Generation Of Chemiluminescence Research Articles

A new universal detection system for high-performance thin-layer chromatography plates using chemiluminescence

High-performance thin-layer chromatography (HPTLC) is a cost-effective method for the separation of small molecules, such as active pharmaceutically ingredients. The method can be used without sophisticated equipment. For example, the detection and quantification of colored compounds on an HPTLC plate can be performed with a CCD camera. For noncolored compounds, a new dipping solution for the generation of chemiluminescence on an HPTLC plates is presented. In combination with a charge-coupled diode (CCD) camera, this can be used as a universal detection system. The efficiency of this new staining reagent is demonstrated by the detection of trimethoprim and sulfamethoxazole from a fixed-dose combination in a ratio of 1:5.

Functional Nanozymes Consisting of Co2+‐ZIF‐67 Metal‐Organic Framework Nanoparticles and Co2+‐ZIF‐67/Polyaniline Conjugates

AbstractCo2+‐ZIF‐67 metal‐organic framework nanoparticles (NMOFs), act as nanozymes catalyzing diverse processes, including peroxidase, oxidase, and catalase activities. Peroxidase activities are reflected by the nanozyme‐catalyzed H2O2 oxidation of dopamine to aminochrome, the H2O2 oxidation of NADH to NAD+, the H2O2‐catalyzed generation of chemiluminescence through oxidation of luminol, and the H2O2‐mediated oxidation of aniline to polyaniline. Oxidase activities of the nanozyme are demonstrated by the Co2+‐ZIF‐67 NMOFs catalyzed aerobic oxidation of dopamine to aminochrome and of NADH to NAD+, and catalase activities of the nanozyme are reflected by the catalytic decomposition of H2O2. Moreover, the Co2+‐ZIF‐67 catalyzed oxidation of aniline to polyaniline (PAN) by H2O2 is accompanied by the coating of NMOFs with PAN to yield a Co2+‐ZIF‐67/PAN hybrid material. Coating the particles in the presence of guest substrates leads to molecular imprinted PAN matrices revealing enhanced ZIF‐67 catalyzed transformations as compared to non‐imprinted PAN matrices. This is demonstrated by imprinting of 2,2′‐azinobis(3‐ethylbenzothiazoline‐6‐sulfonic acid), ABTS2−, in the PAN coating and the 3.3‐fold enhanced catalyzed oxidation of ABTS2− by H2O2, as compared to the non‐imprinted PAN hybrid composite. Moreover, imprinting of L‐/D‐DOPA in the PAN coating of Co2+‐ZIF‐67 NMOFs leads to chiro‐selective H2O2‐guided oxidation of L‐/D‐DOPA to dopachrome by the NMOFs/PAN composite.

Transient Dynamic Operation of G-Quadruplex-Gated Glucose Oxidase-Loaded ZIF-90 Metal-Organic Framework Nanoparticle Bioreactors.

Glucose oxidase-loaded ZIF-90 metal-organic framework nanoparticles conjugated to hemin-G-quadruplexes act as functional bioreactor hybrids operating transient dissipative biocatalytic cascaded transformations consisting of the glucose-driven H2O2-mediated oxidation of Amplex-Red to resorufin or the glucose-driven generation of chemiluminescence by the H2O2-mediated oxidation of luminol. One system involves the fueled activation of a reaction module leading to the temporal formation and depletion of the bioreactor conjugate operating the nickase-guided transient biocatalytic cascades. The second system demonstrates the fueled activation of a reaction module yielding a bioreactor conjugate operating the exonuclease III-dictated transient operation of the two biocatalytic cascades. The temporal operations of the bioreactor circuits are accompanied by kinetic models and computational simulations enabling us to predict the dynamic behavior of the systems subjected to different auxiliary conditions.

A Novel and Label-Free Chemiluminescence Detection of Zearalenone Based on a Truncated Aptamer Conjugated with a G-Quadruplex DNAzyme

