Chinese People's Liberation Army Research Articles

Patients with advanced non-small cell lung cancer with EGFR mutations in addition to complex mutations treated with osimertinib have a poor clinical outcome: A real-world data analysis.

The present study aimed to investigate the clinical characteristics and outcomes of patients with advanced non-small cell lung cancer (NSCLC) treated with osimertinib, and focused on the resistance mechanism to osimertinib in a real-world setting. Data from 128 patients with advanced NSCLC who were treated with osimertinib between March 2015 and November 2018 at the Chinese People's Liberation Army General Hospital (Beijing, China) were retrospectively collected, and the associations between mutation types and survival were analysed. In patients treated with osimertinib, the objective response rate reached 60.9% (78/128) and the disease control rate reached 81.3% (104/128), with a median progression-free survival (PFS) time of 12.2 months. A number of complex mutations were identified in the re-analysis after the development of osimertinib resistance, including TP53, KRAS and PIK3CA mutations, epidermal growth factor receptor (EGFR) and MYC amplifications, and mutations associated with SCLC transformation, demonstrating that these mutations may account for osimertinib resistance. The median PFS time for patients with the EGFR T790M mutation (n=41) was significantly longer than that for patients with the T790M mutation and the aforementioned complex mutations (n=13) (16.7 vs. 10.8 months; P=0.001). Patients with a single EGFR mutation (n=87) had a longer median PFS time than those with an EGFR mutation and complex mutations (n=24) (14.63 vs. 6.63 months; P<0.0001). In conclusion, the present study analysed the effects of osimertinib in patients with advanced NSCLC with EGFR mutations, particularly T790M mutations. The results indicated that the efficacy of osimertinib was weakened when patients had complex mutations, suggesting that complex mutations may be responsible for resistance to osimertinib.

Pretreatment Neutrophil-to-Lymphocyte Ratio (NLR) May Predict the Outcomes of Advanced Non-small-cell Lung Cancer (NSCLC) Patients Treated With Immune Checkpoint Inhibitors (ICIs).

Background: Recent studies have demonstrated the predictive value of pretreatment neutrophil-to-lymphocyte ratio (NLR) in advanced cancers; however, the role of NLR in patients with advanced non-small-cell lung cancer (NSCLC) treated with immune checkpoint inhibitors (ICIs) remained to be explored. Thus, we aimed to investigate whether pretreatment NLR was associated with the outcomes of advanced NSCLC patients treated with ICIs.Methods: A comprehensive literature research was first conducted in PubMed, the Cochrane Central Library, and Embase for studies that evaluated the association between pretreatment NLR and survival of advanced NSCLC patients with ICIs treatment. We then conducted a retrospective study in Chinese People's Liberation Army (PLA) General Hospital (Beijing, China) to validate these findings.Results: A total of 17 eligible studies with 2,106 patients were included in our meta-analysis, of which, 12 studies reported progression-free survival (PFS), and 13 studies reported overall survival (OS). The pooled results showed that high pretreatment NLR was significantly associated with poorer PFS (HR = 1.44, 95% CI 1.26–1.65; P < 0.001) and OS (HR = 2.86, 95% CI 2.11–3.87; P < 0.001) compared with those with low pretreatment NLR. Subgroup analysis demonstrated that the association between baseline NLR and PFS remained significant except that the cut-off value of NLR was 3 (HR = 1.48, 95% CI 0.93–2.37; P = 0.098) and region of Asia (HR = 1.55, 95% CI 1.00–2.39; P = 0.051). These results were further validated in our retrospective study that patients with pretreatment NLR ≥ 6.0 had shorter PFS (median: 5.0 vs. 9.1 months, HR = 1.39; 95% CI 1.01–1.91; P = 0.02) and OS (median: 10.0 vs. 17.3 months, HR = 1.71; 95% CI 1.18–2.46; P < 0.001) compared with those with NLR < 6.0. The associations between NLR and survival were consistent in subgroup analysis stratified by age, gender, ECOG PS, histology, stage, smoking history, treatment, and prior lines of therapy. Dynamics of NLR (dNLR) that increased ≥3.0 from baseline was also significantly associated with worse PFS (median: 3.1 vs. 9.1 months; P = 0.01) and OS (median: 6.8 vs. 17.0 months; P < 0.0001).Conclusions: Our study demonstrates that pretreatment NLR and dNLR from baseline are associated with the outcomes of advanced NSCLC patients treated with ICIs; however, it warrants further prospective studies.

