-95 and 48 kDa in the DNA-enzyme complex was confirmed by a novel approach using immunogold labeling with the respective antibodies. The polypeptides of this purified RNA polymerase were found to be localized in chloroplasts by an indirect immunofluorescence.