Zearalenone (ZEN), one of the most frequently occurring mycotoxin contaminants in foods and feeds, poses considerable threat to human and animal health, owing to its acute and chronic toxicities. Thus, rapid and accurate detection of ZEN has attracted broad research interest. In this work, a novel and label-free chemiluminescence aptasensor based on a ZEN aptamer and a G-quadruplex DNAzyme was constructed. It was established on a competitive assay between ZEN and an auxiliary DNA for the aptamer, leading to activation of the G-quadruplex/hemin DNAzyme and subsequent signal amplification by chemiluminescence generation after substrate addition. To maximize the detection sensitivity, numerous key parameters including truncated aptamers were optimized with molecular docking analysis. Upon optimization, our aptasensor exhibited a perfect linear relationship (R2 = 0.9996) for ZEN detection in a concentration range of 1-100 ng/mL (3.14-314.10 nM) within 40 min, achieving a detection limit of 2.85 ng/mL (8.95 nM), which was a 6.7-fold improvement over that before optimization. Most importantly, the aptasensor obtained a satisfactory recovery rate of 92.84-137.27% and 84.90-124.24% for ZEN-spiked wheat and maize samples, respectively. Overall, our label-free chemiluminescence aptasensor displayed simplicity, sensitivity, specificity and practicality in real samples, indicating high application prospects in the food supply chain for rapid detection of ZEN.

Nucleic acid-functionalized nanozymes and their applications.

Nanozymes are inorganic, organic and metal-organic framework nanoparticles that reveal catalytic functions by emulating native enzyme activities. Recently, these nanozymes have attracted growing scientific interest, finding diverse analytical and medical applications. However, the catalytic activities and functions of nanozymes are limited, due to the lack of substrate binding sites that concentrate on the substrate at the catalytic site (molarity effect), introduce substrate specificity and allow functional complexity of the catalysts (cascaded, switchable and cooperative catalysis). The modification of nanozymes with functional nucleic acids provides means to overcome these limitations and engineer nucleic acid/nanozyme hybrids for diverse applications. This is exemplified with the synthesis of aptananozymes, which are supramolecular aptamer-modified nanozymes. Aptananozymes exhibit combined specific binding and catalytic properties that drive diverse chemical transformations, revealing enhanced catalytic activities, as compared to the separated nanozyme/aptamer constituents. Relationships of structure-catalytic functions in the aptananozyme constructs are demonstrated. In addition, modification of nanozymes exhibiting multimodal catalytic functions with aptamers allows the engineering of nanozyme-based bioreactors for cascaded catalysis. Also, the functionalization of reactive oxygen species (ROS)-generating nanozymes with cancer cell-recognizing aptamers yields aptananozymes for targeted chemodynamic treatment of cancer cells and cancer tumors elicited in mice. Finally, nucleic acid-modified enzyme (glucose oxidase)-loaded metal-organic framework nanoparticles yield switchable biocatalytic nanozymes that drive the ON/OFF biocatalyzed oxidation of Amplex Red, dopamine or the generation of chemiluminescence. Herein, future challenges of the topic are addressed.

Dissipative biocatalytic cascades and gated transient biocatalytic cascades driven by nucleic acid networks.

Living systems consist of complex transient cellular networks guiding structural, catalytic, and switchable functions driven by auxiliary triggers, such as chemical or light energy inputs. We introduce two different transient, dissipative, biocatalytic cascades, the coupled glucose oxidase (GOx)/horseradish peroxidase (HRP) glucose–driven oxidation of 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS2−) to the radical anion (ABTS•−) and the lactate dehydrogenase (LDH)/nicotinamide adenine dinucleotide (NAD+) lactate–driven reduction of NAD+ to NADH. The transient biocatalytic systems are driven by nucleic acid reaction modules using a nucleic acid fuel strand L1′ and a nicking enzyme, Nt.BbvCI, as fuel-degrading catalyst, leading to the dynamic spatiotemporal transient formation of structurally proximate biocatalysts activating the biocatalytic cascades and transient coupled processes, including the generation of chemiluminescence and the synthesis of alanine. Subjecting the mixture of biocatalysts to selective inhibitors allows the gated transient operation of the biocatalysts. The kinetics of transient biocatalytic cascades are accompanied by kinetic models and computational simulations.

A 1,2-Dioxetane-Based Chemiluminescent Probe for Highly Selective and Sensitive Detection of Superoxide Anions in Vitro and in Vivo.

Superoxide anion (O2.- ), a short-lived, highly active reactive oxygen species, participates in many physiological processes. This work reports the design of a chemiluminescent probe (CLO) based on 1,2-dioxetane-phenol with a selective and sensitive response to O2.- . The CLO consisted of a 1,2-dioxetane-phenol as a chemiluminophore core bearing a trifluoromethanesulfonate (Tf) moiety and methyl acrylate group. Upon reacting with O2.- , the Tf was specifically cleaved from the CLO, resulting in chemiluminescence generation. The CLO emits chemiluminescence at 450-650 nm (λmax =540 nm), representing visible and red chemiluminescent molecules, responsive to O2.- . The CLO processes high sensitivity (Limit of detection=66 nM) and selectivity for O2.- with and has been applied to track O2.- fluctuations in living cells and animals. In addition, CLO successfully detected and visualized O2.- -related biochemical processes, making it promising as an important imaging tool for studying redox in biology and medicine.