Response plan in the neonatal intensive care unit during epidemic of SARS-CoV-2 infection (2nd Edition)

Since December 2019, an outbreak of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection has spread from China to other countries. In order to effectively respond to possible neonatal SARS-CoV-2 infection, neonatologists from the Medical Association of Chinese People's Liberation Army and the Editorial Committee of Chinese Journal of Contemporary Pediatrics proposed the response plan in the neonatal intensive care unit during epidemic of SARS-CoV-2 infection (1st edition) at the end of January of 2020. Based on the further knowledge and experience on SARS-CoV-2 infection, the neonatologists updated the plan according to the current evidence, so as to provide a better guide for clinical medical staff to deal with the SARS-CoV-2 infection in the NICU.

Real-world treatment efficacy of anti-programmed death-1 combined with anti-angiogenesis therapy in non-small cell lung cancer patients.

Anti-programmed death-1 (PD-1) therapy has been extensively used to treat cancer. Recently, the combination of immunotherapy and anti-angiogenic therapy has emerged as a novel treatment approach. Therefore, we designed a study to evaluate the real-world benefit of the combination of anti-PD-1 and anti-angiogenesis therapy in patients with non-small cell lung cancer (NSCLC).We obtained the medical records of patients at the Chinese People's Liberation Army General Hospital who received either nivolumab or pembrolizumab combined with anti-angiogenesis therapy from January 2015 to December 2018. The overall response rate (ORR), progression-free survival (PFS), and overall survival (OS) were evaluated for all patients.Sixty-nine patients with NSCLC were included in our study. The ORR was 31.9% (95% CI: 20.6–43.2%) and the median PFS was 8.37 months (95% CI: 6.5–10.0 months). The subgroup analysis statistically revealed a significant difference in ORR for patients receiving first-line treatment vs other lines, and the values were 58.8% (95% CI: 32.7–84.9%) compared with 23.1% (95% CI: 11.2–34.9%). We also observed a significant improvement in PFS, with a median value of 10.5 months (95% CI: 7.4–13.1 months) for patients without EGFR mutations and 5.4 months (95% CI: 4.0–6.3 months) for patients with EGFR mutations.The real-world ORR, PFS, and OS were comparable to previous clinical trials, despite the patients’ different baseline characteristics. Importantly, compared with patients having identified EGFR mutations, patients without EGFR mutations had a better PFS. Furthermore, these data support the use of anti-PD-1 combined with anti-angiogenesis therapy as a novel treatment approach for patients with NSCLC.

Clinical and Radiological Features of Patients With Pulmonary Cryptococcosis in a Hospital of North China.

Objective: The increasing incidence has led to more focus on pulmonary cryptococcosis in HIV-negative patients. We conducted a retrospective analysis of pulmonary cryptococcosis to understand the clinical characteristics, imaging features, diagnosis, treatment and prognosis of this disease in HIV-negative patients in respiratory department of a tertiary hospital in north China.Method: We identified retrospectively those diagnosed with pulmonary cryptococcosis in the first medical center of Chinese People’s Liberation Army General Hospital since 2009 to 2019. The clinical and image data were collected and analyzed.Results: The study involved 34 patients with pulmonary cryptococcosis. All patients were diagnosed by histopathology. It accounted for 0.93‰ of the total number of patients admitted to respiratory department in the same period. The mean age was 49 years; 26 patients (76.5%) were male. Patients were predominantly immunocompetent (30, 88.2%), and there was no underlying disease for most patients (26, 76.5%). The most frequent symptoms were cough and expectoration. Fourteen (41.2%) patients showed no symptom or sign. Multiple lesions (21, 61.8%) and subpleural lesions (23, 67.6%) were the most common. Nodule was the most common abnormality on chest computed tomography image. Eight (23.5%) patients received serum Cryptococcus capsular polysaccharide antigen test, and seven patients showed positive result. All patients recovered after antifungal treatment.Conclusions: Most patients of HIV-negative pulmonary cryptococcosis were mainly immunocompetent patients younger than 60 years without underlying diseases. There was lack of specificity in clinical manifestations and imaging findings. The prognosis of pulmonary cryptococcosis in HIV-negative patients was good.

Characteristics of 64 Children with Coronavirus Disease 2019: A Multicenter Retrospective Cohort Study Inside and Outside Wuhan China

Background: Although coronavirus disease 2019 (COVID-19) has been a disaster for the whole world now, features of children with COVID-19 are out of reach. We aim to explore the characteristics of children COVID-19 and try to shed light on the diagnosis and treatment of the disease. Methods: 64 children (aged 0-18 years) COVID-19 from six hospitals in China during the early outbreak stage were included in this study. We retrospectively grouped according to the severity of the disease, obtained information from electronic medical records, and compared the epidemiology, clinical symptoms, imaging, laboratory examination and treatment. Meanwhile, we made a comparison between different age groups, as well as between adults and children. Results: All enrolled confirmed children (mean age 7.16 [SD 5.27] years) COVID-19 presented date from Jan 15 to Feb 29, 2020. Of all 64 patients, 33 (51.6%) were female. All children were divided into asymptomatic (12), mild (12), moderate (39) and severe (1) groups. Fever (31[48.4%]) and dry cough (10[15.6%]) were the most common symptoms and the gastrointestinal symptoms were rare (four [6.3%]). Patients under 5 years old (3/26 [11.5%]) may have nasal obstruction. White blood cells (WBC) could be normal (34[53.1%]) or decreased in children with COVID-19. (17/40[42.4%]) cases’ Interleukin 6 (IL-6) were raised up especially in the moderate and severe groups. Possible indicators that could be used to evaluate the severity of the disease are lactate dehydrogenase (LDH) (19/40[47.5%]) and D-dimer (11/40[27.5%]) including IL-6. Ground glass opacity (18/40[40%]) was a characteristic change of COVID-19 imaging in the moderate and severe groups. Creatine kinases MB (CK-MB) (10/23 [43.4%]) and aspartate amino transferase (AST) (6/25 [24%]) may be biomarks for early hints with cardiac complications in patients aged 0-5 years. Furthermore, (11/64[17.2%]) cases were co-infected or pre-infected with other respiratory pathogens. Conclusions: The symptoms and computed tomography (CT) of children COVID-19 are not so typical as adults. Mostly of our cohort cases were moderate type and one child was severe type. Constitutional and respiratory symptoms are the mostly clinical features of children COVID-19. So, if the severe cases of children raised or other system symptoms dominantly occurred, other pathogens should be considered. Moreover IL-6 would be an indicator for the development to severe cases as well as D-dimer and LDH. AST and CK-MB will promise the severe inclining complicating heart disease. Funding Statement: This study was supported by Technology Project of Guangzhou City, Grant Award Number: 201607010123. Declaration of Interests: The authors have no conflicts of interest to disclose. Ethics Approval Statement: This study was reviewed and approved by the Medical Ethical Committee of General Hospital of Southern Theater Command of Chinese People's Liberation Army (approval number 2020-04). The written informed consent was waived.

Association between dietary sodium intake and blood pressure variability in Chinese patients with hypertension.

BackgroundThe association between dietary sodium intake and blood pressure variability (BPV) in hypertensive patients remains unclear. The objective of this study was to demonstrate whether dietary sodium intake is a predictor of elevated BPV in Chinese patients with hypertension.MethodsA total of 235 patients with essential hypertension were enrolled in the Department of Cardiology, Chinese People's Liberation Army (PLA) General Hospital in 2018 to 2019, all of whom underwent 24-h ambulatory blood pressure monitoring. BPV was calculated as the standard deviation (SD), coefficient of variation (CV), variation independent of mean (VIM) of blood pressure measurements, respectively, and divided into diurnal systolic BPV (SBPV), diurnal diastolic BPV (DBPV), nocturnal SBPV, and nocturnal DBPV. 24-h urine samples were collected to measure 24-h urine sodium excretion, which represents dietary sodium intake. The relationship between dietary sodium intake and BPV was analyzed by using Spearman correlations and multiple linear regression analysis.ResultsNocturnal SBPV-SD, CV, VIM, and nocturnal DBPV-SD in the high urine sodium excretion group were significantly higher than those in the medium and low urine sodium excretion groups, whereas diurnal SBPV-SD, CV, VIM, diurnal DBPV-SD, CV, VIM, and nocturnal DBPV-CV, VIM were not. Using the Spearman correlation analysis, we found a linear correlation between 24-h urine sodium excretion and nocturnal SBPV-SD, CV, VIM (SD, r = 0.22, P = 0.001; CV, r = 0.17, P = 0.009; VIM, r = 0.16, P = 0.020), nocturnal DBPV-SD (r = 0.21, P = 0.001), respectively. After further adjusting for confounding factors by multiple linear regression, the positive correlations remained between 24-h urine sodium excretion and nocturnal SBPV-SD, CV, VIM (SD, β = 0.224, P < 0.001; CV, β = 0.211, P = 0.001; VIM, β = 0.213, P = 0.001), nocturnal DBPV (SD, β = 0.215, P = 0.001), respectively.ConclusionsDietary sodium intake is associated with nocturnal SBPV in Chinese patients with hypertension.

Single-cell RNA sequencing data suggest a role for angiotensin-converting enzyme 2 in kidney impairment in patients infected with 2019-novel coronavirus.

Single-cell RNA sequencing data suggest a role for angiotensin-converting enzyme 2 in kidney impairment in patients infected with 2019-novel coronavirus.