Novel Mechanism Insight for Enhanced Electrochemiluminescence Signal

Electrochemiluminescence (ECL) is a leading technique in bioanalysis.[1] Since the excited species are produced with an electrochemical stimulus rather than with a light excitation source, ECL displays improved signal-to-noise ratio compared to photoluminescence, with minimized effects due to light scattering and luminescence background. The most challenging breakthrough in the development of analytical electrochemiluminescence (ECL) applications was reported from Bard and co workers that presented for the first time the generation of ECL with a coreactant.[1] This finding opened the application of ECL to large literature and transformed ECL from an academic curiosity to a real application and industrial success. In this context, the only real used materials for the ECL analytical and commercial application are tripropylamine (TPrA) as sacrificial ”oxidative-reductant” coreactant and Ruthenium(II)-tris(2,2’-bipyridine) ([Ru(bpy)3]2+) as emitting species. In this case the mechanism for the ECL generation was proposed by Bard and still nowadays the only one accepted.[2],[3]Here we show an additional, and very efficient, mechanism pathway for the generation of ECL by using TPrA as coreactant. Thanks to the combination between ECL and microscopy we experimentally prove the alternative mechanism with the standard [Ru(bpy)3]2+/TPrA system.[3],[4] These mechanistic findings allow us to propose alternative amines as coreactant enhancing the ECL signal of more than one order of magnitude.The reported results, besides contributing to a better understanding of the mechanisms operating in the chemiluminescence generation, also pave the way for the development of very highly efficient ECL coreactants for ultrasensitive bioanalysis.[5][1] Miao W.; Choi J. P.; Bard A. J., J. Am. Chem. Soc. 2002, 124, 14478-14485[2] Sentic M.; Milutinovic M.; Kanoufi F.; Manojlovic D.; Arbault S.; Sojic N., Chem. Sci. 2014, 5, 2568-2572[3] Valenti G.; Scarabino S.; Goudeau B.; Lesch A.; Jović M.; Villani E.; Sentic M.; Rapino S.; Arbault S.; Paolucci F.; Sojic N., J. Am. Chem. Soc. 2017, 139, 16830-16837.[4] a) Valenti G.; Zangheri M.; Sansaloni S. E.; Mirasoli M.; Penicaud A.; Roda A.; Paolucci F., Chem. Eur. J., 2015, 21, 12640–12645; b) Zanut A.; Fiorani A.; Rebeccani S.; Kesarkar S.; Valenti G., Anal. Bioanal. Chem., 2019, 411(19), 4375-4382.[5] Zanut A. at al Nature Commun. 2020, 11, 2668 Figure 1

Screening-confirmation strategy for nanomaterials involving spectroscopic analytical techniques and its application to the control of silver nanoparticles in pastry samples.

The full characterization of nanomaterials (NMs), which requires a range of different and expensive equipment, is not always necessary to meet certain demands of information. Qualitative analytical methods are ideal alternatives when only a piece of information is required. In this work, a qualitative method for the screening of NMs has been developed and statistically validated for the first time, with silver nanoparticles (AgNPs) as a proof of concept. It is based on the generation of chemiluminescence of the luminol/Ag+ system in alkaline media in the presence of AgNPs. Measurements are obtained in a short time with a simple instrument. Probability of detection (POD) curves were constructed at three cut-off values next to the limit of detection of the chemiluminescent method. The unreliability region (UR) was from 0.50 to 1.82μgL-1. Currently, no regulation on AgNPs exists, but the present method was successfully tested for a hypothetical threshold of 2.5μgL-1 of 40nm AgNPs. The method was applied to silver colored pearls, with silver (E-174) or aluminum (E-173) coating, used for decoration of pastry. Performance parameters such as false negative and positive rates as well as specificity, sensitivity and reliability rates were calculated for validation. The results of the screening method were confirmed by asymmetric flow field flow fractionation coupled to inductively coupled plasma mass spectrometry (AF4-ICP-MS). The proposed screening method is simple, fast, economic, and easy to transfer to routine laboratories in the field of food safety.