Red Blood Cell Distribution Width Predicts Postoperative Death of Infective Endocarditis

Infectious endocarditis (IE) is a rare disease with high mortality rate. Recently, red cell distribution width (RDW) has drawn special attention for predicting cardiovascular disease. This study aims to explore the relationship between RDW value and postoperative death of IE patients.Clinical records of patients with definite IE from Chinese People's Liberation Army General Hospital department of cardiovascular surgery were collected and analyzed. Clinical, echocardiographic, and biochemical variables were evaluated along with RDW.Results: A total of 158 consecutive IE patients (mean age 47.0 ± 16.3 years, male 61.4%) were enrolled in this study. According to receiver operating characteristic (ROC) curve analysis, the optimal RDW cutoff value for predicting mortality was 15.45% (area under the curve 0.913, P < 0.001). A total of 28 patients (17.8%) died postoperatively; of these, 89.3% had RDW value >15.45%. Binary regression analysis showed that aging, multiple valvular involved, valvular vegetation formation, pulmonary hypertension, and high RDW are strong predictors of postoperative death. Multiple regression analysis revealed that high RDW value was independent predictors of postoperative mortality in patients with IE (β: 3.704, 95% confidence interval (95%CI): 2.729-604.692, P < 0.05).IE has a high inhospital mortality rate, and increased RDW is an independent predictor of postoperative death in these patients.

Changes of foveal avascular zone size and correlation between foveal avascular zone size and metamorphopsia before and after idiopathic macular epiretinal membrane surgery

Objective To observe the changes of foveal avascular zone (FAZ) size before and after surgery in idiopathic macular epiretinal membrane (IMEM) eyes and analyze the correlation of FAZ with metamorphopsia. Methods A retrospective case series study. From August 2016 to October 2017, 42 eyes of 38 patients affected with IMEM diagnosed in Central Theater Command General Hospital of Chinese People's Liberation Army were enrolled in this study. All the patients underwent a 25G pars plana vitrectomy (PPV) with IMEM removal and ininternal limiting membrane (ILM) peeling. The BCVA was measured using the international standard visual acuity chart, and the results were converted to the logMAR visual acuity. The severity of metamorphopsia was measured using M-charts. The FAZ areas were evaluated with OCT angiography in both the superficial and deep capillary plexus layers. The central macular thickness (CMT) were assessed with spectral-domain OCT before and after surgery. The logMAR BCVA was 0.61±0.21. The M-score was 0.66±0.38. The CMT of fovea was 337.71±57.63 μm. The FAZ areas in superficial and deep capillary plexus were 0.113±0.037 mm2 and 0.202±0.03 mm2, respectively. The differences in BCVA, M-score and FAZ area before and 1, 3, 6, 12 months after surgery were analyzed by ANOVA. The Spearman rank correlation analysis was performed to investigate the relationship between FAZ areas, visual acuity and metamorphopsia. Results At 12 month after surgery, the FAZ areas in superficial and deep capillary plexus were 0.146±0.021 mm2 and 0.240±0.019 mm2, respectively. Compared with baseline, the the FAZ areas in superficial and deep capillary plexus after surgery significantly increased (F=8.484, 14.346; P<0.001,<0.001). The postoperative logMAR BCVA 0.47±0.19, M-score 0.12±0.22 and CMT 270.60±33.27 μm were significantly improved compared with baseline (F=5.044, 17.763, 13.545; P=0.001, <0.001, <0.001). The preoperative FAZ area in superficial capillary plexus correlated negatively with preoperative M-score (r=-0.816, P<0.001); the preoperative FAZ area in deep capillary plexus correlated negatively with preoperative BCVA and M-score (r=-0.422, -0.882; P=0.005,<0.001). The postoperative FAZ area in superficial capillary plexus correlated negatively with preoperative and postoperative M-score (r=-0.791,-0.716; P<0.001,<0.001). The postoperative FAZ area in deep capillary plexus correlated negatively with BCVA and preoperative and postoperative M-score (r=-0.343, -0.330, -0.732, -0.694; P=0.026, 0.033,<0.001,<0.001). Conclusions PPV with ILM peeling can effectively restore the FAZ areas in superficial and deep capillary plexus, improve the visual acuity and metamorphopsia in patients with IMEM. Both superficial and deep plexus FAZ areas correlated negatively with metamorphopsia, and deep plexus FAZ area also correlated negatively with BCVA. Key words: Macula lutea; Membranes; Vitrectomy; Tomographyoptical coherence; Foveal avascular zone; Metamorphopsia

Operative timing and outcomes in the elderly patients with hip fracture

Objective To analyze the impacts of operative timing on the operative outcomes in elderly patients with hip fracture. Methods A cohort of 814 elderly patients with hip fracture were analyzed retrospectively who had been treated at Department of Orthopaedics, The 7th Medical Center, General Hospital of Chinese People's Liberation Army from January 2012 to December 2015. They were 272 males and 542 females, aged from 60 to 99 years (average, 79.9 years). They were divided into 2 categories according to their systemic status by the American Association of Anesthesiologists (ASA) classification. There were 403 cases of ASA class Ⅰ and Ⅱ in the good status category and 411 cases of ASA class Ⅲ and Ⅳ in the poor status category. Each category was further divided into one early operation group and one late operation group depending on whether the patients were operated on within 48 hours after admission. The 2 groups were compared in terms of hospital stay, incidence of complications, 30-day and 1-year mortalities, and 1-year activities of daily living(ADL) scores. Results In the good status patients there were no significant differences between the 2 groups in the preoperative general data, showing compatibility (P>0.05). The early operation group showed significantly lower 30-day mortality [0% (0/94)] and 1-year mortality [5.3% (5/94)], significantly shorter hospital stay (9.6 d ± 5.2 d) and significantly higher 1-year ADL scores [75 (70, 85)] than the late operation group [4.2% (13/309) and 14.2% (44/309), 12.3 d ± 5.9 d, and 70 (60, 80), respectively] (all P 0.05). In the poor status patients there were no significant differences between the 2 groups in the preoperative general data, showing compatibility (P>0.05). The incidence of complications in the early operation group [42.2% (35/83)] was significantly higher than in the late operation group [30.5% (100/328)] (P 0.05). Conclusion For the elderly patients with hip fracture, operation can be carried out as soon as possible if they are in good physical condition, and early operation is not necessary if they are in poor systemic condition because operation should be carried out at an appropriate time after evaluation of their physical condition allows. Key words: Hip fractures; Timing of surgery; Mortality

Clinical research of early goal directed sedation applying in acute brain injury

To investigate the value and feasibility of early goal directed sedation (EGDS) in patients with acute brain injury. A total of 110 patients with acute brain injury who were admitted to intensive care unit (ICU) of the Third Medical Center of the Chinese People's Liberation Army General Hospital from January 2015 to March 2019 were included and randomly divided into EGDS group and standard sedation group (STD) using the random number table. Patients in the EGDS group were sedated by continuous intravenous infusion of dexmedetomidine (initial dose of 0.2 μg×kg-1×min-1) for 72 consecutive hours. Patients in the STD group received intravenous bolus of propofol as appropriate clinically. Richmond agitation-sedation score (RASS) and electroencephalogram bispectral index (BIS) were used to continuously monitor the level of sedation. All patients were given sufentanil for analgesia. Routine treatments such as dehydration and reduction of intracranial pressure with mannitol, hemostasis or antiplatelet therapy were given according to the patients' condition. Vital signs, acute physiology and chronic health evaluation II (APACHE II) score, Glasgow coma scale (GCS) score, BIS value, artery blood gas analysis, duration of mechanical ventilation, analgesic dosage and adverse events were recorded in two groups before and 24, 48, and 72 hours after sedation. (1) Among the 110 patients, patients who received the second surgery due to cerebral hemorrhage, had worsening of cerebral hernia, withdrew during the course of the study, or whose family members abandoned treatment were excluded from the study. Finally, 105 patients were enrolled in the study, including 56 patients in the EGDS group and 49 in the STD group. There was no significant difference in gender, age, types of brain injury, baseline APACHE II or GCS score or rate of mechanical ventilation between the two groups. (2) Compared with before sedation, heart rate (HR) significantly decreased till 72 hours after sedation in both groups, and the decrease in the EGDS groups was more obvious as compared with the STD group (bpm: 70.49±7.53 vs. 79.83±9.48, P < 0.05). Besides HR, significant improvement was found in the APACHE II and GCS scores in the STD group at 72 hours of sedation as compared with before sedation, and no significant difference was found in other indicators. Compared with before sedation, arterial partial pressure of carbon dioxide (PaCO2) was significantly increased from the 24th hour of sedation, mean artery pressure (MAP) was decreased significantly and GCS score, BIS value were increased significantly from the 48th hour of sedation, till 72 hours, which were all improved significantly as compared with the STD group [72-hour PaCO2 (mmHg, 1 mmHg = 0.133 kPa): 40.30±5.98 vs. 31.57±8.20, 72-hour MAP (mmHg): 85.01±8.26 vs. 89.54±9.41, 72-hour GCS score: 8.62±3.34 vs. 7.89±2.74, 72-hour BIS: 60.87±24.79 vs. 56.68±33.43, all P < 0.05]. APACHE II score was significantly lower only at the 72nd hour of sedation as compared with before sedation in the EGDS group, and no significant difference was found as compared with the STD group (17.10±7.05 vs. 18.90±3.32, P > 0.05). Oxygenation index (PaO2/FiO2) was significantly increased only at the 24th hour of sedation in the EGDS group as compared with the STD group (mmHg: 261.05±118.45 vs. 226.45±96.54, P < 0.05). (3) The duration of mechanical ventilation was significantly shorter in the EGDS group than that in the STD group (hours: 20.56±9.03 vs. 27.75±11.23, P < 0.05), and the total administered dose of sufentanil was significantly lower in the EGDS group than that in the STD group (μg: 79.16±26.76 vs. 102.46±35.48, P < 0.05). (4) Compared with the STD group, the incidence of bradycardia in the EGDS group was increased significantly [10.71% (6/56) vs. 6.12% (3/49), P < 0.05], while the incidence of tachycardia was decreased significantly [14.29% (8/56) vs. 38.78% (19/49), P < 0.05], but no significant difference was found in the incidence of hypotension [5.36% (3/56) vs. 4.08% (2/49), P > 0.05]. The incidence of unexpected extubation in the STD group was 4.08% (2/49), which did not occurre in the EGDS group. EGDS can improve the GCS score and BIS value of patients with acute brain injury, suggesting that the EGDS is safe and feasible, which can help improve neurological function in patients with acute brain injury.