Functional DNA Structures and Their Biomedical Applications

Since the discovery of the double-helix structure in 1953, nucleic acids have been developed from natural genetic codes into functional building blocks in a wide range of biotechnology and material...

Unprecedented strong intrinsic chemiluminescence generation from degradation of halogenated hydroxy-quinoid pollutants by Co(II)-mediated advanced oxidation processes: The critical role of site-specific production of hydroxyl radicals

We found previously that an unusual two-step hydroxyl radical (OH)–dependent chemiluminescence (CL) can be produced by the carcinogenic tetrachloro-1,4-benzoquinone (TCBQ, also known as p-chloranil) and H2O2. However, neither OH generation nor CL emission could be observed between H2O2 and chloranilic acid (CA), the dihydroxylation product of TCBQ. Here we found, unexpectedly, that distinct CL could be produced from CA/H2O2 in the presence of a variety of transition metal ions, among them Co(II) was found to be the most effective. Interestingly, the kinetic profiles of CL production, CA degradation, and reactive oxygen species (ROS) generation were found to be markedly changed with the molar ratios of Co(II):CA. When compared with the classic Fe(II)-mediated Fenton system, we found that the much stronger CL emission and more effective degradation of CA induced by Co(II)-mediated Fenton-like system is mainly due to the highly reactive OH generated site-specifically by Co(II)/H2O2, although other ROS such as O2− and 1O2 were also detected. More interestingly, not only CA, other halogenated anilic acids and catechols could also produce significant CL by Co(II)-mediated Fenton-like system. This is the first report on the distinct CL emission from degradation of halogenated hydroxyl-quinones by Co(II)-mediated Fenton-like advanced oxidation process, which is dependent on the site-specifically produced OH. These findings may have potential applications in measuring halogenated hydroxyl-quinones, and developing more effective techniques to degrade these types of important environmental pollutants.

Controlling the Catalytic and Optical Properties of Aggregated Nanoparticles or Semiconductor Quantum Dots Using DNA-Based Constitutional Dynamic Networks.

Nucleic acid-based constitutional dynamic networks (CDNs) attract growing interest as a means to mimic complex biological networks. The triggered stabilization of the CDNs allows the dictated guided reversible reconfiguration and re-equilibration of the CDNs to other CDN configurations, where some of the constituents are up-regulated, while other constituents are down-regulated. Although substantial progress in controlling the adaptive dynamic control of the compositions of networks by means of auxiliary triggers was demonstrated, the use of CDNs as active ensembles for controlling chemical functionalities is still a challenge. We report on the assembly of signal-triggered CDN systems that guide the switchable aggregation of Au nanoparticles (NPs), thereby controlling their plasmonic properties and their catalytic functions (Au NPs-catalyzed oxidation of l-DOPA to dopachrome). In addition, we demonstrate that the triggered and orthogonal up-regulation and down-regulation of the constituents of the CDNs leads to the dictated aggregation of different-sized CdSe/ZnS quantum dots (QDs), cross-linked by K+-ion-stabilized G-quadruplex units. The incorporation of hemin into the G-quadruplex cross-linking units yields horseradish peroxidase-mimicking DNAzyme units that catalyze the generation of chemiluminescence via the oxidation of luminol by H2O2. The resulting chemiluminescence stimulates the chemiluminescence resonance energy transfer (CRET) process to the QDs, resulting in the luminescence of the two-sized QDs. By the application of appropriate triggers, the CDN-dictated up-regulation and down-regulation of the different-sized QDs aggregates are demonstrated, and the control over the photophysical functions of the different-sized QDs, by means of the CDNs, is highlighted.

Cu2+ -Modified Metal-Organic Framework Nanoparticles: A Peroxidase-Mimicking Nanoenzyme.