Prediction of fatal adverse prognosis in patients with fever-related diseases based on machine learning: A retrospective study.

BackgroundFever is the most common chief complaint of emergency patients. Early identification of patients at an increasing risk of death may avert adverse outcomes. The aim of this study was to establish an early prediction model of fatal adverse prognosis of fever patients by extracting key indicators using big data technology.MethodsA retrospective study of patients’ data was conducted using the Emergency Rescue Database of Chinese People's Liberation Army General Hospital. Patients were divided into the fatal adverse prognosis group and the good prognosis group. The commonly used clinical indicators were compared. Recursive feature elimination (RFE) method was used to determine the optimal number of the included variables. In the training model, logistic regression, random forest, adaboost and bagging were selected. We also collected the emergency room data from December 2018 to December 2019 with the same inclusion and exclusion criterion. The performance of the model was evaluated by accuracy, F1-score, precision, sensitivity and the areas under receiver operator characteristic curves (ROC-AUC).ResultsThe accuracy of logistic regression, decision tree, adaboost and bagging was 0.951, 0.928, 0.924, and 0.924, F1-scores were 0.938, 0.933, 0.930, and 0.930, the precision was 0.943, 0.938, 0.937, and 0.937, ROC-AUC were 0.808, 0.738, 0.736, and 0.885, respectively. ROC-AUC of ten-fold cross-validation in logistic and bagging models were 0.80 and 0.87, respectively. The top six coefficients and odds ratio (OR) values of the variables in the Logistic regression were cardiac troponin T (CTnT) (coefficient=0.346, OR = 1.413), temperature (T) (coefficient=0.235, OR = 1.265), respiratory rate (RR) (coefficient= –0.206,OR = 0.814), serum kalium (K) (coefficient=0.137, OR = 1.146), pulse oxygen saturation (SPO2) (coefficient= –0.101, OR = 0.904), and albumin (ALB) (coefficient= –0.043, OR = 0.958). The weights of the top six variables in the bagging model were: CTnT, RR, lactate dehydrogenase, serum amylase, heartrate, and systolic blood pressure.ConclusionsThe main clinical indicators of concern included CTnT, RR, SPO2, T, ALB and K. The bagging model and logistic regression model had better diagnostic performance comprehesively. Those may be conducive to the early identification of critical patients with fever by physicians.

Relationship between serum C3/C4 ratio and prognosis of immunoglobulin A nephropathy based on propensity score matching.

BackgroundAberrant activation of the complement system plays an important role in the pathogenesis and development of immunoglobulin A nephropathy (IgAN). The relationship between serum complement and the clinical-histopathological features and outcomes of IgAN is controversial. This retrospective study aimed to examine the relationship between the complement 3/4 (C3/C4) ratio and the clinicopathologic changes and prognosis of patients with IgAN.MethodsA total of 397 patients with primary IgAN from January 2007 to December 2012 at the Chinese People's Liberation Army General Hospital were included in this study. The correlation test and Chi-square test or one-way analysis of variance test were performed to evaluate the relationship between the C3/C4 ratio and other clinical-pathological factors. Propensity score matching and a multivariate Cox regression model were used to calculate the risk factors of renal outcome.ResultsThe median follow-up period was 75 months. During the follow-up period, 62 patients (15.6%) developed into the end-stage renal disease (ESRD). The C3/C4 ratio at baseline was associated with the level of serum creatinine (SCr), 24 h urinary protein excretion (24 h Upre), global glomerular sclerosis, and tubulointerstitial lesion. The level of SCr and 24 h Upre and the degree of chronic kidney injury were statistically different among groups defined by different C3/C4 ratio levels. The survival rates of patients among groups with different C3/C4 ratio levels were different. After propensity score matching, eighty-eight pairs of patients were successfully matched, and the C3/C4 ratio was an influencing factor for the patients’ outcome (hazard ratio 0.587, 95% confidence interval 0.329–0.880). Patients with a C3/C4 ratio <3.6 had a poorer outcome compared with the others (P = 0.002).ConclusionsIgAN patients with decreased C3/C4 ratio displayed significantly more severe clinical symptoms and chronic renal injury than patients with higher ratios. A low C3/C4 ratio could be a risk factor for patients developing to ESRD.

Clinical characteristics of patients with ankylosing spondylitis and inflammatory bowel disease

Objective: To analyze the clinical characteristics of patients with ankylosing spondylitis (AS) with inflammation bowel disease (IBD). Methods: AS patients fulfilling the 1984 modified New York diagnostic criteria were recruited in Chinese AS Prospective Imaging Cohort (CASPIC) consecutively from April 2016 to June 2017 in Chinese People's Liberation Army General Hospital by using smart management system for spondyloarthritis (SpAMS). The diagnosis of IBD was confirmed by tissue pathology via ileocolonoscopy. Demographic, clinical and biochemical data were collected. Results: In total, 893 patients with AS were recruited with the mean age 30.8 years. The majority were men (739, 82.8%). There were 64 (7.2%) patients concomitant with IBD. The mean age [(34.5±7.5) years vs. (30.5±8.8) years, P<0.001] was older and the disease duration [(10.8±6.9) years vs. (8.1±5.9) years, P=0.001] was longer in patients with IBD than patients without. Compared with patients without IBD, patients with IBD had more frequent involvement of the cervical spine [(21.9% (14/64) vs. 10.5% (87/829), P=0.006) and thoracic spine [29.7% (19/64) vs. 12.3% (102/829), P<0.001]. Uveitis [28.1% (18/64) vs. 16.4% (136/829), P=0.017] and psoriasis [7.8% (5/64) vs. 2.3% (19/829), P=0.009] were also more common in patients concomitant with IBD. In addition, patients with IBD had significantly higher scores in BASDAI (3.3±2.1 vs. 2.4±1.8, P<0.001), BASFI [2.2 (1.0,3.3) vs. 1.1(0.2,2.4), P<0.001)] and ASAS HI (7.1±4.3 vs. 5.3±3.7, P= 0.001) than patients without IBD. Conclusions: Compared with patients without IBD, AS patients concomitant with IBD have more severe disease activity and organ dysfunction. Furthermore, the uveitis and psoriasis are more frequently accompanied in AS patients with IBD.

Clinical characteristics, treatments, and prognosis of patients with multiple primary carcinoma of head and neck.

Clinical characteristics, treatments, and prognosis of patients with multiple primary carcinoma of head and neck.

Genetic polymorphisms of high platelet reactivity in Chinese patients with coronary heart disease under clopidogrel therapy

The variability in the clinical response to clopidogrel treatment has been attributed to genetic factors, but the specific genes and other risk factors remain unclear. To investigate the incidence of high on-treatment platelet reactivity in coronary heart disease patients following clopidogrel therapy by analyzing the correlation between genetic polymorphisms and high on-treatment platelet reactivity. This study was conducted in the Chinese People's Liberation Army (PLA) general hospital. 578 patients with coronary heart disease undergoing percutaneous transluminal coronary intervention treatment were enrolled. They received dual antiplatelet therapy with aspirin (300mg) plus clopidogrel (300mg) over 24h, or aspirin (100mg/day) and clopidogrel (75mg/day) over 3 days. Patients were divided into two groups according to the adenosine diphosphate inhibition rate. The follow-up lasted at least 12months and adverse endpoint events were recorded. The single nucleotide polymorphisms were detected by MassArray genotyping system. The incidence of HTPR was 15.74% in total, being higher in females than in males (24.29% vs. 13.01%, P < 0.01). Diabetes mellitus, homocysteine and high sensitivity C-reactive protein (hs-CRP) levels were significantly higher in the HTPR group than those in the non-HTPR group (P < 0.05). Polymorphisms of rs1057910 (OR 2.90, P = 0.003), rs2246709 (OR 0.69, P = 0.039), and rs776746 (OR 0.66, P = 0.034) were associated with theincidenceofhigh on-treatment platelet reactivity. Female patients were prone to polymorphisms of rs1057910 (OR 3.24, P = 0.004) and rs776746 (OR 0.57, P = 0.025). Compared to non-high on-treatment platelet reactivity group, no differences in high reactivitygroup were observed with coexisting single nucleotide polymorphisms (14.6% vs. 14.8%, P > 0.05). The adverse endpoint events were significantly higher in the high on-treatment platelet reactivity group than in the non-treatment reactivitygroup. The survival analysis showed that high on-treatment platelet reactivitywas significantly associated with the risk of the endpoint events (P = 0.0219). Gender (female), diabetes mellitus, high levels of homocysteine and hs-CRP were risk factors for high on-treatment platelet reactivity, and high reactivity was a strong predictor for adverse endpoint events in the coronary heart disease patients. The polymorphism of rs1057910 was a risk factor of high on-treatment platelet reactivity while rs2246709 and rs776746 polymorphisms were protective factors, and coexisting single nucleotide polymorphisms didn't increase the incidence of high on-treatment platelet reactivity.