The synthesis and characterization of UiO-type metal-organic framework nanoparticles (NMOFs) composed of Zr4+ ions bridged by 2,2'-bipyridine-5,5'-dicarboxylic acid ligands and the postmodification of the NMOFs with Cu2+ ions are described. The resulting Cu2+ -modified NMOFs, Cu2+ -NMOFs, exhibit peroxidase-like catalytic activities reflected by the catalyzed oxidation of Amplex-Red to the fluorescent Resorufin by H2 O2 , the catalyzed oxidation of dopamine to aminochrome by H2 O2 , and the catalyzed generation of chemiluminescence in the presence of luminol/H2 O2 . Also, the Cu2+ -NMOFs mimic NADH peroxidase functions and catalyze the oxidation of dihydronicotinamide adenine dinucleotide, NADH, to nicotinamide adenine dinucleotide, NAD+ , in the presence of H2 O2 . The Cu2+ -NMOFs-catalyzed generation of chemiluminescence in the presence of luminol/H2 O2 is used to develop a glucose sensor by monitoring the H2 O2 formed by the aerobic oxidation of glucose to gluconic acid in the presence of glucose oxidase. Furthermore, loading the Cu2+ -NMOFs with fluorescein and activating the catalyzed generation of chemiluminescence in the presence of luminol/H2 O2 yield an efficient chemiluminescence resonance energy transfer (CRET) process to the fluorescein reflected by the activation of the fluorescence of the dye (λ = 520 nm, CRET efficiency 35%).

DNA origami nanorobot fiber optic genosensor to TMV

In the quest of greater sensitivity and specificity of diagnostic systems, one continually searches for alternative DNA hybridization methods, enabling greater versatility and where possible field-enabled detection of target analytes. We present, herein, a hybrid molecular self-assembled scaffolded DNA origami entity, intimately immobilized via capture probes linked to aminopropyltriethoxysilane, onto a glass optical fiber end-face transducer, thus producing a novel biosensor. Immobilized DNA nanorobots with a switchable flap can then be actuated by a specific target DNA present in a sample, by exposing a hemin/G-quadruplex DNAzyme, which then catalyzes the generation of chemiluminescence, once the specific fiber probes are immersed in a luminol-based solution. Integrating organic nanorobots to inorganic fiber optics creates a hybrid system that we demonstrate as a proof-of-principle can be utilized in specific DNA sequence detection. This system has potential applications in a wide range of fields, including point-of-care diagnostics or cellular in vivo biosensing when using ultrathin fiber optic probes for research purposes.

Mimicking Peroxidase Activities with Prussian Blue Nanoparticles and Their Cyanometalate Structural Analogues.

Nanoparticles composed of Prussian Blue, PB, and the cyanometalate structural analogues, CuFe, FeCoFe, and FeCo, are examined as inorganic clusters that mimic the functions of peroxidases. PB acts as a superior catalyst for the oxidation of dopamine to aminochrome by H2O2. The oxidation of dopamine by H2O2 in the presence of PB is 6-fold faster than in the presence of CuFe. The cluster FeCo does not catalyze the oxidation of dopamine to aminochrome. The most efficient catalyst for the generation of chemiluminescence by the oxidation of luminol by H2O2 is, however, FeCo, and PB lacks any catalytic activity toward the generation of chemiluminescence. The order of catalyzed chemiluminescence generation is FeCo ≫ CuFe > FeCoFe. The clusters PB, CuFe, FeCoFe, and FeCo mimic the functions of NADH peroxidase. The catalyzed oxidation of NADH by H2O2 to form NAD+ follows the order PB ≫ CuFe ∼ FeCoFe, FeCo. The efficient generation of chemiluminescence by the FeCo-catalyzed oxidation of luminol by H2O2 is used to develop a glucose sensor. The aerobic oxidation of glucose in the presence of glucose oxidase, GOx, yields gluconic acid and H2O2. The chemiluminescence intensities formed by the GOx-generated H2O2 relate to the concentration of glucose, thus providing a quantitative readout signal for the concentrations of glucose.

Mimicking Horseradish Peroxidase Functions Using Cu2+-Modified Carbon Nitride Nanoparticles or Cu2+-Modified Carbon Dots as Heterogeneous Catalysts.

Cu2+-functionalized carbon nitride nanoparticles (Cu2+-g-C3N4 NPs), ∼200 nm, and Cu2+-carbon dots (Cu2+-C-dots), ∼8 nm, act as horseradish peroxidase-mimicking catalysts. The nanoparticles catalyze the generation of chemiluminescence in the presence of luminol/H2O2 and catalyze the oxidation of dopamine by H2O2 to form aminochrome. The Cu2+-g-C3N4-driven generation of chemiluminescence is used to develop a H2O2 sensor and is implemented to develop a glucose detection platform and a sensor for probing glucose oxidase. Also, the Cu2+-C-dots are functionalized with the β-cyclodextrin (β-CD) receptor units. The concentration of dopamine, at the Cu2+-C-dots' surface, by means of the β-CD receptor sites, leads to a 4-fold enhancement in the oxidation of dopamine by H2O2 to yield aminochrome compared to that of the unmodified C-dots.