Impact of resection margins on long-term survival after pancreaticoduodenectomy for pancreatic head carcinoma.

BACKGROUNDThe impact of resection margin status on long-term survival after pancreaticoduodenectomy (PD) for patients with pancreatic head carcinoma remains controversial and depends on the method used in the histopathological study of the resected specimens. This study aimed to examine the impact of resection margin status on the long-term overall survival of patients with pancreatic head carcinoma after PD using the tumor node metastasis standard.METHODSConsecutive patients with pancreatic head carcinoma who underwent PD at the Chinese People's Liberation Army General Hospital between May 2010 and May 2016 were included. The impact of resection margin status on long-term survival was retrospectively analyzed.RESULTSAmong the 124 patients, R0 resection was achieved in 85 patients (68.5%), R1 resection in 38 patients (30.7%) and R2 resection in 1 patient (0.8%). The 1- and 3-year overall survival (OS) rates were significantly higher for the patients who underwent R0 resection than the rates for those who underwent R1 resection (1-year OS rates: 69.4% vs 53.0%; 3-year OS rates: 26.9% vs 11.7%). Multivariate analysis showed that resection margin status and venous invasion were significant risk factors for OS.CONCLUSIONResection margin was an independent risk factor for OS for patients with pancreatic head carcinoma after PD. R0 resection was associated with significantly better OS after surgery.

Metataxonomics of Internal Transcribed Spacer amplicons in cerebrospinal fluid for diagnosing and genotyping of cryptococcal meningitis.

Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality. Rapidity and accuracy of diagnosis contribute to better prognosis, but readily available tools, such as microscopy, culture, and antigens do not perform well all the time. Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid (CSF) samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer (ITS) amplicons. The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls. Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital, Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018. ITS1 ribosomal deoxyribonucleic acid (rDNA) genes of 15 whole samples were amplified by universal forward primer ITS1 (CTTGGTCATTTAGAGGAAGTAA) and reverse primer ITS2 (GCTGCGTTCTTCATCGATGC), sequenced by Illumina MiSeq Benchtop Sequencer. The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples. Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis (PERMANOVA) in R software. The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control. The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance (from 95.90% to 99.97%), followed by many other fungal groups (each <1.41%). ITS genotype was defined in 11 CSF samples, corresponding to ITS type 1, and confirmed by Sanger sequencing. A statistically significant difference (r = 0.65869, P = 0.0014) between infectious group and control group was observed. The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples, which may provide a better diagnostic approach of cryptococcal infection.

Non-surgical treatment of acute pancreatitis with colonic fistula

Objective: To examine the effectiveness of non-operative of colonic fistula following acute pancreatitis. Methods: Retrospective analysis of 354 patients with acute pancreatitis who were admitted to Department of Hepatobiliary Surgery of Chinese People's Liberation Army General Hospital from January 2013 to December 2018. Age of the patients was (46±14) years (range: 14-85 years); 249 cases (70.3%) were males. There were 41 cases of acute edematous pancreatitis and 313 cases of acute necrotising pancreatitis. Two hundred and fifteen cases were diagnosed as moderate severe acute pancreatitis and 139 were diagnosed as severe acute pancreatitis. Among 313 cases of acute necrotising pancreatitis, 62 cases underwent non-surgical treatment, 251 cases underwent surgical treatment in which 218 of minimal access retroperitoneal pancreatic necrosectomy underwent percutaneous nephroliguectomy with peripancreatic necrotic tissue removal technique. Results: There were 15 cases of colon fistula following acute necrotising pancreatitis, and the incidence rate was 4.2%(15/354). There were 7 males and 8 females, with age of (39±8) years (range: 27 to 50 years). The median interval between acute pancreatitis onset and diagnosis of colonic fistula was 71 days(27-134) days. Two cases occurred at the hepatic flexure of the colon, 4 cases at transverse colon, and 9 cases at splenic flexure of colon. Of the 354 patients, 39 cases died and the mortality was 11.0%. Two patients underwent laparotomy, and one of them died. The remaining 13 patients underwent non-surgical treatment and were discharged. Conclusion: Acute pancreatitis with colonic fistula can be treated with non-surgical treatment and can achieve good prognosis.