Concatenated logic gates by amplified chemiluminescence of hemin/G-Quadruplex DNAzyme based on a nonlinear hybridization chain reaction

A nonlinear hybridization chain reaction (non L-HCR) is presented here, in which series of toehold-mediated strands hybridization and branch migration reaction initiate in the presence of a trigger DNA. It leads to self-sustained assembly of double-stranded substrates into fractal nanostructures. The formed fractal nanostructures were about 10μm length×1.5μm wide×30nm high. Furthermore, the 3′ part (TAGGGTTGGGCGGGATGGGT) of Gx DNA are exposed and ready to combined with hemin to form hemin/G-quadruplex DNAzyme, which could amplify the generation of chemiluminescence (CL) in the presence of luminol and H2O2. Under optimal conditions, the CL intensity linearly increased with the concentration of the trigger DNA from 0.5×10−6 to 1.0×10−11M and the detection limit is 7.0×10−12M. In this assay, three-input concatenated logic gates operating as a biocomputing keypad-lock security system also have been successfully constructed. When the inputs are all introduced the “lock” opens. This simple non L-HCR design realizes the fractal nanostructures construction, CL detection and logic gates operating. It can be used in the nanotechnology and biological assay.

Mimicking Horseradish Peroxidase and NADH Peroxidase by Heterogeneous Cu2+-Modified Graphene Oxide Nanoparticles

Cu2+-ion-modified graphene oxide nanoparticles, Cu2+-GO NPs, act as a heterogeneous catalyst mimicking functions of horseradish peroxidase, HRP, and of NADH peroxidase. The Cu2+-GO NPs catalyze the oxidation of dopamine to aminochrome by H2O2 and catalyze the generation of chemiluminescence in the presence of luminol and H2O2. The Cu2+-GO NPs provide an active material for the chemiluminescence detection of H2O2 and allow the probing of the activity of H2O2-generating oxidases and the detection of their substrates. This is exemplified with detecting glucose by the aerobic oxidation of glucose by glucose oxidase and the Cu2+-GO NP-stimulated chemiluminescence intensity generated by the H2O2 product. Similarly, the Cu2+-GO NPs catalyze the H2O2 oxidation of NADH to the biologically active NAD+ cofactor. This catalytic system allows its conjugation to biocatalytic transformations involving NAD+-dependent enzyme, as exemplified for the alcohol dehydrogenase-catalyzed oxidation of benzyl alcohol to benzoic acid through the Cu2+-GO NPs-catalyzed regeneration of NAD+.

Efficient Generation of Chemiluminescence during the reduction of manganese(IV) ions with lactic acid

The kinetics and mechanism of chemiluminescence during the reduction of manganese(IV) ions with lactic acid in an H2SO4–AcOH medium are studied. Kinetic spectrophotometric measurements are used to determine the profiles of change in the concentrations of Mn(IV) and Mn(III) ions during the reaction. The results from kinetic spectrophotometric measurements are compared to the light yield kinetics. The quantum chemiluminescence and chemiexcitation yields reach record values.

A point-of-use microfluidic device with integrated photodetector array for immunoassay multiplexing: Detection of a panel of mycotoxins in multiple samples

For a point-of-use analytical device to be successful in real-world applications, it needs to be rapid, simple to operate and, ideally, able to multiplex the detection of several analytes and samples.Mycotoxin detection in food and feedstock in particular has become increasingly relevant as these toxins, such as ochratoxin A (OTA), aflatoxin B1 (AFB1) and deoxynivalenol (DON), are subject to strict regulations and recommendations in the European Union. A novel, simple, negative pressure-driven device with manually operated magnetic valves was developed and the simultaneous immunodetection of these three mycotoxins was demonstrated via the laminar flow patterning of probes in an area of ≈0.12mm2 and subsequent chemiluminescence generation via HRP-labeled antibodies. The three mycotoxins were detected in less than 20min at concentrations of 100ng/mL for OTA and DON and 3ng/mL for AFB1, spiked in a sample under analysis and simultaneously compared to a toxin-free reference and a standard contaminated with critical target concentrations. The on-chip optical detection was performed in a single acquisition step by integrating a microfabricated array of 25×25µm2 hydrogenated amorphous silicon (a-Si:H) photosensors below the microfluidic chip. The device presented in this work is simple and effective for point-of-use multiplexing of immunoassays and was applied in this work to the screening of mycotoxins.